Mapoly0088s0049



Description

GB DEF: BHLH TRANSCRIPTION FACTOR

Reference DB

Database ID Description
OrthoMCL OG5_164256
PFAM PF14215 BHLH-MYC and R2R3-MYB transcription factors N-terminal
PANTHER PTHR13902 SERINE/THREONINE-PROTEIN KINASE WNK (WITH NO LYSINE)-RELATED
PANTHER PTHR13902:SF5 GB DEF: BHLH TRANSCRIPTION FACTOR

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH19 transcription factor, bHLH Mapoly0088s0049.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0088s0049.1 scaffold_88:538090..547345  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0088s0049.1  

Gene structure:

mRNA scaffold_88:538090..547345  ( + strand )
five_prime_UTR scaffold_88:538090..539167  ( + strand )
CDS scaffold_88:539168..539262  ( + strand )
CDS scaffold_88:540547..540756  ( + strand )
CDS scaffold_88:541206..541320  ( + strand )
CDS scaffold_88:541847..541888  ( + strand )
CDS scaffold_88:542048..542104  ( + strand )
CDS scaffold_88:542433..544604  ( + strand )
CDS scaffold_88:544818..544919  ( + strand )
CDS scaffold_88:545945..546121  ( + strand )
CDS scaffold_88:546215..546340  ( + strand )
CDS scaffold_88:546604..546822  ( + strand )
three_prime_UTR scaffold_88:546823..547345  ( + strand )

Sequences:

