Mapoly0085s0044



Description

ZINC FINGER PROTEIN 622

Reference DB

Database ID Description
KOG KOG2785 C2H2-type Zn-finger protein
OrthoMCL OG5_127615
PFAM PF12171 Zinc-finger double-stranded RNA-binding
PFAM PF12756 C2H2 type zinc-finger (2 copies)
PANTHER PTHR13182 ZINC FINGER PROTEIN 622

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-13 transcription factor, C2H2-ZnF Mapoly0085s0044.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0085s0044.1 scaffold_85:332186..334965  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0085s0044.1  

Gene structure:

mRNA scaffold_85:332186..334965  ( + strand )
five_prime_UTR scaffold_85:332186..332466  ( + strand )
CDS scaffold_85:332467..332571  ( + strand )
CDS scaffold_85:333103..333687  ( + strand )
CDS scaffold_85:333937..334106  ( + strand )
CDS scaffold_85:334224..334445  ( + strand )
CDS scaffold_85:334648..334807  ( + strand )
three_prime_UTR scaffold_85:334808..334965  ( + strand )

Sequences:

Gene

>Mapoly0085s0044.1
GAGAGCGAGAGCGACATTGCCTCTGTAGGTGTAGGTCGTAGTCGTGGTGGAGCACGTACGTCTGTGGCTTCGAGTTGTTTTTTAACCTCGGCCGCTCGCTCGATTTGGTCCAGGATCGTTTGTTGCGGCTCGACGGGTTTGTGCGTTTTAGGACGGGAGGAGGAATTTGGTGTCGAGAAATCTCGACTTTTGAAGCGTTGGAACTTTCACCGCAGGGCAGGGCAGGGAGTTATTGTTAGGGTTTAAGTCGCTGCGAATTGGGAGGTTTTCGGGTCGCTGAGATGCCGGGTCTGGCGTGCAACGCTTGTAATGTAGAGTTTCAGGATGAGACAGGGCAGAAATCTCACTATCGGTCTGACTGGCACCGGTACAATTTGAAGAGAAAGGTACTCAACTGTGATAAGAATCACGTTATGATAGATTGTGGCTTGGTTATTGGGGTACCTCGTTTCAATGCCGAGGGAATTCATCTCATATTAGTTCTGTTTGTAGCTTGAGGTGTGGTGGCGCTTTACTGTTTGATAGCGGAGTGCTGCTTTTGGATATGTACTCGTTGTGCAGTATGCAAGTATTGAATTCGATTTGAAGTTCGAATTCAATACTTGCATATATGTGGAAGGCTGAGCTTTTGAGCGTTTCGCTGCAGTTTGAATCGGCTGGGTCCACGAGCATGTAGCTTATCGTCATGCAGTGCCAGTCTAGAATGAAATGTCATTTTCATTCCTTCTTTTCACGCACAGCAGACCATCAACCATCAGAGTATTACAAAGCTTGAATGGATAGGAGTGGAAGTTCACTAGCATTGAATTACCCCCCAACTTGGATTAAGATTTGTAGATCATGATCACAGCGTAAACACATTGAACTTTTTTGTCGGGCCCTTTGGTTGCGGTTGCTCATCAAATTGTATTCTGCAGGTCGCTGGAGTTCCCGGGGTTACTGAAGGACTTTTCAACCTGAGGTTAGAGGCATTGGCTGCAGAGAAGAAGAAGGCGGAAGGACAGCGTCTGCTTTACAAGTGCTCACTTTGTGGTAAAGAGTATTCAACAGAGAAAGCCCACATTCAGCATTTGCAGTCCAAGCTCCATATCAGCAAGGCTGCCAGTCTTGAAGATTCGTCAGGGGCAGCTGTTGCTGTTGTGAGACCCGCACCAGCTCGGCCAGTGAAGGAGCAAGTGCCCGTTGTCGAAGCAAAGGAGGAAGACGAAGAGACCGAGACCGAGAGCAGCGATGAGGAATGGGAAGAAGTTGATGGAGATGAGGCCGAGGATGCTGTCATGGAGCTTCGGGGCAATGAGGAGGGTTCTGACGACAGGGCTGGATCTAGTGGTGAAGTAATTGATGAAGAATGGGACGCAAGCCGCTGTTTTATTTGTGACTTCCAGCCAGATGGAAGTATCGAAGGTTGTGTAGAGCACATGCACAAAGTCCATGGATTTTTCCTCCCTGATGCCGAATTCTTGAAGGATCCGCAAGGAATGCTTAGTTACCTTGGTCTCAAGGTACGCTTATATCATGCTCTTAAGTCCAGTCTGTGAAGGACATCATGTCCAGGAGTTTTGATTTAAGTCTTGCGAGTTTATGATCCATCAGATGCTCTTGTTCAGGTTTGAGGTTTGTAATAGTAAGGGGACTAATTGTCTGAACATTCTCTCGAAGGGACTCAAAGAGTCGTCACAGTGGAAGAACTATGGTGTACATTGTTTAAGCGGATTGTTGCTCAGCTGAGAAGGTGTTTTGTCCTGACATAGGTAACGAAAGGATTCATGTGCCTATTTTGTGACGATAGAGGTAAGCGCTTCCAAAGCTTAGAAGCAGTGCGGAAGCATATGGTGTCTAAAAGTCATTGCAAGTTGCGTTATGGCGACGGAGAAGGTGCAGCAGAGGAAGAACTGGAAGAATACTACGATTTCAGTAGCAGGTAATGTGTAATTGTCTTTGATTTTATTTATCCACTTGGCACATCTGATTACAGACAATTCTGGAGCGTTTAGCAACCGCCGTTCACAGCCTGACCTGTTTTGTGTATGTGTATCAGCTATGTTGGCGCAGACGGGAAACAGCTTGTGAAAATCGAAGATGGAGATGACGCACCCGCCGTGTTAACCAGTGGTGGCCTTGAGCTTATGTTGAAGGGCGATGATGCTGAAGGAAAGGCATCTAGAACACTTGGTTCGAGGGAGTTATTCCGCTACTACAAACAAAAGCCCAAACCATCTGATCAAAGAGATGGAATGGTCGTCAACGCAGTTATTGCAAGGTATGGCTGGCACTAGATAATTTTTTTATGAAATTTACAGACGGTTTCAGCCATAAAGACGTCTGTCTTGCATGTTGTATTTAGGTTGTCTTAAATGGTTCCATAGATAGCATAGATTCTTCGTACTGCTCGTTCCAGTTTATTGAAAAACATTTCGTTTGGTTTCCTTGAACACTACTAATTCGTGACACTCAATTTTCAGATACCGGAGTATGGGACTAGCAACTAGAGAACCAGGGGCAAAATATCCCAAGAGTGCAGATGGGAAGAAAACTAGACATTCCAGATTAGACCTTATGCGTACACAGATTGGTATGAGGAATAATGTCAACTGGGACTTGCCCAGAAATGTACCATATTAGGAGGAACGGTTGCAGAGTATCTCTGCTGTCCCGTCTCTTCAGCAAGCTAGCTTACGAAATAACGAAATTCAATATTTTTGCAAGCAATTTTTATCAACGTGAAAAATATACTTCTCAACAATAGTAAAAATTACGCAGGCTACCAATCTCAAATTCCA

