Mapoly0084s0085



Description

TELOMERIC REPEAT BINDING PROTEIN 1

Reference DB

Database ID Description
OrthoMCL OG5_133795
PANTHER PTHR21717 TELOMERIC REPEAT BINDING PROTEIN
PANTHER PTHR21717:SF9 TELOMERIC REPEAT BINDING PROTEIN 1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB16 transcription factor, MYB Mapoly0084s0085.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0084s0085.1 scaffold_84:895757..900948  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0084s0085.1  

Gene structure:

mRNA scaffold_84:895757..900948  ( - strand )
three_prime_UTR scaffold_84:895757..895771  ( - strand )
CDS scaffold_84:895772..895930  ( - strand )
CDS scaffold_84:896048..896120  ( - strand )
CDS scaffold_84:896674..898715  ( - strand )
CDS scaffold_84:898974..899102  ( - strand )
CDS scaffold_84:899273..899419  ( - strand )
CDS scaffold_84:899581..899807  ( - strand )
CDS scaffold_84:900083..900164  ( - strand )
five_prime_UTR scaffold_84:900165..900320  ( - strand )
five_prime_UTR scaffold_84:900604..900948  ( - strand )

Sequences:

Gene

>Mapoly0084s0085.1
ACTTTCAAAGTTGCCAGCATGGATTTATGCAAAGTGATTGAAACCTCCAAATCTCGGGGCGATTATGATTAGATGATGATGATGATCAGTAGTCTCTGCAAGTAATACCACGATTTTCATCAGATAGAGGAAGCGCCTAGATCTAAGCGGTCGACACATTTATCGGACGGGGAAGCGTCGAAGCCAGTTCGGCAAATTCAAACATGTCAAATTAGCATGTTCCAAATCGCGACCGAATCGCTAGCAGGCGATGCCGAATCGGCCTCGACCGACGATTTGTCCGACCTATGGTTTGAAATTGGCGGATTCTGCAGGAGTTACAGCTCCTCGACCGGAGAAGTGAAGGTGAGCAGGACGCTGCGTGTTGAGCCGATTTTTCAATTTCGATCTGTGGGATTTTCAATGCGTTCGAGGGCGATCTTATGTCGCTTGAGATTGGGTCAGATTTCGCTTGATGTGTCACTCGGTTGAAGTAAATTCTTTTTAGATTGGAAATATCGCCAAGGTTTGATTTTATAGCGCCAATATTTGATGGTTTGTGAGGCTTGCCCTTCTCTAGTCAGTCTGGAGGAGTTCATGATCCTGGAGGGGGCCATTGTGTTCACTAAGCGTCTAAATTTGTGTGCAGGCATCGGGCGCTGTGTGTGAACTTTGCTGCCTTCTTTTGTTCAATTCCGAGGTCTGCCGGGTCGTCAGTGCCCCAGCTGCAATGATACGGGTTTTTTAAGAGTCCGCTTTCGAACAAGCCAGAGGAGGCGAATTTGGAGCCGCGATTGGTAGTAGAATGTTGGCCTCCGTGCTTCCGTGGGAGTGGATACTCGAGAACGTTCTCGACTTGAACGATTTTTCGTTGCCATGCTTGAAGGGTTTGAGTTCCGCCACTTTGCCCTATGTTTCCAGCACTTGTAGGTCGTCAATCTGTCTGTCGGTCGCGACTTTATGGCCCTAGTTTTTGATGTCATATTTGAGTGTAATTCTGGAGATGCTTGACGCATGCTGTTCTGAAAGTTTTTATACGGCCATTAGAGCAGCTTTCGGGTTTTCGTTAAGCAAAAGGTATTTCTGCACACGTACTTCACAGGCGGTTTCAAGGTCCGGCTCAAAATTCTTACAATCCAAATTGGATCGATTGATGGCCCAGAGCTGATCAGCTACATTCCACACATCGAAGACTCGCGGTGCAGCAAGTTGCTTCAGAAGGTGGCTTTGCGTTACTTAGAGGAGATTGTTCTTTCGCGTAACGTGGATCCATGCGCAATCACCCTGATAAAATTCATCGTGAAACCGCACGGTGGATCCAGCCTACGCCGAATTCACAGCCTTAGAGAGTCAGTTGAATATGACTTGATTCTGCGGGTCGAAACTGAGGTACAACAAATGCGACTTGTTTGAAGATGTGCAGCAGTTGATATCTCCCCTGCTTCCTCATTCGAGAAAGTTTCAGTATCAGCTCCACGATTTGGAAACCTTTACATCTTAAAGTACATGAAAAAGAGCTCATGAATTGTTCCCTGCTTTGTTCGTTCCAGGTTGTGCTTACAACTTTGAGGTACCGTGATGAAAGCGGAGGTAGAGATTGGGAAGCATTTCAGGATGCTCTGGAGGAAATTTTTCCCGAATCTTCACTGGAAGCGAGCAAGGCTGGGCGCCGTAAGGAGCTCATTTCCGTGAGTTTGGTGAGACACCTTATGTGCGTTTTGTAAGCACATATAATATTTATCTTCATCGAAGATGAGCAATGAGCTAGAATCATGTATCCGCAAGTGCGAGTCTTTGGCAGTCATATTGTTGTCAGACATACGTAAGTACTAATTATTTGGCTGATATTCGCCGTTTAATTCTTCAGGCCGGTGAGCAGCAAGATGATCTTATTGAAAAAATGCTTCTCAAGTATCCTCTCGAAGACCTTCTGAAAGACCTGTTGCAGTTGATTGAATCCAAGAGGAAATTATTGAAGACCAAGTTTCTCGACCAGGTTAGTCAAGACGTATGTAAGTCTCGTCAATAAATCAAGCTGTGATGTTAATATTGGCCTAGTTTGCACTGATTCCGCATCATTACACCGGGGCGTTGGGGCTCTGGTCTTCAGACTATGAGTGAACTTCACTTAGAGATTACGGTTAAGTGCGGAAATTATTTTTGGTGACGGTAAACTTCCTCGCTGTCCCTCATTAGACGTGGATTTAGCTTCATGATTGTCACGTTCGCTGACATCAACACAACATTTCTACAGCTTGCCAAAGATGTGATCAATGGTTCGTATACTCCTTCAGCTTCTCGCCCCTCTCAGGATGGGTTATCTACCCCAACGAACTTCAAAGAACTATTCATGCTCGATGACTCCCTCAATGAGCATGAAGGTCCAGACTCTCTATATCCAGAAAATGAGGCAGTATTGCCCAGCCGCTCGCATACGATCCTCTCTACACAGAAATTTTACCATCGAAGTCCAGCCGAGAAGTTTGTAAAGGAGCCCTTTGCCGATATCCTGAGTGGTAGGACCACCCCCTCAACGCCTCTCACTGCCAAGGATGGTGAGACGGTTACAAGGAACGAGAAACGAGACCTGCATGTTTGTGAACAGGCCGGAGAGCAAGTCACTCCCGTGGACAGGGTCTTGGTGCATGAGGGACTAAGGTTAGAGATGTCTACGAGTATGGCGGAGGTCGACAAAGTTGCTCGTGGACTCACCAATCAGATCAACGAGCTCGTCGATGATATCGACAAGTTTGCCGTCGATATTCACAGAGTGGCTGTCAACTCGACTGAACAGACGTACTATTCAGGAGAAACAGATCTTGCGCAGGAGGCACAATCAAAAGACCCAAGTTCTTCACCAGCTGAGAAAGGCGAGAAAAGGCCTGCGACTGAAAAGCTGCCCGATGATGATGCTAAAAAGAGGGTGCGTGGTTCAAAAAAGAGGGTGCGTGGTTCTTTGGATACATCTAGAATAGGTGGAGGAAAGGAGAACGAAGAAGGATATTACAGAAAGGCTAGGTTAACCACCGCAGGTAATGAATACACTGCAAGTGCAGAGCGTGAGGATATCCTAACAGCTGACTTGGATTGTCATGCCATCCGCGATGGACCTGAGAACACGAGTGCGACTTCAGTCCACAGGCTTTTTTTGGCTTTCTTGAGGCAATCAAGGCTAGACCAGCTTGTTTGCAAATTCTCTGTACCGGAAGCACCCGTATTCAAAAGTCATTCTTCTGGACTTGACAGCGGGTGCATCATTTGTCGAAGAGGTGGTGTTCTCGTCAAGTGTCACGGGTGCTCTGTCAAAGTTCATGACCGGTGTCTTGACGAGCTACGTATGCGAAATCCTGTTCACGAACGTCACTGGTTTTGTCCATCTTGTGTTGAGCAGCTGACGTTGGGGATTTTGGAATCGGTGAAAGCCGAGGCAGCTACAGCAAGACAGGAGGCTATCGCGTTTGTGCTTGCGACAGGGAAACATCCTGGAGATATTCGTAGTTCATGTGATGGCATCGATGGACGTGCTCAGATGACCAATTCCGCAGTTGCCTTTTCTGTACTACAAGAAGGTGCACACTTAAAGGTCAGTACTAAGGAAGATTTGAAGCAAAACCCGGATCCAGAGTCCAATAACCTGGACTGTGAAGACGATTCAGAGGCAGAAGCAAGAAAGGAATCCGAAGGAATGGTGTCACTCTTAATTGTGCAAGACAGCAATATAGGTTGTCCTAGACCTAAAGATCATTCCCACTCCGTTAAGGAAACAGATTCTCCTCGTAAAGAAATTGAACTTACTGTTAGGCTTGGAACCATCTCAAAGGCTGTTAGTAACCATGAAGATGAGAGACCTGAACCACTGTCCAGCCCTCCTTTACCTACGTCACATTTTAATCCAGATATGAGGGAGCCGTCACCAGTTGCATGTGAGAATGTACTGTCTACAGATGCAACTGAGGAAACGCTTGCAACGAGTACACCTCCTACAGAATGTGTGGAGAAGGATCTTCACGCTAACCCTAGTGGTCGTAACCTGTCTGAGGAAGGACTGAAAGCGCTGTATGATGAGACCAGTGCTGTCAAGCCGAAATTATCCGGCAGTGGAAATCCAAAGTCGTCACAGAAATCACCTATGAACTCGTCGAAACCAGGAGTGGACGAAGGAGACGGACATGACGGGGACCTTGAGGAGGATATTCATAGACACCAAGACGGTGGGGAATGCAGCAAAGAAAACCAACCCAGTGACTTTCCAACCCCGGTTGATGAGCGAACTCCACCGAGGAAAGGTCGCTACAGGTCAGTGCTTCGACACGCCTACTCATGAATATGATCACCTCAAAATGAAGGAAGTCATGTATATTGTAAGGGTTTTTCTTTTCAAATTACCTTGAAAACAGCAGTGAACGAATGTCGATTTGGTCTTAAGAGACATATGGGGAAGCCATCATAGAAAGATTTCCTTTCATATGTAAAGTCAGTAACATTGTTTAGATGAGGTTACCGCCTGTAAGGCGAAAAGTATGTTTATCAAATCTAAGGGGTCTTTTGTGTCTGCAAATCTGGTAGTTGGTTCTGATCAACTGCAGATTCACTGTCCGGCTTTGAGTTTAGACGATGATCTGGTCTGGGATGTTTCATGATATGCTGTGTTAAGTAGATTAGGGACTTGTAGCATAGACTTAACAAGCCGTACCTCTGCTTTATGAATTGGAGCAATTTTTTATGGAGTGTATGTAGTTGTCTTTGACTTATCAAACCGGCCCAGATAGGTAGGACGCTCCTTGTTTCTGCACTCAAGGAGGATGTTTGTCCACGAACTCAAGCAATGTTACCGAATTATCTTGTGCAGGGGAAGGTGGAAGATACCTGGAGTCCGGCGCAGAAATCTACCTTGGTCTGAATCTGAGATATTCGTCTTGAAGGTTAGTCGTGTTTTCCACCAGCCTTGGAATTTTGAGTTGCTGTACTGAAGAATGGTAGTGTTACACTTGAATCAGTAAATGCTGCAACTGATTTAATACTGTGTGTGATGAATGCAGGAGGGCGTACAGAAATTTTCCAATGACGGTCGGGGGTTTCAGTGGAAAAATATTCTAGAGTTTGGTTATGGCAAGTTCGACCCAAGTCGCACAACCGTAGACCTCAAAGATAAATGGCGCAACTTGAGCAAGTATCGTGATACAAGTCCCAGCTCTTAGGCGTCCTCTGATGTG