Gene

>Mapoly0088s0049.1
GTTTTCAGTCAGCTCGCTTGTTTTTTGGCCTAGGTGGTACTACGAGTGTGCCGCTGCCAGAGAGATCGCAGGGAAAGCAGTATACTACGATGAGTCATCATAGGGAAAATACATACGTGGGGGCGATATGGGAAGAGCCTAAAAAGGATAGAAAAGTTGGAGAGCAAACCAAGTGGATAGGTAGTAATAAGTAGTGCAGATGGAGTCCTTCTTACCTTCCGGAATCCGATCACGTCCTTTGATAATGGCTGGCTCCCATAGCTCGCACGTTTGCAAATCCAAGTTTACATCCGTATGTGCGTAAAGAAGCAAACGGGGGGGAACAAGAGAGATACACGGCGCAAAATACGGGACTTGCAGTCGATGTAGATCTTTACAATACTGTACACAGATACTTGTGGTCTTTCTTTCCGCATTCGTGTCTGCTTTCGTCCGTCGATTGTGATTTTTATTTACCGATTCCAGGCCCCACAGGTCCCTTAAACATCCGGACCCCATTGATAGATCTCTTTTGATTTTTACCACTGTACACGCAGTCAATTCCTCTCAGTTATAGCCCCCTCGTACAGCAGCGGCTCAGATTTCCTCTGTTCTTACGAATCGTTTGTCTGAGTGTCTCGTCTTCAAGCGGTACAAGGCCAGTTTCAAGAAGGCCTCATTGTTTGCTTCCTTGGCTCCTCTCAGTACAGCTACTTCGTCCTGTCGCTCATCCAGGCCCGTGCAGTGTGCACCGTCACTCAAAGGTTCAGAACAACAACAACTACGCTAGGATCGCCGGTGCTCTTCTTCTGCGAGTTTGTGTCGTCGAGTCGTTCGGAGCAGTGTCGAGCAGAGCAGGGCAGTGATTTGACACATCTGTTGATGGTGTAGAGGAATTTCTCTGGAATGTGCCGGGAGTAGCTATGGCAGGGTGCGGGAACATCAGTTTGCGGTGCCATGCTTCCAAGAAGTCCTCTGTGAGGTACGACCATTACTGGAGGTCCTGTCCTCGAGACGAGACGCCGAAAGCTACTGGATCTTCTGGTGTACTTGAATTTTAAACGAGGCATGAGGAGGTGAGATCTGCAGACAGGGCGCAATGGCAATGGTGCTGCAGCAGGCGTTGAGGGGACTGTGTTACAAATCAGGATGGTCTTACGCTGTCTTTTGGAAGCTCAAGCGCCGCAGTCGAATGTGAGTTTTTTTTTTGAACCGATATTTTCTCAACCTTTTGAGCTTCGAACTTCTCTTCTTCCGCTGATTGCGAGTTAAATAAAACTTGCACTCACGCAGGATCCTTGAGTGACTCAAATTCAGTGTCCTGAGTCCAGCTAGCTAGTCGGTGCAGACTTTACATTGGGCGGTGTTTTCAATCAACATGGCCGCTGTGCTTTCCAGTGTTGTTTGCTGTCAAATTCCGACATTCATTGGATACTTATATGGAGTCTCAACCTGACCTGATGCCAATTGTTGATCGTAGCCGGTCAACATCCTCTTGAACAGTTCAGCCATAGAGCTGGTGTTCGCAAGTAAAAGTCTTTTACTCGGCTCCCAAAAACATCGTCGATTTCTTTGTCCTCCCTTCTATGTGATCGGCACAAAGTCGAAAAAGCAGAGACACTTTCGGAGCGTAATGACATCACCCAAAGTGTGAATTGGCCTCCGTATTACTACAATCTTTCTACACAATCGTTTTTACAATCGTTCTTCTTTTCTTGCAGCTTGCCTATTTTCATTATCTATTTAATGTGATAAATCTGAGGATTAGCTTCTTTTCCTTGTCTTCTGACGATATGGAATAACGGCATTCGCCTGGATATTAGTGACACAAACACGTATTAGTGGCGCATATGAGTTGCCACTACTAGTTGTATCTGTCGCCTAAACTTCACATCTGCATCATGCACAGGAGGCAAAGTAACATAGGAACTATTCTTGTTCGTAAATTTAGCGTTCTGCAAGCTATCGAAGTACTGCAAATGTATAACGTTTCGTTAAGAGGAATTGTTCTCTAGGAGACTTTGTTTCCCTCAGTTCGTTTTGAGAACTTACTTATGGTGGAGGGGTTCATAGGTGTAGATCACAGTCTCTAAACTCTGCGCAGTGACCATGCGGCGTATGAATATCGGGTGGTTCAGGCCGGCCCTTGATCTTTTGCTTCCGCTTAAGACTGTCTATTGTGGCTCGATGCGCTTCGAGCTAGAGCGGTTGGAGGATTAAGCTCGGAAGGTCATTAGGATTTTGTAAGCAAAAGCAGTCGAGGTTGTGTTATTGTGATCTGGACAGTCATCCCAGTGGTCTTTGGGCAGATCTCAATCCCAAAGAAATAAAGCACCGACTGTAATGAGCGATGCCTTTCTCGTGGAGTGTGAAATTTTTTGGTGTGCTATTCATGCTCCAGGGGAATGGTCAGTTGTGGTCAGTTGTGGTTGCTCGAAGCGATTGTACTAATGACGGATATGGGGTGCTTGATGGCAGGGTTCTTACATGGGAAGATGGGTTCTACGAATTCTCCAAGCCCTCTGCAGTATCCAGTTTCGACTCTATGCAGACGACCGGTGGCTTTAACATGATGAACAGCGGCAGACCCGGAACAGATCCCTTAGCGCCAGATGTTCCAGGTGCTGAGGATGAAATCGGTCTGGCTGTGGCCAGGATGTCGTACCATGTCTACTCTCTCGGAGAAGGGTATACTTCTGTTACCATGGGGAACTTTTGCTTGTTATCAGTTGGTATAGATCATACCTCTGGATTATACTTATAACTAATGTTGAGTATGCTTTTTGTGCAGGTTTTTTTTATCTTAAGATTCAGTTGTATATTGCATATGCCAGCTTTCTCTGTTTTTGGCACTGTCTATTTCCCAGCCAGGTGTCTTCATGTTCCTGGAGGGTGATGATGCATGCAAATGGTGAAAGTTCTGTTATGACTCGATTCATTCCATCTTGTGTATCGAACGAATCTAGTGATTCATCTGTGTTCTTTGTGTTTTTCTTAGTGCTTCGACGGCCTAGCAATTCTAGCAAAGTATCGAAGCAGTTAGCTTGCACAGTTGGCATTCTGAGCTTTAATCGCCTTTGTAGAATGGCCCTTGTTTGTTTTCAATTCATCAGTTGTCGTTGGGGTTTCATGTTCAGAATCATTGGGCGTGTCGCATTTACTGGGAAGCACCAGTGGGTATTTGGAGAACGTGGCTCTACTGGCGAGGGGACTGGAACTGGCAGATCAACCGGCAGAGCCATCAACGAGAAAGTAAGACACCTCGTTCTCGCAATGTCTTTGAAGGCTTTGTCCACAACAATCATACTCTATGCTGAATCCTTTGGTTTGTATCTTCCTAGTCTGAGTCTAGTCAGTACACTTCTGGAGTTTCGTATTGAGTTTATCATGCGTTTATTCTTTCAATTCTTTGAGTGGATCATCATTATATGCGTGAATGATAGGTACATACCTGCCTGTTTTGGTTGTCGTAGGCCATTAATTACTGTTTTACGTTTGGTTACTGTTGGACTGCACCAGTCAGTATATTCATAGCATCACACCGAGTATTAAATGTGACGTTTTCAGCGTCAAAACTTCACGGTCTGTGGAGAAACGCACATGAACGTATACACTAAGAATCTGAGGTCTTATGTTTGGACTTCGCCTTATGCAATTGTATATTGAAGATAGTGATATGATCTCTAGCTGTGAACTGTCACTTTGCAGCCATCTCTGAGCTATAATTTTGTAGCATAGTAGAGGTTTGCTTCTCACGTGAGTGGCCTTGTTTGCGCAGTATCCTGCCGGATGGCAACAACAGTTTACTGCTGGCATTAAGGTACGTCATGAGCCAGCCTGTGGACTTTCAGGAACGCAGATATGTTGTCATGGTGTATTTATTATGGTTTCTTTGTCTAATTCTTCTAGCAGTCAATTGTCTTCTCAAAGCAAACGGTGTATATGTAGTAATCTATAATATGTTCATGTGGAATTGCAGACTATTGCTGTGGTGGCTGTTCCTCAAGGAGTTGTGCAACTGGGATCTACACAAATTGTGAGAACATTTTGCACTTGGACATCGTAGTCTTGTTCGTATCGTTGCCTCTCAAGAAAACTTCAATCACGAATCCAACTAGTTTCAGAGTAGAGATCTTGAAGCTGATCGGTAACATCATTACGAATCCTTCGGATGAGGTCGAAGGTGCTGATTGTCTGACTGTTCGAGACCCTAGTTGTCACCACCTTAAATCTCCTTTGCTTGTACAAGAGTCACTTAGGAGAGAAAGCAACCGTTCGTACTGTTTCTCAGAAAATGATATATACCCATTTTTCCTAACACCGCGAGGCCGACGAATATTCATGCTCTTATTCATGGTTTTCAGGTAATGGAAGACTTAACTCTGGTGAGCCATGTCAGAGGCCTGTTTGGGACACTCCAGAGTGTCCCTGGAGCGTTTCTATCAGATTACGTTCCAGACTCTCAAGGCGGAAGAGTTCATGTTCCTTGTTCAGTGGTGATGCCTTTACCAATGTTGATTCCCATGGGAGCAACCAACGAAACTACTAGAAGCGCTAACGTCACTCACCTGCACCCTGGTCAATTAAGCATGAATAACGTTCCTCAGATACCAACAACTGCTGTGGTCAGTGGCTCATATGACTTGATGAACTTATGCAAAGCATCTGTGCCAGCTAGAGCTCATCTCAGTAATCCATTTCGAACCTCCTCCGTCAATCCTCTCTCTTTGCAGACATCTAGGATCATGCCGAGCCCACACGTGAACAAGGACTCAACATCGAGCAATAATTCATTGTTGTCCACCGTCTCCATGGCTGTTGGTAACAGGAAGGGTCTTTCAAACATTCCGTTTACAAGTGTCCATTGTGCACCTTCCACCGAAAGTGCCTCTGTAGCATCCCTTGGGTCGGGTAACTGGAACTCCCCACCTGCAATGCCATCCGTGGCACAAAGTAAGACTGGAGGCTTGTTTGATCGCAGATTGCACGCCGATCACAGACTGCGACACCAGCTGCAGACCAGTTTGCCTGTTTGCGGAGTGAAATCTTACCAAGATACAGTGCTGACAACAACCAAAGGACCTTCACAGCAGACTTCTATCTGTGTGACGAGCTCTCCAATTACCACAGGTGGTGGCGTAGATTGTAAACCCACTCGGACCTTCGGACAAGAGGCATTTAGAGCCATGGAGTCCTGCAACACTGAGTCCACTTTGAAGACGGCTGGTTTTACAGGCGGTGCGTTGGATACAAAAGGCCTACGAGAACAAAGTCAATTGTACAATAGAAACCATGGTGAATTGCTGCAGGGTCAATCCCGTAGGTCCAGTCCGAATGTGGAAATGTCTAATTTGGAGATGCCTTCCAAAGCATGTTTGACGGCGCCAACTGAAGGACTTTTATCACATGCTGGGAAATGGGCACATACAGTTACTACTGGCCCTCACTCTGAGGTAACTAAAGTTTCTGTAAATAATGTCAGTCAATCCGATGACAAGCGGAACACAAACACTTATTCTCAGGTAAGGGAAGACGAAAAAGTATGCAAGCAGGTATATGTGCAGTCCCCTCCGAAATTTGCAGATGTAGCAGGCTTTTCGAACCAGTCTGTACCGATATCGAAGGGTAGTGGAAGCAGTTTGCAGGGCATACAAGTATGCACTGAGGGTGGTAGGAATGTGCAGGTTCGGTCCCAAATCTCTGATAGGGCATGGAATGAAAGTCCTAAAGCGGAATGGGATTGTTTCTCCGGCTTGCTCAACCCTTTCCCCATTGGAGATGAGTTGTCTCAGGCGCTGAGGCCTGCATCTTTAAGGGAATGTGACAGGGATCTTTTTAGCAATTTGCACCCAGTTCATGTTCCCGATGACGTCAGAGAGAACTCAAGTGTTAAGACGGTTGGGGAAACGAAGTTGCTGACCGATAGTGGTGAAGGGAAGTGTGCCCGAAACACAGTTATGGATTACGATATTTTCCAGGCCATTTCAGATGCTGTTCTGATGGACTCACGATCTGAGCCCCTACTTGAAGCTATGGTTGCTGGTGTCTCAAATGCTCCTTCAGCCCCTTCGCCATCAAAAGTTGGCAGTTGTTCGCATGAGCCTAACTTGTCTGGAGGTAATAGTACTCTTTCTGGAGAACCAGAATCTATGCGTCAAAGAAACGACACGTATCGCTCAGGATCTTCAGGGGATACCTTGGAGTATGACACAGCAGGTGGGATCTCTCCGTGCAAGACTGAAATGGAGTACGAAAAGTTTGCAAGTTGTGGGATCGATTTTCAGAGGGAAAGTATGCTGAAGGCATCCCAGAACTCTATGAGAATGAGTGGGGATGAAGGGCAAAAGAGAAGCGACGATGAACTTGCTCCATATGATAATGTCTTGCCTGCTAAAAGGCAGGAGGAATTTGGCAAAGTCGCAAATAGCAGGAAGAGGCCTAAACTTGGAGATACCTTGAGACCACGGCCGAAAGACAGGCAGCAGATCCAAGATCGAGTTAGGGAGCTGCGAGAAATTGTTCCGAATGCATGCAAGGTGAGTGTCCTTATATAGCAACGGTCTGGTTTCTTCTCCTTTATGAAGTGCTGTATTAGGCGAATTTGAATAATTTGTCTAACGTTATTGCACCTGAACGATGAGGGATTGTGAAAGTCTACCTACAAGGTATGAATTAATGATATTCAGTTGCCCAGAATCCACCAATCAGTTTGTTGTAACCTGTTTTGGTCGTTTGTCTGTGAATTACAGTGCAGCATAGACTCCCTACTGGAGAGAACGATCAGGCACATGCATTTTCTGCAGAGTGTCACTCAACATGGTGGAAATTGGAAAAATTTTGGAGGTTTAAAGGTTTGAACACTAACAAGCCTTTGATCGCGTTCTCTGCTTGTGGCCTTACTGCACTTATCAATATTTCAGATGATATTGCCAAGAAAGAAAAGTGGTTAGAGTATGACTGGTCTGTTTGTTTACTTCAGTCCCGATACATGTACAGACAGTAGACCTTGAGGAGTTCGTGATTTCAGACCTGTCCTATAGGGTGAACCCGAGCCACAGCTTATGTATGTACAAACACGGGTGGACAGTTAACCATCGCTCAAGGATGTCGGATTGAACACACATATAAACATCCCAGTCAAATATATAAATATCGACCCACCTTCTAAGCAGTCTCGAAACCCTCCTGTCTTCTCTGCGTTTAACAAGGACTACAGAAGGACGAGACCAGACTTATAGAACAGATGAGATTTATTAAAAGCCCTGGCCGCATAGAGTGGTACATGGGATATGATGAGGTGTTCTGTAATATCATAAGATGGATACAAAGAGTTTCTTACTGGGCATGATCGATTTTAGTAATTCCTGAGTGGTGAAAGAGCGACTGCCTGTTGTATTTCCATGACATGTCGATGAGCAGAAGTTACTGTAGCGGGGTGTGATTATTATCCGGTTATTAGTGGCTGCAATTTAAGGCGAAGCCACTTGGATTTAAGATGTCACTAATCATGATCGAAGCGCTTAGTGAGCTTATGATCTACCCCTGAGCAATGACTCCGTAGTCGATATCTCGAACCTGTGCTATTGGCTGCTGCTGCTGCTGCCGCTGCACACATAGACGTACGTAGGCAATTTAAACTGAGATTTTGAAACGAGGAGGCCGGGTGCTCAACTTTATGTTTGTATAATACCCGACAAGCACTTCGCAGGGAAATCTAAGTAGGTCATGTAGGAATGTCCGCTAGGGATGCTTTGAATAAACATATGGGTTGTGCGAGCTGTTGGTGACTAAAAGGTTACAGAGTCTTCTCGTTTCCTGTTCGTTGCCTGCGTGCTTACCTGTAGGGAATGTTTACGAACGTGTTTTATGCTCACAGGAAGAGGAGGACGCCGAGTGTTTATCTGTTGATTGCAAAGCTTACCCAGACATGCAAGGTGGAGAAAAGGAGAAGTCGGAGGTTGGACCTATTTGTGACTTGAAGTTTGACAAACCAAATAATGGTTGTCCTATTGTTGTTGAGAATACCAATCAACCCCGACAAATGCTCGTGGAGGTTAGGCCCCTGAACCTGGTATTGAATTACGTGGAACATGTTTTCTGAGATTATGGCCATCGTGGACTAAGTTTCTTCATCTTGCTTGTGCAGATGTTGTGTGAAGAGAGAGGCCTTTTCTTGGAAATTGCTGAGACAGTAAGAGGGCTTGGCCTTACAATCTTGAAGGGTGCAATGGAGAGTCGCAGCGGGAAGACCTGGGCTCGTTTCGTCGTTGAGGTACGGTTTCTACTGAAATATAGGTTCGGTCGCTACTTTCAAGTAGAACATACCCGTTAGTTTCTCAAACTCGGTCATTCTGGATATCATTCGGCTGTATCAGAACTGGAAGTTAGTTACCCCTGTTAATTAAGATCATTGCTGTTCTTAGACACATTCAAGGTTCCCTTTCCCTTGGCTACACCGTCAGGAGGAAATAGGAGTCAGAGCAAAGTATTTTGCAGATTTCTTGAGTGGTTCTATTATGTATGTGTTCTGTGCAGGCCACCTCACGTGACATCCACCGGGTAGAGGTACTATGGTATCTCATGCAGCTAATACAGCCAACAAGTGCGCTACTGCCAAGTTACGGTAGACCGTCGAACTTTGCAGATCCGGGTTGCTTATATGGTGCGGCTCATGACAGCACATCAGGCAGTATGACGTCGTCGTTCCCTCACATGCTCCGGCCTTCTGTACCTCTCCAGATGACAGCCCGATGACAGTCAGTAACATCTGTTCTTCACCCCCGAAGACTTTCCTTGTTCACCGAAAGGGGTGCAGCGAGTGGGCCAAAGGTCTGCCATGATTGGCATCCATCAAGTGATTGCTCTTGAATTCTTTTCTCACCTTTTTCTCCTCACGGATCATAGGATAATTTTGTGTTGAGATTCTGGTTTAAGGCGAATGTGCAGACAGAAGCTAGACAGCTTTATGTTGGGGAATTTTCAGTCAGCCCAAGGCTGGTACATATTGGCTTGTTAGCTTACTCACGTCTACAAGAATTTCCGTAATGCAGATGAAGCCGCTAGGGCTTCATGAGCAGGTTTTGATTTAAAACTCTCCAAGGAGGGATGGCGGGATGCTGCCATTGCCATATTTTTTAGTGTTATTTACATGAAGAAGTGGTGAGAAGGGAATATTAAGTGGCAGTCACAACTGGTTACTTGCGGAAGTTGTAAGAGATGTTACGGTGAAGAAGTAAACTCGAAGCTGTGTGAAACTCTCAGCGAGGAGCGTATCCCG

mRNA

>Mapoly0088s0049.1
GTTTTCAGTCAGCTCGCTTGTTTTTTGGCCTAGGTGGTACTACGAGTGTGCCGCTGCCAGAGAGATCGCAGGGAAAGCAGTATACTACGATGAGTCATCATAGGGAAAATACATACGTGGGGGCGATATGGGAAGAGCCTAAAAAGGATAGAAAAGTTGGAGAGCAAACCAAGTGGATAGGTAGTAATAAGTAGTGCAGATGGAGTCCTTCTTACCTTCCGGAATCCGATCACGTCCTTTGATAATGGCTGGCTCCCATAGCTCGCACGTTTGCAAATCCAAGTTTACATCCGTATGTGCGTAAAGAAGCAAACGGGGGGGAACAAGAGAGATACACGGCGCAAAATACGGGACTTGCAGTCGATGTAGATCTTTACAATACTGTACACAGATACTTGTGGTCTTTCTTTCCGCATTCGTGTCTGCTTTCGTCCGTCGATTGTGATTTTTATTTACCGATTCCAGGCCCCACAGGTCCCTTAAACATCCGGACCCCATTGATAGATCTCTTTTGATTTTTACCACTGTACACGCAGTCAATTCCTCTCAGTTATAGCCCCCTCGTACAGCAGCGGCTCAGATTTCCTCTGTTCTTACGAATCGTTTGTCTGAGTGTCTCGTCTTCAAGCGGTACAAGGCCAGTTTCAAGAAGGCCTCATTGTTTGCTTCCTTGGCTCCTCTCAGTACAGCTACTTCGTCCTGTCGCTCATCCAGGCCCGTGCAGTGTGCACCGTCACTCAAAGGTTCAGAACAACAACAACTACGCTAGGATCGCCGGTGCTCTTCTTCTGCGAGTTTGTGTCGTCGAGTCGTTCGGAGCAGTGTCGAGCAGAGCAGGGCAGTGATTTGACACATCTGTTGATGGTGTAGAGGAATTTCTCTGGAATGTGCCGGGAGTAGCTATGGCAGGGTGCGGGAACATCAGTTTGCGGTGCCATGCTTCCAAGAAGTCCTCTGTGAGGTACGACCATTACTGGAGGTCCTGTCCTCGAGACGAGACGCCGAAAGCTACTGGATCTTCTGGTGTACTTGAATTTTAAACGAGGCATGAGGAGGTGAGATCTGCAGACAGGGCGCAATGGCAATGGTGCTGCAGCAGGCGTTGAGGGGACTGTGTTACAAATCAGGATGGTCTTACGCTGTCTTTTGGAAGCTCAAGCGCCGCAGTCGAATGGTTCTTACATGGGAAGATGGGTTCTACGAATTCTCCAAGCCCTCTGCAGTATCCAGTTTCGACTCTATGCAGACGACCGGTGGCTTTAACATGATGAACAGCGGCAGACCCGGAACAGATCCCTTAGCGCCAGATGTTCCAGGTGCTGAGGATGAAATCGGTCTGGCTGTGGCCAGGATGTCGTACCATGTCTACTCTCTCGGAGAAGGAATCATTGGGCGTGTCGCATTTACTGGGAAGCACCAGTGGGTATTTGGAGAACGTGGCTCTACTGGCGAGGGGACTGGAACTGGCAGATCAACCGGCAGAGCCATCAACGAGAAATATCCTGCCGGATGGCAACAACAGTTTACTGCTGGCATTAAGACTATTGCTGTGGTGGCTGTTCCTCAAGGAGTTGTGCAACTGGGATCTACACAAATTGTAATGGAAGACTTAACTCTGGTGAGCCATGTCAGAGGCCTGTTTGGGACACTCCAGAGTGTCCCTGGAGCGTTTCTATCAGATTACGTTCCAGACTCTCAAGGCGGAAGAGTTCATGTTCCTTGTTCAGTGGTGATGCCTTTACCAATGTTGATTCCCATGGGAGCAACCAACGAAACTACTAGAAGCGCTAACGTCACTCACCTGCACCCTGGTCAATTAAGCATGAATAACGTTCCTCAGATACCAACAACTGCTGTGGTCAGTGGCTCATATGACTTGATGAACTTATGCAAAGCATCTGTGCCAGCTAGAGCTCATCTCAGTAATCCATTTCGAACCTCCTCCGTCAATCCTCTCTCTTTGCAGACATCTAGGATCATGCCGAGCCCACACGTGAACAAGGACTCAACATCGAGCAATAATTCATTGTTGTCCACCGTCTCCATGGCTGTTGGTAACAGGAAGGGTCTTTCAAACATTCCGTTTACAAGTGTCCATTGTGCACCTTCCACCGAAAGTGCCTCTGTAGCATCCCTTGGGTCGGGTAACTGGAACTCCCCACCTGCAATGCCATCCGTGGCACAAAGTAAGACTGGAGGCTTGTTTGATCGCAGATTGCACGCCGATCACAGACTGCGACACCAGCTGCAGACCAGTTTGCCTGTTTGCGGAGTGAAATCTTACCAAGATACAGTGCTGACAACAACCAAAGGACCTTCACAGCAGACTTCTATCTGTGTGACGAGCTCTCCAATTACCACAGGTGGTGGCGTAGATTGTAAACCCACTCGGACCTTCGGACAAGAGGCATTTAGAGCCATGGAGTCCTGCAACACTGAGTCCACTTTGAAGACGGCTGGTTTTACAGGCGGTGCGTTGGATACAAAAGGCCTACGAGAACAAAGTCAATTGTACAATAGAAACCATGGTGAATTGCTGCAGGGTCAATCCCGTAGGTCCAGTCCGAATGTGGAAATGTCTAATTTGGAGATGCCTTCCAAAGCATGTTTGACGGCGCCAACTGAAGGACTTTTATCACATGCTGGGAAATGGGCACATACAGTTACTACTGGCCCTCACTCTGAGGTAACTAAAGTTTCTGTAAATAATGTCAGTCAATCCGATGACAAGCGGAACACAAACACTTATTCTCAGGTAAGGGAAGACGAAAAAGTATGCAAGCAGGTATATGTGCAGTCCCCTCCGAAATTTGCAGATGTAGCAGGCTTTTCGAACCAGTCTGTACCGATATCGAAGGGTAGTGGAAGCAGTTTGCAGGGCATACAAGTATGCACTGAGGGTGGTAGGAATGTGCAGGTTCGGTCCCAAATCTCTGATAGGGCATGGAATGAAAGTCCTAAAGCGGAATGGGATTGTTTCTCCGGCTTGCTCAACCCTTTCCCCATTGGAGATGAGTTGTCTCAGGCGCTGAGGCCTGCATCTTTAAGGGAATGTGACAGGGATCTTTTTAGCAATTTGCACCCAGTTCATGTTCCCGATGACGTCAGAGAGAACTCAAGTGTTAAGACGGTTGGGGAAACGAAGTTGCTGACCGATAGTGGTGAAGGGAAGTGTGCCCGAAACACAGTTATGGATTACGATATTTTCCAGGCCATTTCAGATGCTGTTCTGATGGACTCACGATCTGAGCCCCTACTTGAAGCTATGGTTGCTGGTGTCTCAAATGCTCCTTCAGCCCCTTCGCCATCAAAAGTTGGCAGTTGTTCGCATGAGCCTAACTTGTCTGGAGGTAATAGTACTCTTTCTGGAGAACCAGAATCTATGCGTCAAAGAAACGACACGTATCGCTCAGGATCTTCAGGGGATACCTTGGAGTATGACACAGCAGGTGGGATCTCTCCGTGCAAGACTGAAATGGAGTACGAAAAGTTTGCAAGTTGTGGGATCGATTTTCAGAGGGAAAGTATGCTGAAGGCATCCCAGAACTCTATGAGAATGAGTGGGGATGAAGGGCAAAAGAGAAGCGACGATGAACTTGCTCCATATGATAATGTCTTGCCTGCTAAAAGGCAGGAGGAATTTGGCAAAGTCGCAAATAGCAGGAAGAGGCCTAAACTTGGAGATACCTTGAGACCACGGCCGAAAGACAGGCAGCAGATCCAAGATCGAGTTAGGGAGCTGCGAGAAATTGTTCCGAATGCATGCAAGTGCAGCATAGACTCCCTACTGGAGAGAACGATCAGGCACATGCATTTTCTGCAGAGTGTCACTCAACATGGTGGAAATTGGAAAAATTTTGGAGGTTTAAAGGAAGAGGAGGACGCCGAGTGTTTATCTGTTGATTGCAAAGCTTACCCAGACATGCAAGGTGGAGAAAAGGAGAAGTCGGAGGTTGGACCTATTTGTGACTTGAAGTTTGACAAACCAAATAATGGTTGTCCTATTGTTGTTGAGAATACCAATCAACCCCGACAAATGCTCGTGGAGATGTTGTGTGAAGAGAGAGGCCTTTTCTTGGAAATTGCTGAGACAGTAAGAGGGCTTGGCCTTACAATCTTGAAGGGTGCAATGGAGAGTCGCAGCGGGAAGACCTGGGCTCGTTTCGTCGTTGAGGCCACCTCACGTGACATCCACCGGGTAGAGGTACTATGGTATCTCATGCAGCTAATACAGCCAACAAGTGCGCTACTGCCAAGTTACGGTAGACCGTCGAACTTTGCAGATCCGGGTTGCTTATATGGTGCGGCTCATGACAGCACATCAGGCAGTATGACGTCGTCGTTCCCTCACATGCTCCGGCCTTCTGTACCTCTCCAGATGACAGCCCGATGACAGTCAGTAACATCTGTTCTTCACCCCCGAAGACTTTCCTTGTTCACCGAAAGGGGTGCAGCGAGTGGGCCAAAGGTCTGCCATGATTGGCATCCATCAAGTGATTGCTCTTGAATTCTTTTCTCACCTTTTTCTCCTCACGGATCATAGGATAATTTTGTGTTGAGATTCTGGTTTAAGGCGAATGTGCAGACAGAAGCTAGACAGCTTTATGTTGGGGAATTTTCAGTCAGCCCAAGGCTGGTACATATTGGCTTGTTAGCTTACTCACGTCTACAAGAATTTCCGTAATGCAGATGAAGCCGCTAGGGCTTCATGAGCAGGTTTTGATTTAAAACTCTCCAAGGAGGGATGGCGGGATGCTGCCATTGCCATATTTTTTAGTGTTATTTACATGAAGAAGTGGTGAGAAGGGAATATTAAGTGGCAGTCACAACTGGTTACTTGCGGAAGTTGTAAGAGATGTTACGGTGAAGAAGTAAACTCGAAGCTGTGTGAAACTCTCAGCGAGGAGCGTATCCCG

