Mapoly0086s0035



Description

B3 DNA binding domain

Reference DB

Database ID Description
GO GO:0003677 DNA binding
OrthoMCL OG5_153318
PFAM PF02362 B3 DNA binding domain
PANTHER PTHR31140 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABI3A B3-domain transcription factor abscisic acid-insensitive 3 Mapoly0086s0035.1 Public
MpB3-6 transcription factor, B3 Mapoly0086s0035.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0086s0035.1 scaffold_86:316537..326929  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0086s0035.1  

Gene structure:

mRNA scaffold_86:316537..326929  ( + strand )
five_prime_UTR scaffold_86:316537..317411  ( + strand )
CDS scaffold_86:317412..319070  ( + strand )
CDS scaffold_86:320753..320857  ( + strand )
CDS scaffold_86:321814..321914  ( + strand )
CDS scaffold_86:322081..322127  ( + strand )
CDS scaffold_86:322258..322334  ( + strand )
CDS scaffold_86:324860..325252  ( + strand )
three_prime_UTR scaffold_86:325253..326929  ( + strand )

Sequences:

Gene

>Mapoly0086s0035.1
TGCTCCACCTGTGGGATGCTCTAGAGTTTTCCGCCAAAGTACGAGAAAGGCGTGGGCTATGTCGCTAGACGACGTGGAGGTCATGTAGGTCGCGGCATAATTCTCAGGGTCGCAGGGCGACGTGGACGCGATGGTTCGGACATTTGCTGCCAGCGGAAGCGCTCCCAGAATGTCTGCTTGATAGGGCGTCTGGCGCCGTTCTCCTCATCCAGTCTCGCGCCTGCTCTCGGGCGCCCGACGCCAAGTCTGGAGCCCTTCGGGCGCTCCGGACTTGCAGGCATCAGCGTGTCACATGACCAGCGGAGAGCCTCCAAATCGTCAAAATGCAAGTGCAGAACAACTTCCTTTTGTCGTCTTCGAGTGTGCGTGGCCTTGATTCCCCACTTTTCCTCGCCCTCCGGTCCGTCGGATGCTCATCTGGCATGTTTCGCCCTCCCAACCATTATAGTTTCCAGGGTATGGTGTACTCTGCCGCATCGATAGGGACTTTATTTCCAAATTTTCTATTCGATTGCGAAACCTTGGGGTACTTCGCCCTCCCTGAACATCCGTCGTTGCCATTGGATACAGCGATATCCTGGTGATGGTAGGAATGGGGTGGAAGCAATCACCGTTAGGGATGCTTCGTGTGGGAGGAGAAGGCATCTTGTAAGCCCGGCGAGCCTGTCACTCATCGAGGTATTGTCGCGAAAAAGACTGCCTGCATCCTTCCGGAGACAGGAGTCAGAGACAGTACATCGATGTACTCCCGAAAAAGTTTCCGATGCATCTCAACCTCAACCAGGATTGTCGCCCTTGCCGTCTGACTCGGAGGTTGGGTGTACAGTGTGCAGTGTGAAGGATTTTGCTCACGGAGGCGAGTTCGCACTAATTCGATGGAGGGTCACGCTCCAGTAGACCATGTACAGAATCGGGCTGTCAACTCATGGTTTTCCCAGAGACCGAGAACGCACTCGGATCATCGCGGTGTTAAGAGGGAGATGGCGGACGTCTCGCAATATGTAGGGTCCTGGGTGGACGATCCGAAAGAACGGCAACGCATTTCCCCCGAAGCCGAGGCGGGAGGATGGCTTCGTGATGAACCCGTCGATGGCCACAACAGTTCACAACGTTCTGGATCATCTGCCGCGTTTCCGTGTGGGAACCCGGCGAGTCTAGGCTCCGTGGACGTAGATGGAAACACGATGTATTCAGGCACGAAGAACAGCAACTTTAATGTTTCCCAAGTTTCTACATCGTCCCCTTCTGATGCTCTGCCCTCTGGGTCCCCAGGTCGTTTACCGGATCTGACCGAGGACGCCGCGGGTCCTCCTAATCAATCGTGTACTCCTGTGTATTTCCAGGAGCAGAGGGCGAACCTCTTTGCTCAACTGAGGGGCATTCGCATCAAGGAAAGCGTTATTCGCAGTGCTATAGAGAGGCTTGGCGGTGGACAGAAAGGTCTACGAGCTGTGATAAAGGTGATCATCTTTTGGTTGAGGAGCCGCACAACCTCGTCACAGACGAGTGAACAATTTAGCATCCAAGAACCCTTGGCTCCTCTTTCCACAGAGGAAATTGAAAAGTTACCTTGGAACCACGGTGGTAGTTTGGAGAATAGCTTCGGGACCAGCCAAGAGAATGGGAGCGGTTGCACTGTCAGTGGGGATTTGCAGTTTCTTATGAACTCATCTTTTCTGGATGGAGCCCCAGGTAGCGTCTCATGTACAGGCGAGTTGAAGCTAGGAGACGGCGAGTATGCAGAAACAAAGAATCACGATATACAGTTGTTAGCGATCAACGAGCCTGGAGCGTTGAGTGGAATGCTAGATGACATGGGTGTGCAGGAACTGGGAGTACAGGGTTCAGGGTCTTTATTGGATGTCCAGCCGTCGCTTGTAGCAGGGTGGAGCCATCAGACTTTTATTACAGATGAACGCCAGCATCGACTTGGGATTCGCAGGCTTTCTCCTTCTCCTGAGCGAGTCACTCTGTCTACGGACTTGGGCTACGAGGACACCCAGTTTCACCGAAACAAGATTAGACGGCTTTCTCCATCGGGCAGTTCGTCTACGAGTTCGTGTGACGTTCCAGCGTACTCGAGTATTTCCCAATCTCTTCCCGATGTCATGGGGTTCTCCAACAATCCCTTTGCTCCAGGTGGTCCCTTTAGTATCAGCCCCTCTAGTCCGAGTTTGGACCACCACGCTATGGACATGGGCACTTTCAGTTCCTTTGGAATGCAAGGAACTAGTTTGATTGACGAGGCTACTATTGGGGGCACTGCTGCTATGTATACCGACAGTACAATGGAGCGTGAGCAGTCAGGGGCTCGATTGGGACTTGTAGGGAAGAGCAAGACTACTCCTGCTGCGCATACTCGACTGGCACGAAAGAATAGAATGGATCGGAACAGGAGATCTGCCTCTCTCCATCCTACTCGTTCTACACAAAGTGGAGCTCCTGGTGTAGGAGTAACTGGAAGTGGGTGGGCGCCCTCATCCGGAGCTTTACGCACGCCTCATTCTCAAACTCTCCCTGGAGGAGAGGGACAGGTAACCCACAGGATTCCCACTCAGTGTTCTTCCCTACGATTTTGTTAGAGGTTGGCCCATTGTTAGGTCTCTTTGTCACTCCTTGTTTCAGTTTTCCCAACATGTTCAAATTGTGTCCATGTTTTGGCTGTGAAATTTGGATTGAGATGTGTGTGTCTGCTGCACAATATGTAACTACTAGTAGTCGATGTATAGCGGGAAACGTTGCGGCTTCATGACTCAAGTGGAGTGCACACCCCGCCTTGGTTAGACGCCTGCGCTTATTCATATCTAGAACGATATCGAATAGAATTTTATCTTCATTATAATACTTCTTCGATTGGGGACTTCTTCGATAGGGGAGTTCTTTCTGGCGCTTGGAGAACTTGCATTGGCCTTCGAACGAAAATCTTTGCTCTATAGCCATGGTTCCGTCCAAGCCTCCGTCCAAGCCGGTCTCCTCGTACTGCACTGAGAGAAATAAGAACCAATGGAAGAGTGTAAACTGGTCAATTGAAGTAGACATCAATACTTTTACAATATCAACCACCACAAACTAGCTTCTTTCTGCACCAGTCAAGGGGATTTATATCATTCCCTGTTGTACGCCCCTCTTACTATGAAAAGTAACCATGTCTCTCCTTTCCCGAAGATTACGCTACGTGTTGTGAAGTTCTTCGATGTCATATACCTTCCCGCATCACTTCTTGATTTTAAAAAATCGAATACCCTCGCAAGGTTAGCACGCATCTCTTTTGTGATTGTTTGAGAAAATAGCTGTGTATGTCTCAGTCTTAGCATCTTCGGAACGGTCTGTCTACATTTGGAAATTCCCTACTGCATGTTTGCTGTCTTCGAGCTGAATTCAGTTATGGGAATTTGGCAGAGCCTGGAGTTGGAAATTTCTATCTTGGAAATTTACCCAGAACGTCTTTTGTCATTACGGAAAGCTTCTTATGAGCCTTTGTGCTTAGCTAGAAAATATCATAATTACTTCATAGCTGATTCGCCTTCTTTATAAAGATTATCTTGGCAGTCTTGTCAAAGTGGGCCCTTTGTTGGAGAAAACAGTCATTATATATTTTAGTACCCTCATTCGTTCCCAGGTCTCTACACTTTGACTTGTGGGGTTGTTTCACTGGGCCTTTTTGATTTGTATATCACTGAAATTTCATCAGGAGTATAGCTCGTATTTGGATGGAATCTCTTTCATGGAGTTGAGATAGCAAGATTCTACCAACCGTTACAATTTATTGCAGACGTATGAATTGATGAATTCTGATTAAAAACCGATTCTTATTTGGCCTCTCTGCTTCTTTCAAATCATCCTTGTTTTGCTTGGCTGAACTAGAAGCGTACTTACTTAGTAGTACCCACTAATTACATTGACCGGCTGATTGTCGGATTTAGCAATTGCATGGGTCAGCGAGTCTCGTAACTTGGTCAGTTAACTCACACCCCACGCAAATTATTCTGTAGAAACATGATCAGAGCATCAACTTTCATTTCGTAGGCATGTGCGCAAAGACTCTCTTCCTCGGTCTAGGCAGATCTGTTTTCGAACTCTAGAGTGTAGGGAAGGTTAGAGGTCATATATAATGTTTAAGTGTCTAGCCTTGGATGGTTGTCTCTTGCGCACGGAGATTTTTATTCACTTGTTACCACCTTGTATTTTTGGCTGATGCCATTTGATTTGACTGCAGACACGGGTGAAGGACCGACGTGATATGGACCGTTTACAATATCTGCTCCAAAAGATGTTGAAGCCAAGCGATGTCGGCAATCTTGGCCGAATAGTTCTTCCAAAGGTTCGAACATGTCCATTCTCTTTTATTGACATCAGGACAAGAGTAGGCCCTGTGCAGGCATGTAGCGAACGTCAGGAGTTAGGAGCTTTAGAAGAGGTTTTGGCCTTTCCTGGTGCACCGCAATCTATGCATGCTGGTGTTTCGCAACCGTACATCCCTGCCTTATGCCATCTTTTCTTGTTTGGTCTTTATTCTTATCTCTTATGCGAGTGGTGAGAGGAGAAAGTTGGCACGTCTCATTCACTTTCAAGCACATGAATGTGGTTCGTTATATTTACGTCCAGAGCATATTGCGCAGTTGTCGGGCCAGTCTTAAAATATCTTCCTAATTAGGAATAATGTACTTGAAAGTTTGAAAATTAGGATCAATGTACTTTTAATTGCACCTATACTGTATGTGACCATAGAGTGTAGGTGCAGAGTTTGCATCTAGAGTCGGTCTTTGTGGGCACGGTATCCGTTTATGTCCACTGACAGCCGGTCTCCTCTATGTCGTTAAAGCTATTTCACTCCCTCCGCTCTTCGTATTGATGCATCCGTTTGTCTTTCCTTTTCTTACAGCTCCAGTTCATGCACGACACGTCCTACTTTTATTATGGTCTTCTTGTTTTATGCTATGTAGCACATGTCGTCAGCACTTCTAGGGCATATCACCCAGATTTCTGTTGCTGTCTCTTTCACGCTAAGCCCTTCATCATTTACTATTTTGTCTGGCTCGCCTGCTGATAGCTTTATAATTTATCCTACTTTAGTCGCCAGGATTGTTGTTACTTGATGCTGTGAGGGACAAGGGGAGTCGAGACTGCTAGTTGCCACAGCTTGTGATACTTCTCATTTTTACCGAAGAACGGTTCTGTCAGTTGTGATGGATTTATGTTTATCTTGTGGATGGCAAGCGCTGGCACTTATCTTTTTTTGTATACTTCCCTGCTTAAGATGTATCTTCCATAACGCAGAAAGACGCCGAAAGCCACTTACCGTGGCTAGGAGCGAGGGAAGGAATTCCATTCCCCTGCGAAGACTTTGATACCGGAGATAAATTAAATCTCAGATACCGGTTGGTATATCCTTACTTCATTCTGCTTTCGGAAAGTAATTTCAGCAAATCAACAAATAACTGTAGGTGGAATATGTAAAGGTATGAGTTTTCAATAATACAATCGAGATTGACAAACTTGGATTTATCACTGCCTCTAGTCACTGAGAGTCACTTTTCTTTTCAGGTTCTGGCCCAACAACAAGAGCCGTATGTATTTACTGGAAAATACTGGTAGGTATCTGTTCGCTCTGTTCCACTTAGAAACTCTGATTTTGTTGCTGTTTTATATATTTAGTAGCAAAGTTGTCGGTTCCAGTCTGCAGATTGATCCTGTGATTTATAGTGTAATGTTCTGCTGCAGGCGAGTTCGTCAAAAAACACAATCTTGAAGAAGGAGACCGATTGATGATATATAAGAATGTACAGGACGATACTTTCGTGAGTCTCTTCTGCCTTCTTGATTATCATTTGAGAGAAGGCTGATAAATGTGCATCATAGTCTATCAGAAACTGCATCGAGTCGCATTTCAAGCAGCATCAGTGTCTCCAATTTTCGGTATTTGTAAGTTGTTTATAGTCGCCTCTTGGAACTTGCCACTTGACCTAGATGCATGCTTTGAAATACGGTAACTCTTCCTAGAAGCTTCCCTCTCCTTCTGGAGTTACAGCGGCTGTGATCCATCTTCACTATTTCAGGACGCGACGCGTCTGTGTTTGCGCGATGTAACTTTCTCTAGTGTAGGTACTAATTGATTGTATACATTTGTTCAGTTTGTGGGGTGACGCTTGCTTTAGGGATTATGTAAGTGATATGAGTGTACGGTTACTGATGGTGTTATAGTATCTTGTTTTGGGTTAGTCATTCGTGGACGCAACGTTATACTCATTGTCAACCAAGTAACTTGCATTCAGGAGTCGAGAATTATTATCGCGGTTTGTAACCCCTGTCGTCATTTTTTCACTTGGAATATGAGTTGCCTGCACAAATTTTTGTTATCGTTACCTGTTTTGGGTCTTTCCAAGGAAAGTGGGGCTTTGGCACTTTTTGTATAACATTTCTGTCCTTCCGTAGTTCATCGAAGAATTTTCTCTGGAGTCATGTTGATCATTTAGCACGTTGTTGCTAGATTCTACTCTGTTTTGCTTGGAAGTCATCCACTTACTTCCAGAGACGCGTGATACCAACACCTTTTACTTGCATAACTCATGGATTTCTGATACTGCTGAACTCCTTTGTTCAGTTGTACATGATATTCATTCCTTTAAGACTTGCATTTCACATGTGCGCTCACATAGTTAATTTGCCATTCACTTCGCAGACGTTACAAAGGGAGGTTCGTCTACCTGTTTGAGACAATGCCCAATTTGTAGTAAGATACCCACAGTTGATTCAGTAGCAATACAGTTGTTCAGTCAGGTGAATCTTCTTTTGTTTGTTGAAACGGGTTGCAGTTGCTCATACTCTTTTGTTTTCATTTGTCTGACGATGTAACACTCTGAAAGTCTATCACACTATCATACCGTTTATTTAATGTCGTACACATATGCCTCTCATTGCGTTAATGTTAATCAAGTTCTGTTGCGCTTCTAAATTAGAGTGGTTATTGTAATCGTTGACGGTCGTTGTTTGTCATTGTTAATGACTGTGTCAAAAATTATCCTAGTATGAATGTGTCTAATCATTCGCACCTTCCGGTTAAGCTACTCGTTCGAGGAAAAATGGCACCTCTCTCATCGATTGAGAGGATGCAGTGTCCGTTCTACGCAACTTCTGAAACAGGTTATATGACTATTCGCGCCCTGATGATTTTGTGTGTTGATGTCGTTGTATCGCGTGAAACGTTTAGTTTACCGCTCTTTGCTCTCCTCTTCTCATTTCATCCTTTGTGAGGAAAATATAATCTGGAGGAGATAATAATTGGCTGTGTACACTCCTGTGATTCATGTTCATGCATGTGAAGGTGAAACCTGTACAGATAATTCTGCCCAATCCGTTGAAAGCTCAGCTTGTTTAAAGGGCAGAAACACTTCTGCCCGTGGCAGAAGTGTTTATGTCCGCAGTGATTTAGTTTTGGAAGTCAGCCGCAGAATGCATGGTTCATGCTGTCGTAGTTGGTACTGTCTGTCCGTCTTCACTTTTTATGTACACAAGTTTGCACCCCTTAGGCTTGCCTGTTAGGCTTTTTCAATGGCGCCCTCTGGGCTCTGGTGGTAGCTTGTTGAGTATATAATTTATGCAAATTAGGGAATCACCTGGCGCGATGATGGGTAGAAACCTATACACCCGGGTTTACACTGATGAGTCCATCGTCTTGATAATCGTTACCGCCCCCAGTTGCATTTACTGTTGTTGACTTTCCTTATTAGAGAAGTTCATTTCGTTTGGCCTTGGACTGTTCAGTACATACATAGTAAACGATTTTCTCAGGCTCTGGATCGACTTTCAAGTGGTCGTTCATATTTGACATATTCTCTCACTCTGCCTCCACGGAAAGCTGGGTTTGCTTATTTTCTCACTGGTTGAATGCTTGGAATTGATCATGATTGAAGTTTGTTAACAATGCTTTATGCGAAGTTAGACCCTTCTGCATCAGCTAATAATATTCATGGTTGCATATGAATCGTTACCTCACTTTTGGTGACGAGACGCAGTCTTCTAACTAACACGCAAGTGACATCTGTCGTCCTCATAGATGACAACAACCTTGAGAGTAGGTACTGATGCCCAAGTTTGTAGTTTCGTTTCGTTTCTTTCTCCCAAAGTGGGATGTCCAACGTAATATGGCGTACACTCTGAAGTACTTGCATTTCCATGTTTTCTTACGTCTGTCATGGTGTTCAAATTTGTGTGTTAAGTCGAGTAAATCCATCAAGCGATGAAACTGGTCTTGAACCAGATTGGTGTAGTGCATGTGTCGTAACGCAAATAGTTTCACCATTCTAAGACATTGCTCTGTGGGCAGATCATTCGAGGTCGCAAGGCGCAGGACTGTGTGGATCCCACTTCAAGTCAAGCCCAGGCTGATGACAAGGAGGTGCGAGGGAAGGAGATATCTTCGCAAGGACCTCCTCTTTCTGGTAGTAGCAGTGGTACGTCATCAGTCGATATGGATGTTGTACCTGACGCTCCTCTAGAGCATACTGTTTCTGGACAAGAAGGATCGCCAGCTTCTGGTGTTACGGCTGTCACCTTAATAACGTCGCAAGATGATTTATTGAATTTTGCGGATCTACCGGATGCACCAATGGGCGATGGGACTGAGCCGTTAGTCCGATTCCCCAGTTTGGAGGCTTTTGAGGACTTACTGGGCATGGTTCCTGCTGTCTTGAGCCAGCAGCAGCAGGAAACTCTATAATCGGAGGCGGGAAGGACACTAAGTTAGGTTTCCACGAAAAAACATTGGTCGTTCTTCAATGTTAGGATCTGGACAGGGGAGAAGGTGGAGCCCTTTCCTAGATGTACCTTGTGTCGCGTCACGTGGACCTTCCATGCCCTCATCTTGTACGAATTTGACATTTGATATGTGGTGATATTCGGCGTGATATAAGTCCGATCAGGGCTTTATGATACTGTGATAAAAGACGGTTAGAAAGAAGTTGGATTCAACTGTTGGTAATTGTAAATCACTCTAGTGTGGTAGTTTGTTCCGTGGAACTTGTCTTCAAATGAGGGAGTTTCTGCTTTAACTCAGGAAAGCAGTAATCTCGTGTTCTAGTTAGCTGGGCGTAGTCAAACGTTCTGATCAACGGAATGGTGGATACTGGTATGGTACCGTGTTTATTGGTGGACGAGGGATGATCCCCAACCAAGTCTGTTTTTCTCGTTTTTGTGATGAGAATATCTGCTGCCCCGATCTAGGAGTAGTCAGAGGAGTTCTCTTTTACAACAGAGAGCTTCTCCTACCTTTCCCGGAAATATTATTGAGGGGAACTGTACTTGCAGTAGCAAGTTTTGTGACAGGCTTTACGTGTAAGGCAGTGTATACACGTCTGCAGCTTCTTTTCTTCTCGGAGGACTCTATTTGTGTGCTGTCTCAGGTGGAGCATTGTCACAGTGAATTGTGGACGAAGCGCAGAGGAAATAACCGAAGGTACCGTTTTTCCCTTGTAAGATGGAGGTCGTTGACAGACTTTATGCAGCTGAGTGGACAGGTTTTCAGTGGAGCATATCACCGCTGTATTTGGCCAGTCCTAGAGACAGACCGGCGTGAAAATTATTTACTTGAATCTTCCACTCGTGACCTGTCTGCTCCAGAGAAGTTCTGGGGAATCAGCTAATGCAGCCCTTTATCAGCAACAGCTGCAGACAACCTTCAGGGAAAGGAGAGCTTACTCAGATAGTTCTCACCACTTGCATCAGGTAACCTTTCGGAAATAAGCTGTCACGTCTGGTCCTTATCAATTCTTTCCGATAATGATCGGGAATTGCTCGTAAACAGCTACTCATACCAGACGCTCGTACAGCTTAGTGTTGCTGCTCGTGAACTTCAAGAAACTAGCTCTTTGAAGACTTATTTCGTGTTGAACCTCTAGAGTGGCCTGACTATTCAAAAGATCAGATGCCCAGTTTTGGTGTATCAAGTGCGGATGTTAATACCGAGGTTGCTCTCTGATTGACTGAGCGACTGATGCACTTCCTCAAGTACTGGTCAAGCATTATATGATATGAAGTAACTTGTCTGTAAATTACAGACAAGTTACTACGTTCAATCTCAGAGTGCCGCCCCACCGAAAGTTGTAGAACTATTACATACTATTGTTCCCTCGGATTTGATGTCTCATGCACACAGCTTGGCACGGAGGCGGTCGTCTAGAGTTGAACGGGGAGAATGGAAGTTTGTTTACTAGCTCACAAATTTCTTCTCTCAGGAAGAATACACAGCGTTACTTTACCTGAAATTCCTATGAAAGTTTGAATGTGTATGAACCCTTTCTATATCAAGTCACTTTTTGTCTTCATTTGGTCTTTCAAAAGCACATTGGAATAATTATGATGCGAGGGGAACATGAATTCCTGTGGGAATTTTTTTTGC