mRNA

>Mapoly0084s0085.1
ACTTTCAAAGTTGCCAGCATGGATTTATGCAAAGTGATTGAAACCTCCAAATCTCGGGGCGATTATGATTAGATGATGATGATGATCAGTAGTCTCTGCAAGTAATACCACGATTTTCATCAGATAGAGGAAGCGCCTAGATCTAAGCGGTCGACACATTTATCGGACGGGGAAGCGTCGAAGCCAGTTCGGCAAATTCAAACATGTCAAATTAGCATGTTCCAAATCGCGACCGAATCGCTAGCAGGCGATGCCGAATCGGCCTCGACCGACGATTTGTCCGACCTATGGTTTGAAATTGGCGGATTCTGCAGGAGTTACAGCTCCTCGACCGGAGAAGTGAAGGCATCGGGCGCTGTGTGTGAACTTTGCTGCCTTCTTTTGTTCAATTCCGAGGTCTGCCGGGTCGTCAGTGCCCCAGCTGCAATGATACGGGTTTTTTAAGAGTCCGCTTTCGAACAAGCCAGAGGAGGCGAATTTGGAGCCGCGATTGGTAGTAGAATGTTGGCCTCCGTGCTTCCGTGGGAGTGGATACTCGAGAACGTTCTCGACTTGAACGATTTTTCGTTGCCATGCTTGAAGGAGCTGATCAGCTACATTCCACACATCGAAGACTCGCGGTGCAGCAAGTTGCTTCAGAAGGTGGCTTTGCGTTACTTAGAGGAGATTGTTCTTTCGCGTAACGTGGATCCATGCGCAATCACCCTGATAAAATTCATCGTGAAACCGCACGGTGGATCCAGCCTACGCCGAATTCACAGCCTTAGAGAGTCAGTTGAATATGACTTGATTCTGCGGGTCGAAACTGAGGTTGTGCTTACAACTTTGAGGTACCGTGATGAAAGCGGAGGTAGAGATTGGGAAGCATTTCAGGATGCTCTGGAGGAAATTTTTCCCGAATCTTCACTGGAAGCGAGCAAGGCTGGGCGCCGTAAGGAGCTCATTTCCGTGAGTTTGGCCGGTGAGCAGCAAGATGATCTTATTGAAAAAATGCTTCTCAAGTATCCTCTCGAAGACCTTCTGAAAGACCTGTTGCAGTTGATTGAATCCAAGAGGAAATTATTGAAGACCAAGTTTCTCGACCAGCTTGCCAAAGATGTGATCAATGGTTCGTATACTCCTTCAGCTTCTCGCCCCTCTCAGGATGGGTTATCTACCCCAACGAACTTCAAAGAACTATTCATGCTCGATGACTCCCTCAATGAGCATGAAGGTCCAGACTCTCTATATCCAGAAAATGAGGCAGTATTGCCCAGCCGCTCGCATACGATCCTCTCTACACAGAAATTTTACCATCGAAGTCCAGCCGAGAAGTTTGTAAAGGAGCCCTTTGCCGATATCCTGAGTGGTAGGACCACCCCCTCAACGCCTCTCACTGCCAAGGATGGTGAGACGGTTACAAGGAACGAGAAACGAGACCTGCATGTTTGTGAACAGGCCGGAGAGCAAGTCACTCCCGTGGACAGGGTCTTGGTGCATGAGGGACTAAGGTTAGAGATGTCTACGAGTATGGCGGAGGTCGACAAAGTTGCTCGTGGACTCACCAATCAGATCAACGAGCTCGTCGATGATATCGACAAGTTTGCCGTCGATATTCACAGAGTGGCTGTCAACTCGACTGAACAGACGTACTATTCAGGAGAAACAGATCTTGCGCAGGAGGCACAATCAAAAGACCCAAGTTCTTCACCAGCTGAGAAAGGCGAGAAAAGGCCTGCGACTGAAAAGCTGCCCGATGATGATGCTAAAAAGAGGGTGCGTGGTTCAAAAAAGAGGGTGCGTGGTTCTTTGGATACATCTAGAATAGGTGGAGGAAAGGAGAACGAAGAAGGATATTACAGAAAGGCTAGGTTAACCACCGCAGGTAATGAATACACTGCAAGTGCAGAGCGTGAGGATATCCTAACAGCTGACTTGGATTGTCATGCCATCCGCGATGGACCTGAGAACACGAGTGCGACTTCAGTCCACAGGCTTTTTTTGGCTTTCTTGAGGCAATCAAGGCTAGACCAGCTTGTTTGCAAATTCTCTGTACCGGAAGCACCCGTATTCAAAAGTCATTCTTCTGGACTTGACAGCGGGTGCATCATTTGTCGAAGAGGTGGTGTTCTCGTCAAGTGTCACGGGTGCTCTGTCAAAGTTCATGACCGGTGTCTTGACGAGCTACGTATGCGAAATCCTGTTCACGAACGTCACTGGTTTTGTCCATCTTGTGTTGAGCAGCTGACGTTGGGGATTTTGGAATCGGTGAAAGCCGAGGCAGCTACAGCAAGACAGGAGGCTATCGCGTTTGTGCTTGCGACAGGGAAACATCCTGGAGATATTCGTAGTTCATGTGATGGCATCGATGGACGTGCTCAGATGACCAATTCCGCAGTTGCCTTTTCTGTACTACAAGAAGGTGCACACTTAAAGGTCAGTACTAAGGAAGATTTGAAGCAAAACCCGGATCCAGAGTCCAATAACCTGGACTGTGAAGACGATTCAGAGGCAGAAGCAAGAAAGGAATCCGAAGGAATGGTGTCACTCTTAATTGTGCAAGACAGCAATATAGGTTGTCCTAGACCTAAAGATCATTCCCACTCCGTTAAGGAAACAGATTCTCCTCGTAAAGAAATTGAACTTACTGTTAGGCTTGGAACCATCTCAAAGGCTGTTAGTAACCATGAAGATGAGAGACCTGAACCACTGTCCAGCCCTCCTTTACCTACGTCACATTTTAATCCAGATATGAGGGAGCCGTCACCAGTTGCATGTGAGAATGTACTGTCTACAGATGCAACTGAGGAAACGCTTGCAACGAGTACACCTCCTACAGAATGTGTGGAGAAGGATCTTCACGCTAACCCTAGTGGTCGTAACCTGTCTGAGGAAGGACTGAAAGCGCTGTATGATGAGACCAGTGCTGTCAAGCCGAAATTATCCGGCAGTGGAAATCCAAAGTCGTCACAGAAATCACCTATGAACTCGTCGAAACCAGGAGTGGACGAAGGAGACGGACATGACGGGGACCTTGAGGAGGATATTCATAGACACCAAGACGGTGGGGAATGCAGCAAAGAAAACCAACCCAGTGACTTTCCAACCCCGGTTGATGAGCGAACTCCACCGAGGAAAGGTCGCTACAGGGGAAGGTGGAAGATACCTGGAGTCCGGCGCAGAAATCTACCTTGGTCTGAATCTGAGATATTCGTCTTGAAGGAGGGCGTACAGAAATTTTCCAATGACGGTCGGGGGTTTCAGTGGAAAAATATTCTAGAGTTTGGTTATGGCAAGTTCGACCCAAGTCGCACAACCGTAGACCTCAAAGATAAATGGCGCAACTTGAGCAAGTATCGTGATACAAGTCCCAGCTCTTAGGCGTCCTCTGATGTG