mRNA

>Mapoly0085s0044.1
GAGAGCGAGAGCGACATTGCCTCTGTAGGTGTAGGTCGTAGTCGTGGTGGAGCACGTACGTCTGTGGCTTCGAGTTGTTTTTTAACCTCGGCCGCTCGCTCGATTTGGTCCAGGATCGTTTGTTGCGGCTCGACGGGTTTGTGCGTTTTAGGACGGGAGGAGGAATTTGGTGTCGAGAAATCTCGACTTTTGAAGCGTTGGAACTTTCACCGCAGGGCAGGGCAGGGAGTTATTGTTAGGGTTTAAGTCGCTGCGAATTGGGAGGTTTTCGGGTCGCTGAGATGCCGGGTCTGGCGTGCAACGCTTGTAATGTAGAGTTTCAGGATGAGACAGGGCAGAAATCTCACTATCGGTCTGACTGGCACCGGTACAATTTGAAGAGAAAGGTCGCTGGAGTTCCCGGGGTTACTGAAGGACTTTTCAACCTGAGGTTAGAGGCATTGGCTGCAGAGAAGAAGAAGGCGGAAGGACAGCGTCTGCTTTACAAGTGCTCACTTTGTGGTAAAGAGTATTCAACAGAGAAAGCCCACATTCAGCATTTGCAGTCCAAGCTCCATATCAGCAAGGCTGCCAGTCTTGAAGATTCGTCAGGGGCAGCTGTTGCTGTTGTGAGACCCGCACCAGCTCGGCCAGTGAAGGAGCAAGTGCCCGTTGTCGAAGCAAAGGAGGAAGACGAAGAGACCGAGACCGAGAGCAGCGATGAGGAATGGGAAGAAGTTGATGGAGATGAGGCCGAGGATGCTGTCATGGAGCTTCGGGGCAATGAGGAGGGTTCTGACGACAGGGCTGGATCTAGTGGTGAAGTAATTGATGAAGAATGGGACGCAAGCCGCTGTTTTATTTGTGACTTCCAGCCAGATGGAAGTATCGAAGGTTGTGTAGAGCACATGCACAAAGTCCATGGATTTTTCCTCCCTGATGCCGAATTCTTGAAGGATCCGCAAGGAATGCTTAGTTACCTTGGTCTCAAGGTAACGAAAGGATTCATGTGCCTATTTTGTGACGATAGAGGTAAGCGCTTCCAAAGCTTAGAAGCAGTGCGGAAGCATATGGTGTCTAAAAGTCATTGCAAGTTGCGTTATGGCGACGGAGAAGGTGCAGCAGAGGAAGAACTGGAAGAATACTACGATTTCAGTAGCAGCTATGTTGGCGCAGACGGGAAACAGCTTGTGAAAATCGAAGATGGAGATGACGCACCCGCCGTGTTAACCAGTGGTGGCCTTGAGCTTATGTTGAAGGGCGATGATGCTGAAGGAAAGGCATCTAGAACACTTGGTTCGAGGGAGTTATTCCGCTACTACAAACAAAAGCCCAAACCATCTGATCAAAGAGATGGAATGGTCGTCAACGCAGTTATTGCAAGATACCGGAGTATGGGACTAGCAACTAGAGAACCAGGGGCAAAATATCCCAAGAGTGCAGATGGGAAGAAAACTAGACATTCCAGATTAGACCTTATGCGTACACAGATTGGTATGAGGAATAATGTCAACTGGGACTTGCCCAGAAATGTACCATATTAGGAGGAACGGTTGCAGAGTATCTCTGCTGTCCCGTCTCTTCAGCAAGCTAGCTTACGAAATAACGAAATTCAATATTTTTGCAAGCAATTTTTATCAACGTGAAAAATATACTTCTCAACAATAGTAAAAATTACGCAGGCTACCAATCTCAAATTCCA