mRNA

>Mapoly0086s0035.1
TGCTCCACCTGTGGGATGCTCTAGAGTTTTCCGCCAAAGTACGAGAAAGGCGTGGGCTATGTCGCTAGACGACGTGGAGGTCATGTAGGTCGCGGCATAATTCTCAGGGTCGCAGGGCGACGTGGACGCGATGGTTCGGACATTTGCTGCCAGCGGAAGCGCTCCCAGAATGTCTGCTTGATAGGGCGTCTGGCGCCGTTCTCCTCATCCAGTCTCGCGCCTGCTCTCGGGCGCCCGACGCCAAGTCTGGAGCCCTTCGGGCGCTCCGGACTTGCAGGCATCAGCGTGTCACATGACCAGCGGAGAGCCTCCAAATCGTCAAAATGCAAGTGCAGAACAACTTCCTTTTGTCGTCTTCGAGTGTGCGTGGCCTTGATTCCCCACTTTTCCTCGCCCTCCGGTCCGTCGGATGCTCATCTGGCATGTTTCGCCCTCCCAACCATTATAGTTTCCAGGGTATGGTGTACTCTGCCGCATCGATAGGGACTTTATTTCCAAATTTTCTATTCGATTGCGAAACCTTGGGGTACTTCGCCCTCCCTGAACATCCGTCGTTGCCATTGGATACAGCGATATCCTGGTGATGGTAGGAATGGGGTGGAAGCAATCACCGTTAGGGATGCTTCGTGTGGGAGGAGAAGGCATCTTGTAAGCCCGGCGAGCCTGTCACTCATCGAGGTATTGTCGCGAAAAAGACTGCCTGCATCCTTCCGGAGACAGGAGTCAGAGACAGTACATCGATGTACTCCCGAAAAAGTTTCCGATGCATCTCAACCTCAACCAGGATTGTCGCCCTTGCCGTCTGACTCGGAGGTTGGGTGTACAGTGTGCAGTGTGAAGGATTTTGCTCACGGAGGCGAGTTCGCACTAATTCGATGGAGGGTCACGCTCCAGTAGACCATGTACAGAATCGGGCTGTCAACTCATGGTTTTCCCAGAGACCGAGAACGCACTCGGATCATCGCGGTGTTAAGAGGGAGATGGCGGACGTCTCGCAATATGTAGGGTCCTGGGTGGACGATCCGAAAGAACGGCAACGCATTTCCCCCGAAGCCGAGGCGGGAGGATGGCTTCGTGATGAACCCGTCGATGGCCACAACAGTTCACAACGTTCTGGATCATCTGCCGCGTTTCCGTGTGGGAACCCGGCGAGTCTAGGCTCCGTGGACGTAGATGGAAACACGATGTATTCAGGCACGAAGAACAGCAACTTTAATGTTTCCCAAGTTTCTACATCGTCCCCTTCTGATGCTCTGCCCTCTGGGTCCCCAGGTCGTTTACCGGATCTGACCGAGGACGCCGCGGGTCCTCCTAATCAATCGTGTACTCCTGTGTATTTCCAGGAGCAGAGGGCGAACCTCTTTGCTCAACTGAGGGGCATTCGCATCAAGGAAAGCGTTATTCGCAGTGCTATAGAGAGGCTTGGCGGTGGACAGAAAGGTCTACGAGCTGTGATAAAGGTGATCATCTTTTGGTTGAGGAGCCGCACAACCTCGTCACAGACGAGTGAACAATTTAGCATCCAAGAACCCTTGGCTCCTCTTTCCACAGAGGAAATTGAAAAGTTACCTTGGAACCACGGTGGTAGTTTGGAGAATAGCTTCGGGACCAGCCAAGAGAATGGGAGCGGTTGCACTGTCAGTGGGGATTTGCAGTTTCTTATGAACTCATCTTTTCTGGATGGAGCCCCAGGTAGCGTCTCATGTACAGGCGAGTTGAAGCTAGGAGACGGCGAGTATGCAGAAACAAAGAATCACGATATACAGTTGTTAGCGATCAACGAGCCTGGAGCGTTGAGTGGAATGCTAGATGACATGGGTGTGCAGGAACTGGGAGTACAGGGTTCAGGGTCTTTATTGGATGTCCAGCCGTCGCTTGTAGCAGGGTGGAGCCATCAGACTTTTATTACAGATGAACGCCAGCATCGACTTGGGATTCGCAGGCTTTCTCCTTCTCCTGAGCGAGTCACTCTGTCTACGGACTTGGGCTACGAGGACACCCAGTTTCACCGAAACAAGATTAGACGGCTTTCTCCATCGGGCAGTTCGTCTACGAGTTCGTGTGACGTTCCAGCGTACTCGAGTATTTCCCAATCTCTTCCCGATGTCATGGGGTTCTCCAACAATCCCTTTGCTCCAGGTGGTCCCTTTAGTATCAGCCCCTCTAGTCCGAGTTTGGACCACCACGCTATGGACATGGGCACTTTCAGTTCCTTTGGAATGCAAGGAACTAGTTTGATTGACGAGGCTACTATTGGGGGCACTGCTGCTATGTATACCGACAGTACAATGGAGCGTGAGCAGTCAGGGGCTCGATTGGGACTTGTAGGGAAGAGCAAGACTACTCCTGCTGCGCATACTCGACTGGCACGAAAGAATAGAATGGATCGGAACAGGAGATCTGCCTCTCTCCATCCTACTCGTTCTACACAAAGTGGAGCTCCTGGTGTAGGAGTAACTGGAAGTGGGTGGGCGCCCTCATCCGGAGCTTTACGCACGCCTCATTCTCAAACTCTCCCTGGAGGAGAGGGACAGACACGGGTGAAGGACCGACGTGATATGGACCGTTTACAATATCTGCTCCAAAAGATGTTGAAGCCAAGCGATGTCGGCAATCTTGGCCGAATAGTTCTTCCAAAGAAAGACGCCGAAAGCCACTTACCGTGGCTAGGAGCGAGGGAAGGAATTCCATTCCCCTGCGAAGACTTTGATACCGGAGATAAATTAAATCTCAGATACCGGTTCTGGCCCAACAACAAGAGCCGTATGTATTTACTGGAAAATACTGGCGAGTTCGTCAAAAAACACAATCTTGAAGAAGGAGACCGATTGATGATATATAAGAATGTACAGGACGATACTTTCATCATTCGAGGTCGCAAGGCGCAGGACTGTGTGGATCCCACTTCAAGTCAAGCCCAGGCTGATGACAAGGAGGTGCGAGGGAAGGAGATATCTTCGCAAGGACCTCCTCTTTCTGGTAGTAGCAGTGGTACGTCATCAGTCGATATGGATGTTGTACCTGACGCTCCTCTAGAGCATACTGTTTCTGGACAAGAAGGATCGCCAGCTTCTGGTGTTACGGCTGTCACCTTAATAACGTCGCAAGATGATTTATTGAATTTTGCGGATCTACCGGATGCACCAATGGGCGATGGGACTGAGCCGTTAGTCCGATTCCCCAGTTTGGAGGCTTTTGAGGACTTACTGGGCATGGTTCCTGCTGTCTTGAGCCAGCAGCAGCAGGAAACTCTATAATCGGAGGCGGGAAGGACACTAAGTTAGGTTTCCACGAAAAAACATTGGTCGTTCTTCAATGTTAGGATCTGGACAGGGGAGAAGGTGGAGCCCTTTCCTAGATGTACCTTGTGTCGCGTCACGTGGACCTTCCATGCCCTCATCTTGTACGAATTTGACATTTGATATGTGGTGATATTCGGCGTGATATAAGTCCGATCAGGGCTTTATGATACTGTGATAAAAGACGGTTAGAAAGAAGTTGGATTCAACTGTTGGTAATTGTAAATCACTCTAGTGTGGTAGTTTGTTCCGTGGAACTTGTCTTCAAATGAGGGAGTTTCTGCTTTAACTCAGGAAAGCAGTAATCTCGTGTTCTAGTTAGCTGGGCGTAGTCAAACGTTCTGATCAACGGAATGGTGGATACTGGTATGGTACCGTGTTTATTGGTGGACGAGGGATGATCCCCAACCAAGTCTGTTTTTCTCGTTTTTGTGATGAGAATATCTGCTGCCCCGATCTAGGAGTAGTCAGAGGAGTTCTCTTTTACAACAGAGAGCTTCTCCTACCTTTCCCGGAAATATTATTGAGGGGAACTGTACTTGCAGTAGCAAGTTTTGTGACAGGCTTTACGTGTAAGGCAGTGTATACACGTCTGCAGCTTCTTTTCTTCTCGGAGGACTCTATTTGTGTGCTGTCTCAGGTGGAGCATTGTCACAGTGAATTGTGGACGAAGCGCAGAGGAAATAACCGAAGGTACCGTTTTTCCCTTGTAAGATGGAGGTCGTTGACAGACTTTATGCAGCTGAGTGGACAGGTTTTCAGTGGAGCATATCACCGCTGTATTTGGCCAGTCCTAGAGACAGACCGGCGTGAAAATTATTTACTTGAATCTTCCACTCGTGACCTGTCTGCTCCAGAGAAGTTCTGGGGAATCAGCTAATGCAGCCCTTTATCAGCAACAGCTGCAGACAACCTTCAGGGAAAGGAGAGCTTACTCAGATAGTTCTCACCACTTGCATCAGGTAACCTTTCGGAAATAAGCTGTCACGTCTGGTCCTTATCAATTCTTTCCGATAATGATCGGGAATTGCTCGTAAACAGCTACTCATACCAGACGCTCGTACAGCTTAGTGTTGCTGCTCGTGAACTTCAAGAAACTAGCTCTTTGAAGACTTATTTCGTGTTGAACCTCTAGAGTGGCCTGACTATTCAAAAGATCAGATGCCCAGTTTTGGTGTATCAAGTGCGGATGTTAATACCGAGGTTGCTCTCTGATTGACTGAGCGACTGATGCACTTCCTCAAGTACTGGTCAAGCATTATATGATATGAAGTAACTTGTCTGTAAATTACAGACAAGTTACTACGTTCAATCTCAGAGTGCCGCCCCACCGAAAGTTGTAGAACTATTACATACTATTGTTCCCTCGGATTTGATGTCTCATGCACACAGCTTGGCACGGAGGCGGTCGTCTAGAGTTGAACGGGGAGAATGGAAGTTTGTTTACTAGCTCACAAATTTCTTCTCTCAGGAAGAATACACAGCGTTACTTTACCTGAAATTCCTATGAAAGTTTGAATGTGTATGAACCCTTTCTATATCAAGTCACTTTTTGTCTTCATTTGGTCTTTCAAAAGCACATTGGAATAATTATGATGCGAGGGGAACATGAATTCCTGTGGGAATTTTTTTTGC