CDS

>Mapoly0088s0049.1
ATGGCAATGGTGCTGCAGCAGGCGTTGAGGGGACTGTGTTACAAATCAGGATGGTCTTACGCTGTCTTTTGGAAGCTCAAGCGCCGCAGTCGAATGGTTCTTACATGGGAAGATGGGTTCTACGAATTCTCCAAGCCCTCTGCAGTATCCAGTTTCGACTCTATGCAGACGACCGGTGGCTTTAACATGATGAACAGCGGCAGACCCGGAACAGATCCCTTAGCGCCAGATGTTCCAGGTGCTGAGGATGAAATCGGTCTGGCTGTGGCCAGGATGTCGTACCATGTCTACTCTCTCGGAGAAGGAATCATTGGGCGTGTCGCATTTACTGGGAAGCACCAGTGGGTATTTGGAGAACGTGGCTCTACTGGCGAGGGGACTGGAACTGGCAGATCAACCGGCAGAGCCATCAACGAGAAATATCCTGCCGGATGGCAACAACAGTTTACTGCTGGCATTAAGACTATTGCTGTGGTGGCTGTTCCTCAAGGAGTTGTGCAACTGGGATCTACACAAATTGTAATGGAAGACTTAACTCTGGTGAGCCATGTCAGAGGCCTGTTTGGGACACTCCAGAGTGTCCCTGGAGCGTTTCTATCAGATTACGTTCCAGACTCTCAAGGCGGAAGAGTTCATGTTCCTTGTTCAGTGGTGATGCCTTTACCAATGTTGATTCCCATGGGAGCAACCAACGAAACTACTAGAAGCGCTAACGTCACTCACCTGCACCCTGGTCAATTAAGCATGAATAACGTTCCTCAGATACCAACAACTGCTGTGGTCAGTGGCTCATATGACTTGATGAACTTATGCAAAGCATCTGTGCCAGCTAGAGCTCATCTCAGTAATCCATTTCGAACCTCCTCCGTCAATCCTCTCTCTTTGCAGACATCTAGGATCATGCCGAGCCCACACGTGAACAAGGACTCAACATCGAGCAATAATTCATTGTTGTCCACCGTCTCCATGGCTGTTGGTAACAGGAAGGGTCTTTCAAACATTCCGTTTACAAGTGTCCATTGTGCACCTTCCACCGAAAGTGCCTCTGTAGCATCCCTTGGGTCGGGTAACTGGAACTCCCCACCTGCAATGCCATCCGTGGCACAAAGTAAGACTGGAGGCTTGTTTGATCGCAGATTGCACGCCGATCACAGACTGCGACACCAGCTGCAGACCAGTTTGCCTGTTTGCGGAGTGAAATCTTACCAAGATACAGTGCTGACAACAACCAAAGGACCTTCACAGCAGACTTCTATCTGTGTGACGAGCTCTCCAATTACCACAGGTGGTGGCGTAGATTGTAAACCCACTCGGACCTTCGGACAAGAGGCATTTAGAGCCATGGAGTCCTGCAACACTGAGTCCACTTTGAAGACGGCTGGTTTTACAGGCGGTGCGTTGGATACAAAAGGCCTACGAGAACAAAGTCAATTGTACAATAGAAACCATGGTGAATTGCTGCAGGGTCAATCCCGTAGGTCCAGTCCGAATGTGGAAATGTCTAATTTGGAGATGCCTTCCAAAGCATGTTTGACGGCGCCAACTGAAGGACTTTTATCACATGCTGGGAAATGGGCACATACAGTTACTACTGGCCCTCACTCTGAGGTAACTAAAGTTTCTGTAAATAATGTCAGTCAATCCGATGACAAGCGGAACACAAACACTTATTCTCAGGTAAGGGAAGACGAAAAAGTATGCAAGCAGGTATATGTGCAGTCCCCTCCGAAATTTGCAGATGTAGCAGGCTTTTCGAACCAGTCTGTACCGATATCGAAGGGTAGTGGAAGCAGTTTGCAGGGCATACAAGTATGCACTGAGGGTGGTAGGAATGTGCAGGTTCGGTCCCAAATCTCTGATAGGGCATGGAATGAAAGTCCTAAAGCGGAATGGGATTGTTTCTCCGGCTTGCTCAACCCTTTCCCCATTGGAGATGAGTTGTCTCAGGCGCTGAGGCCTGCATCTTTAAGGGAATGTGACAGGGATCTTTTTAGCAATTTGCACCCAGTTCATGTTCCCGATGACGTCAGAGAGAACTCAAGTGTTAAGACGGTTGGGGAAACGAAGTTGCTGACCGATAGTGGTGAAGGGAAGTGTGCCCGAAACACAGTTATGGATTACGATATTTTCCAGGCCATTTCAGATGCTGTTCTGATGGACTCACGATCTGAGCCCCTACTTGAAGCTATGGTTGCTGGTGTCTCAAATGCTCCTTCAGCCCCTTCGCCATCAAAAGTTGGCAGTTGTTCGCATGAGCCTAACTTGTCTGGAGGTAATAGTACTCTTTCTGGAGAACCAGAATCTATGCGTCAAAGAAACGACACGTATCGCTCAGGATCTTCAGGGGATACCTTGGAGTATGACACAGCAGGTGGGATCTCTCCGTGCAAGACTGAAATGGAGTACGAAAAGTTTGCAAGTTGTGGGATCGATTTTCAGAGGGAAAGTATGCTGAAGGCATCCCAGAACTCTATGAGAATGAGTGGGGATGAAGGGCAAAAGAGAAGCGACGATGAACTTGCTCCATATGATAATGTCTTGCCTGCTAAAAGGCAGGAGGAATTTGGCAAAGTCGCAAATAGCAGGAAGAGGCCTAAACTTGGAGATACCTTGAGACCACGGCCGAAAGACAGGCAGCAGATCCAAGATCGAGTTAGGGAGCTGCGAGAAATTGTTCCGAATGCATGCAAGTGCAGCATAGACTCCCTACTGGAGAGAACGATCAGGCACATGCATTTTCTGCAGAGTGTCACTCAACATGGTGGAAATTGGAAAAATTTTGGAGGTTTAAAGGAAGAGGAGGACGCCGAGTGTTTATCTGTTGATTGCAAAGCTTACCCAGACATGCAAGGTGGAGAAAAGGAGAAGTCGGAGGTTGGACCTATTTGTGACTTGAAGTTTGACAAACCAAATAATGGTTGTCCTATTGTTGTTGAGAATACCAATCAACCCCGACAAATGCTCGTGGAGATGTTGTGTGAAGAGAGAGGCCTTTTCTTGGAAATTGCTGAGACAGTAAGAGGGCTTGGCCTTACAATCTTGAAGGGTGCAATGGAGAGTCGCAGCGGGAAGACCTGGGCTCGTTTCGTCGTTGAGGCCACCTCACGTGACATCCACCGGGTAGAGGTACTATGGTATCTCATGCAGCTAATACAGCCAACAAGTGCGCTACTGCCAAGTTACGGTAGACCGTCGAACTTTGCAGATCCGGGTTGCTTATATGGTGCGGCTCATGACAGCACATCAGGCAGTATGACGTCGTCGTTCCCTCACATGCTCCGGCCTTCTGTACCTCTCCAGATGACAGCCCGATGA