CDS

>Mapoly0085s0044.1
ATGCCGGGTCTGGCGTGCAACGCTTGTAATGTAGAGTTTCAGGATGAGACAGGGCAGAAATCTCACTATCGGTCTGACTGGCACCGGTACAATTTGAAGAGAAAGGTCGCTGGAGTTCCCGGGGTTACTGAAGGACTTTTCAACCTGAGGTTAGAGGCATTGGCTGCAGAGAAGAAGAAGGCGGAAGGACAGCGTCTGCTTTACAAGTGCTCACTTTGTGGTAAAGAGTATTCAACAGAGAAAGCCCACATTCAGCATTTGCAGTCCAAGCTCCATATCAGCAAGGCTGCCAGTCTTGAAGATTCGTCAGGGGCAGCTGTTGCTGTTGTGAGACCCGCACCAGCTCGGCCAGTGAAGGAGCAAGTGCCCGTTGTCGAAGCAAAGGAGGAAGACGAAGAGACCGAGACCGAGAGCAGCGATGAGGAATGGGAAGAAGTTGATGGAGATGAGGCCGAGGATGCTGTCATGGAGCTTCGGGGCAATGAGGAGGGTTCTGACGACAGGGCTGGATCTAGTGGTGAAGTAATTGATGAAGAATGGGACGCAAGCCGCTGTTTTATTTGTGACTTCCAGCCAGATGGAAGTATCGAAGGTTGTGTAGAGCACATGCACAAAGTCCATGGATTTTTCCTCCCTGATGCCGAATTCTTGAAGGATCCGCAAGGAATGCTTAGTTACCTTGGTCTCAAGGTAACGAAAGGATTCATGTGCCTATTTTGTGACGATAGAGGTAAGCGCTTCCAAAGCTTAGAAGCAGTGCGGAAGCATATGGTGTCTAAAAGTCATTGCAAGTTGCGTTATGGCGACGGAGAAGGTGCAGCAGAGGAAGAACTGGAAGAATACTACGATTTCAGTAGCAGCTATGTTGGCGCAGACGGGAAACAGCTTGTGAAAATCGAAGATGGAGATGACGCACCCGCCGTGTTAACCAGTGGTGGCCTTGAGCTTATGTTGAAGGGCGATGATGCTGAAGGAAAGGCATCTAGAACACTTGGTTCGAGGGAGTTATTCCGCTACTACAAACAAAAGCCCAAACCATCTGATCAAAGAGATGGAATGGTCGTCAACGCAGTTATTGCAAGATACCGGAGTATGGGACTAGCAACTAGAGAACCAGGGGCAAAATATCCCAAGAGTGCAGATGGGAAGAAAACTAGACATTCCAGATTAGACCTTATGCGTACACAGATTGGTATGAGGAATAATGTCAACTGGGACTTGCCCAGAAATGTACCATATTAG

Protein

>Mapoly0085s0044.1
MPGLACNACNVEFQDETGQKSHYRSDWHRYNLKRKVAGVPGVTEGLFNLRLEALAAEKKKAEGQRLLYKCSLCGKEYSTEKAHIQHLQSKLHISKAASLEDSSGAAVAVVRPAPARPVKEQVPVVEAKEEDEETETESSDEEWEEVDGDEAEDAVMELRGNEEGSDDRAGSSGEVIDEEWDASRCFICDFQPDGSIEGCVEHMHKVHGFFLPDAEFLKDPQGMLSYLGLKVTKGFMCLFCDDRGKRFQSLEAVRKHMVSKSHCKLRYGDGEGAAEEELEEYYDFSSSYVGADGKQLVKIEDGDDAPAVLTSGGLELMLKGDDAEGKASRTLGSRELFRYYKQKPKPSDQRDGMVVNAVIARYRSMGLATREPGAKYPKSADGKKTRHSRLDLMRTQIGMRNNVNWDLPRNVPY

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>