CDS

>Mapoly0086s0035.1
ATGGAGGGTCACGCTCCAGTAGACCATGTACAGAATCGGGCTGTCAACTCATGGTTTTCCCAGAGACCGAGAACGCACTCGGATCATCGCGGTGTTAAGAGGGAGATGGCGGACGTCTCGCAATATGTAGGGTCCTGGGTGGACGATCCGAAAGAACGGCAACGCATTTCCCCCGAAGCCGAGGCGGGAGGATGGCTTCGTGATGAACCCGTCGATGGCCACAACAGTTCACAACGTTCTGGATCATCTGCCGCGTTTCCGTGTGGGAACCCGGCGAGTCTAGGCTCCGTGGACGTAGATGGAAACACGATGTATTCAGGCACGAAGAACAGCAACTTTAATGTTTCCCAAGTTTCTACATCGTCCCCTTCTGATGCTCTGCCCTCTGGGTCCCCAGGTCGTTTACCGGATCTGACCGAGGACGCCGCGGGTCCTCCTAATCAATCGTGTACTCCTGTGTATTTCCAGGAGCAGAGGGCGAACCTCTTTGCTCAACTGAGGGGCATTCGCATCAAGGAAAGCGTTATTCGCAGTGCTATAGAGAGGCTTGGCGGTGGACAGAAAGGTCTACGAGCTGTGATAAAGGTGATCATCTTTTGGTTGAGGAGCCGCACAACCTCGTCACAGACGAGTGAACAATTTAGCATCCAAGAACCCTTGGCTCCTCTTTCCACAGAGGAAATTGAAAAGTTACCTTGGAACCACGGTGGTAGTTTGGAGAATAGCTTCGGGACCAGCCAAGAGAATGGGAGCGGTTGCACTGTCAGTGGGGATTTGCAGTTTCTTATGAACTCATCTTTTCTGGATGGAGCCCCAGGTAGCGTCTCATGTACAGGCGAGTTGAAGCTAGGAGACGGCGAGTATGCAGAAACAAAGAATCACGATATACAGTTGTTAGCGATCAACGAGCCTGGAGCGTTGAGTGGAATGCTAGATGACATGGGTGTGCAGGAACTGGGAGTACAGGGTTCAGGGTCTTTATTGGATGTCCAGCCGTCGCTTGTAGCAGGGTGGAGCCATCAGACTTTTATTACAGATGAACGCCAGCATCGACTTGGGATTCGCAGGCTTTCTCCTTCTCCTGAGCGAGTCACTCTGTCTACGGACTTGGGCTACGAGGACACCCAGTTTCACCGAAACAAGATTAGACGGCTTTCTCCATCGGGCAGTTCGTCTACGAGTTCGTGTGACGTTCCAGCGTACTCGAGTATTTCCCAATCTCTTCCCGATGTCATGGGGTTCTCCAACAATCCCTTTGCTCCAGGTGGTCCCTTTAGTATCAGCCCCTCTAGTCCGAGTTTGGACCACCACGCTATGGACATGGGCACTTTCAGTTCCTTTGGAATGCAAGGAACTAGTTTGATTGACGAGGCTACTATTGGGGGCACTGCTGCTATGTATACCGACAGTACAATGGAGCGTGAGCAGTCAGGGGCTCGATTGGGACTTGTAGGGAAGAGCAAGACTACTCCTGCTGCGCATACTCGACTGGCACGAAAGAATAGAATGGATCGGAACAGGAGATCTGCCTCTCTCCATCCTACTCGTTCTACACAAAGTGGAGCTCCTGGTGTAGGAGTAACTGGAAGTGGGTGGGCGCCCTCATCCGGAGCTTTACGCACGCCTCATTCTCAAACTCTCCCTGGAGGAGAGGGACAGACACGGGTGAAGGACCGACGTGATATGGACCGTTTACAATATCTGCTCCAAAAGATGTTGAAGCCAAGCGATGTCGGCAATCTTGGCCGAATAGTTCTTCCAAAGAAAGACGCCGAAAGCCACTTACCGTGGCTAGGAGCGAGGGAAGGAATTCCATTCCCCTGCGAAGACTTTGATACCGGAGATAAATTAAATCTCAGATACCGGTTCTGGCCCAACAACAAGAGCCGTATGTATTTACTGGAAAATACTGGCGAGTTCGTCAAAAAACACAATCTTGAAGAAGGAGACCGATTGATGATATATAAGAATGTACAGGACGATACTTTCATCATTCGAGGTCGCAAGGCGCAGGACTGTGTGGATCCCACTTCAAGTCAAGCCCAGGCTGATGACAAGGAGGTGCGAGGGAAGGAGATATCTTCGCAAGGACCTCCTCTTTCTGGTAGTAGCAGTGGTACGTCATCAGTCGATATGGATGTTGTACCTGACGCTCCTCTAGAGCATACTGTTTCTGGACAAGAAGGATCGCCAGCTTCTGGTGTTACGGCTGTCACCTTAATAACGTCGCAAGATGATTTATTGAATTTTGCGGATCTACCGGATGCACCAATGGGCGATGGGACTGAGCCGTTAGTCCGATTCCCCAGTTTGGAGGCTTTTGAGGACTTACTGGGCATGGTTCCTGCTGTCTTGAGCCAGCAGCAGCAGGAAACTCTATAA

Protein

>Mapoly0086s0035.1
MEGHAPVDHVQNRAVNSWFSQRPRTHSDHRGVKREMADVSQYVGSWVDDPKERQRISPEAEAGGWLRDEPVDGHNSSQRSGSSAAFPCGNPASLGSVDVDGNTMYSGTKNSNFNVSQVSTSSPSDALPSGSPGRLPDLTEDAAGPPNQSCTPVYFQEQRANLFAQLRGIRIKESVIRSAIERLGGGQKGLRAVIKVIIFWLRSRTTSSQTSEQFSIQEPLAPLSTEEIEKLPWNHGGSLENSFGTSQENGSGCTVSGDLQFLMNSSFLDGAPGSVSCTGELKLGDGEYAETKNHDIQLLAINEPGALSGMLDDMGVQELGVQGSGSLLDVQPSLVAGWSHQTFITDERQHRLGIRRLSPSPERVTLSTDLGYEDTQFHRNKIRRLSPSGSSSTSSCDVPAYSSISQSLPDVMGFSNNPFAPGGPFSISPSSPSLDHHAMDMGTFSSFGMQGTSLIDEATIGGTAAMYTDSTMEREQSGARLGLVGKSKTTPAAHTRLARKNRMDRNRRSASLHPTRSTQSGAPGVGVTGSGWAPSSGALRTPHSQTLPGGEGQTRVKDRRDMDRLQYLLQKMLKPSDVGNLGRIVLPKKDAESHLPWLGAREGIPFPCEDFDTGDKLNLRYRFWPNNKSRMYLLENTGEFVKKHNLEEGDRLMIYKNVQDDTFIIRGRKAQDCVDPTSSQAQADDKEVRGKEISSQGPPLSGSSSGTSSVDMDVVPDAPLEHTVSGQEGSPASGVTAVTLITSQDDLLNFADLPDAPMGDGTEPLVRFPSLEAFEDLLGMVPAVLSQQQQETL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>