CDS

>Mapoly0084s0085.1
ATGTTGGCCTCCGTGCTTCCGTGGGAGTGGATACTCGAGAACGTTCTCGACTTGAACGATTTTTCGTTGCCATGCTTGAAGGAGCTGATCAGCTACATTCCACACATCGAAGACTCGCGGTGCAGCAAGTTGCTTCAGAAGGTGGCTTTGCGTTACTTAGAGGAGATTGTTCTTTCGCGTAACGTGGATCCATGCGCAATCACCCTGATAAAATTCATCGTGAAACCGCACGGTGGATCCAGCCTACGCCGAATTCACAGCCTTAGAGAGTCAGTTGAATATGACTTGATTCTGCGGGTCGAAACTGAGGTTGTGCTTACAACTTTGAGGTACCGTGATGAAAGCGGAGGTAGAGATTGGGAAGCATTTCAGGATGCTCTGGAGGAAATTTTTCCCGAATCTTCACTGGAAGCGAGCAAGGCTGGGCGCCGTAAGGAGCTCATTTCCGTGAGTTTGGCCGGTGAGCAGCAAGATGATCTTATTGAAAAAATGCTTCTCAAGTATCCTCTCGAAGACCTTCTGAAAGACCTGTTGCAGTTGATTGAATCCAAGAGGAAATTATTGAAGACCAAGTTTCTCGACCAGCTTGCCAAAGATGTGATCAATGGTTCGTATACTCCTTCAGCTTCTCGCCCCTCTCAGGATGGGTTATCTACCCCAACGAACTTCAAAGAACTATTCATGCTCGATGACTCCCTCAATGAGCATGAAGGTCCAGACTCTCTATATCCAGAAAATGAGGCAGTATTGCCCAGCCGCTCGCATACGATCCTCTCTACACAGAAATTTTACCATCGAAGTCCAGCCGAGAAGTTTGTAAAGGAGCCCTTTGCCGATATCCTGAGTGGTAGGACCACCCCCTCAACGCCTCTCACTGCCAAGGATGGTGAGACGGTTACAAGGAACGAGAAACGAGACCTGCATGTTTGTGAACAGGCCGGAGAGCAAGTCACTCCCGTGGACAGGGTCTTGGTGCATGAGGGACTAAGGTTAGAGATGTCTACGAGTATGGCGGAGGTCGACAAAGTTGCTCGTGGACTCACCAATCAGATCAACGAGCTCGTCGATGATATCGACAAGTTTGCCGTCGATATTCACAGAGTGGCTGTCAACTCGACTGAACAGACGTACTATTCAGGAGAAACAGATCTTGCGCAGGAGGCACAATCAAAAGACCCAAGTTCTTCACCAGCTGAGAAAGGCGAGAAAAGGCCTGCGACTGAAAAGCTGCCCGATGATGATGCTAAAAAGAGGGTGCGTGGTTCAAAAAAGAGGGTGCGTGGTTCTTTGGATACATCTAGAATAGGTGGAGGAAAGGAGAACGAAGAAGGATATTACAGAAAGGCTAGGTTAACCACCGCAGGTAATGAATACACTGCAAGTGCAGAGCGTGAGGATATCCTAACAGCTGACTTGGATTGTCATGCCATCCGCGATGGACCTGAGAACACGAGTGCGACTTCAGTCCACAGGCTTTTTTTGGCTTTCTTGAGGCAATCAAGGCTAGACCAGCTTGTTTGCAAATTCTCTGTACCGGAAGCACCCGTATTCAAAAGTCATTCTTCTGGACTTGACAGCGGGTGCATCATTTGTCGAAGAGGTGGTGTTCTCGTCAAGTGTCACGGGTGCTCTGTCAAAGTTCATGACCGGTGTCTTGACGAGCTACGTATGCGAAATCCTGTTCACGAACGTCACTGGTTTTGTCCATCTTGTGTTGAGCAGCTGACGTTGGGGATTTTGGAATCGGTGAAAGCCGAGGCAGCTACAGCAAGACAGGAGGCTATCGCGTTTGTGCTTGCGACAGGGAAACATCCTGGAGATATTCGTAGTTCATGTGATGGCATCGATGGACGTGCTCAGATGACCAATTCCGCAGTTGCCTTTTCTGTACTACAAGAAGGTGCACACTTAAAGGTCAGTACTAAGGAAGATTTGAAGCAAAACCCGGATCCAGAGTCCAATAACCTGGACTGTGAAGACGATTCAGAGGCAGAAGCAAGAAAGGAATCCGAAGGAATGGTGTCACTCTTAATTGTGCAAGACAGCAATATAGGTTGTCCTAGACCTAAAGATCATTCCCACTCCGTTAAGGAAACAGATTCTCCTCGTAAAGAAATTGAACTTACTGTTAGGCTTGGAACCATCTCAAAGGCTGTTAGTAACCATGAAGATGAGAGACCTGAACCACTGTCCAGCCCTCCTTTACCTACGTCACATTTTAATCCAGATATGAGGGAGCCGTCACCAGTTGCATGTGAGAATGTACTGTCTACAGATGCAACTGAGGAAACGCTTGCAACGAGTACACCTCCTACAGAATGTGTGGAGAAGGATCTTCACGCTAACCCTAGTGGTCGTAACCTGTCTGAGGAAGGACTGAAAGCGCTGTATGATGAGACCAGTGCTGTCAAGCCGAAATTATCCGGCAGTGGAAATCCAAAGTCGTCACAGAAATCACCTATGAACTCGTCGAAACCAGGAGTGGACGAAGGAGACGGACATGACGGGGACCTTGAGGAGGATATTCATAGACACCAAGACGGTGGGGAATGCAGCAAAGAAAACCAACCCAGTGACTTTCCAACCCCGGTTGATGAGCGAACTCCACCGAGGAAAGGTCGCTACAGGGGAAGGTGGAAGATACCTGGAGTCCGGCGCAGAAATCTACCTTGGTCTGAATCTGAGATATTCGTCTTGAAGGAGGGCGTACAGAAATTTTCCAATGACGGTCGGGGGTTTCAGTGGAAAAATATTCTAGAGTTTGGTTATGGCAAGTTCGACCCAAGTCGCACAACCGTAGACCTCAAAGATAAATGGCGCAACTTGAGCAAGTATCGTGATACAAGTCCCAGCTCTTAG