Protein

>Mapoly0088s0049.1
MAMVLQQALRGLCYKSGWSYAVFWKLKRRSRMVLTWEDGFYEFSKPSAVSSFDSMQTTGGFNMMNSGRPGTDPLAPDVPGAEDEIGLAVARMSYHVYSLGEGIIGRVAFTGKHQWVFGERGSTGEGTGTGRSTGRAINEKYPAGWQQQFTAGIKTIAVVAVPQGVVQLGSTQIVMEDLTLVSHVRGLFGTLQSVPGAFLSDYVPDSQGGRVHVPCSVVMPLPMLIPMGATNETTRSANVTHLHPGQLSMNNVPQIPTTAVVSGSYDLMNLCKASVPARAHLSNPFRTSSVNPLSLQTSRIMPSPHVNKDSTSSNNSLLSTVSMAVGNRKGLSNIPFTSVHCAPSTESASVASLGSGNWNSPPAMPSVAQSKTGGLFDRRLHADHRLRHQLQTSLPVCGVKSYQDTVLTTTKGPSQQTSICVTSSPITTGGGVDCKPTRTFGQEAFRAMESCNTESTLKTAGFTGGALDTKGLREQSQLYNRNHGELLQGQSRRSSPNVEMSNLEMPSKACLTAPTEGLLSHAGKWAHTVTTGPHSEVTKVSVNNVSQSDDKRNTNTYSQVREDEKVCKQVYVQSPPKFADVAGFSNQSVPISKGSGSSLQGIQVCTEGGRNVQVRSQISDRAWNESPKAEWDCFSGLLNPFPIGDELSQALRPASLRECDRDLFSNLHPVHVPDDVRENSSVKTVGETKLLTDSGEGKCARNTVMDYDIFQAISDAVLMDSRSEPLLEAMVAGVSNAPSAPSPSKVGSCSHEPNLSGGNSTLSGEPESMRQRNDTYRSGSSGDTLEYDTAGGISPCKTEMEYEKFASCGIDFQRESMLKASQNSMRMSGDEGQKRSDDELAPYDNVLPAKRQEEFGKVANSRKRPKLGDTLRPRPKDRQQIQDRVRELREIVPNACKCSIDSLLERTIRHMHFLQSVTQHGGNWKNFGGLKEEEDAECLSVDCKAYPDMQGGEKEKSEVGPICDLKFDKPNNGCPIVVENTNQPRQMLVEMLCEERGLFLEIAETVRGLGLTILKGAMESRSGKTWARFVVEATSRDIHRVEVLWYLMQLIQPTSALLPSYGRPSNFADPGCLYGAAHDSTSGSMTSSFPHMLRPSVPLQMTAR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>