Protein

>Mapoly0084s0085.1
MLASVLPWEWILENVLDLNDFSLPCLKELISYIPHIEDSRCSKLLQKVALRYLEEIVLSRNVDPCAITLIKFIVKPHGGSSLRRIHSLRESVEYDLILRVETEVVLTTLRYRDESGGRDWEAFQDALEEIFPESSLEASKAGRRKELISVSLAGEQQDDLIEKMLLKYPLEDLLKDLLQLIESKRKLLKTKFLDQLAKDVINGSYTPSASRPSQDGLSTPTNFKELFMLDDSLNEHEGPDSLYPENEAVLPSRSHTILSTQKFYHRSPAEKFVKEPFADILSGRTTPSTPLTAKDGETVTRNEKRDLHVCEQAGEQVTPVDRVLVHEGLRLEMSTSMAEVDKVARGLTNQINELVDDIDKFAVDIHRVAVNSTEQTYYSGETDLAQEAQSKDPSSSPAEKGEKRPATEKLPDDDAKKRVRGSKKRVRGSLDTSRIGGGKENEEGYYRKARLTTAGNEYTASAEREDILTADLDCHAIRDGPENTSATSVHRLFLAFLRQSRLDQLVCKFSVPEAPVFKSHSSGLDSGCIICRRGGVLVKCHGCSVKVHDRCLDELRMRNPVHERHWFCPSCVEQLTLGILESVKAEAATARQEAIAFVLATGKHPGDIRSSCDGIDGRAQMTNSAVAFSVLQEGAHLKVSTKEDLKQNPDPESNNLDCEDDSEAEARKESEGMVSLLIVQDSNIGCPRPKDHSHSVKETDSPRKEIELTVRLGTISKAVSNHEDERPEPLSSPPLPTSHFNPDMREPSPVACENVLSTDATEETLATSTPPTECVEKDLHANPSGRNLSEEGLKALYDETSAVKPKLSGSGNPKSSQKSPMNSSKPGVDEGDGHDGDLEEDIHRHQDGGECSKENQPSDFPTPVDERTPPRKGRYRGRWKIPGVRRRNLPWSESEIFVLKEGVQKFSNDGRGFQWKNILEFGYGKFDPSRTTVDLKDKWRNLSKYRDTSPSS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>