Mapoly0091s0008



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_213026
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR16223 FAMILY NOT NAMED
PANTHER PTHR16223:SF18

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH28 transcription factor, bHLH Mapoly0091s0008.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0091s0008.1 scaffold_91:115987..120754  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0091s0008.2 scaffold_91:115987..120754  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0091s0008.1  

Gene structure:

mRNA scaffold_91:115987..120754  ( + strand )
five_prime_UTR scaffold_91:115987..116479  ( + strand )
five_prime_UTR scaffold_91:116900..117004  ( + strand )
five_prime_UTR scaffold_91:117272..117359  ( + strand )
CDS scaffold_91:117360..118628  ( + strand )
CDS scaffold_91:119104..119307  ( + strand )
CDS scaffold_91:119819..119884  ( + strand )
CDS scaffold_91:120080..120145  ( + strand )
CDS scaffold_91:120283..120384  ( + strand )
three_prime_UTR scaffold_91:120385..120754  ( + strand )

Sequences:

Gene

>Mapoly0091s0008.1
GACGCTTCCCTGCAAACGGAGATAGAGAGAGGGAGTGAGAGAACTTACCTTGGGCTGTAGTCTGATCTATATTAGATCGAGCCAAGGCTTGCCGTGGGCTTGATATGAGCTTGAGTAGCAGGACGCATGTCAACTGAGCTGAATTCTGAAAATATCTGACACCTCCGATCTTCTGGATGTCTCAGAGATCTGAGAGAGGCTACTTATGAGCGTCGATTACTCACTGCTCGGAGGCCTTCACGAAGGATCGTCCATTGATTAGGAGCTTTCATGTCTACATGTATCACCAAACAGTGATTTTCATAGTTGTGCTCTGAGGACCTTATGATCATCATTTCGACTTGGTTGCGGTTGCTGTACGTAGGAGGGTGAAAATCAAAATCCCAACGCTCGAGGGACATTCAGAGATATGAGACTTTGACATGCAAGAGACCATGCATGCCTAGCTGTTGCATTTGCTTCTCCGGCTTCTTGATTCGAAATTCATTAAGAGGTGGGTGCTACGTATGGTTTGCCGCAAGAGGGACCTACATCATGTACGAACAAGCTTCAGAGTTCTGCTCGATGAAACACAGATCATAAGTATAGTCGATGACAGCTTCTTCTTGAATACCAGCCTCGTCCTTTCCAAGATTCAACAGGGTCCAGCCCAAATTGATCATTTCCTTGCTTCTACAAATCCCCCGGTTGCGTCCATTTATACGTATCTGAAGCGAATAGCTGGTTACCATAATCTCTCCCCTACGATCGATCCACCATCTCATGAATATTTAGGTAATGTTTTTTGTCGCCTTTACTCCCAGTTTATACACAACTTCTTGATTCGACCATCTAGTCACGATCGGGGTCTTATCTCAGAAAGAGCATGGAGAACTCAAGAAAAGTGATTTTTGTAGGTTGCTTGTTCGAACAGATGCACCTCATCATATCAACGGTCTTATCAACACCTTGGAGATAAAGTTGAGAAATGCGCACTAAAACTTAACACAATGCTGAAAGCCAAGTGTTTAGTGTTGCAGTAAGTTTTCCTCATCCGGATCTTGACAGTTGTATGCATAAAGTATCTCCAACGTTTAGATTTAGTTTGATTCTGGGTAAATCCTGAAGGGCTTCAACTCTAACCTTCTTGACAACTGTTGCTCCATTTTGTTCTCGTTGATTCTCTTCTTCTGTTCAAGCCTGAAAGGTTCAATCGAACCCGCCTTCAAATGAAATCGGGCCCAGAAGTTTATAGCAATCTTGCTCTTGTTGTCGATCATAACTCAAGATTTTGTGCACTGCGCAGGAAACTCGGAGAAACTGCTGAAACAAAATCCGACTTTCGTGATCGGAACTGTACATAATTTACAGATAAAGTCTTTATTCCGGCGAGTATGGCGAATTATGATAGCAGCTTACAGTCTGGGAACTCGGAAGAAACAGCTGTGTCTACTTCGCAAGCACTGACAAGTCCTTGCGAAGCCATGTGGGATGGATGGACAACTCAGACATCCACTGCATCTGCAGGGCCTCCAAGCATCTCACTGACTGATCTCCAAGTGCAAGGCTCAATTGTACATATGAAGAGCTCTACAAATTTTCAATCAGACTTGCTCTCATCCTGGCTGTCTGGCTTCCAAACTCTGTCTCAGGCCGCGGGTGTGCTTGGTGCAGTCGACCATGATCAGCCACAGTCACAAGAGGGTACCGGTAGCTTAATGTATCCGGATGAATTCTCCCGGTTGAACATATGTTCCACGTCATCGGATGAGCGTCCAGACGGGGTGGCTCACTCAGAGAGCTCGCATGCCTCGCAGTTATTCATCGAGCGCTGCAGTGATCAGAATATCATGAGGGCAGATCGTGAATTTTGTGAGACTCCAGTTACGGAGGACAGTAGCAAAAGAGAGGAATCAGCTCCGTATTTTCGCAGCACAAGCGCTCCCAATCAATCTAGTAATTTTGACAAAGTGGTGAGGAATACTGAACAAGATCAGCATATGGTGCGGACTCCTGAAACAGACTTGAGCTCCAGAACATCGTCACCCCCCTCCATGCAGCTGGCTTCGTATGGTCAAATGATGCAGCATCTGGTTGGACAATACGAGAGCAACCCAGCCACCACTTGGCTTAGTTGCGTCACATCATCTTCCTCACAACTGCGACCATCTGACAACGGCTTACGTCCAGTCCAGGGTGATCTCAGCAGAGCCAACACAAGCAGTGAAAGTATAATACTACACCACCACAGGCCAGGAAGTAACCATTTTTCCAGCGCCAACGATCCGTACTGCAAGGCCTCTGCTGAGAACATGTACGCTGAATTGCATGGTCTTCTGACGAAAACTCAACAAGATTCCCTGACAGGCACAATTCAGCTTCCGCAGGCACCGGCTGCCACTTCTGCTTGTGGTTGGTCACAATTCACGGACGCGAACATGCAAGGCCAGCAGAGCATTTTTGCCTCCGATGCAAGTACCGCAGCCATAACTCCAAAGCCGACGAGAAGAACGGAAGATCCATCATCATCTCACGCAGGAAAGGCAAGAGCATCCGTTGTCAAAGTAGCCCGTTCAAATCCAGAGCGGCAAGAGAAAAGGTCTTCTCGGGGACATGACGATGAGTCGGGAAGTAGCAGTCCCGCCTTGAAACGATCCTGCATTGTACGTCCATTTTGATCGATAAGATCAATTTCCAGAATTTTGCCCAATTTTTCACCATCTTCGCTTGTTCATGATCCTTGTATCACCACTAGTTTGTACATAGATTTCCTTGCTTTTGCAACAAAGTCCGAAGTTGAGAGTAGGATTCAGACGATTTTCAATCTACTAGAAATGAAACTTCTTACATCATTAACTGTGACGACGAGTGCTCCTCCTATCACGATGCTAAAGTGGGGCTCGAAGAATGAGAATACTCTTTGGTATTTTTATTATCGTTCGGTACTGCTGCTCGAGCCTTCCAGTCTACAGATTTAATTCCCAGTAACCCGCAGAATGGCCTCATCTCTGTCTACCTGTTAGTTCACAGTGCTCCGACACGAGAGTGGTTCTTACATTTTCTTAAAACAACTTCCTCTTACTATGGAAGGAGAGCCTGAGTTTCTGATGGAGTTGTTGGCGTATGCATCCAATTCAGGAACATGCAATTTGGCAGTCGAATGCAGCATTTCTGGGAAGAGTATCTGACCCGCAGTTTCATGCATCTCTTGGAAGCGGCTACGGAATTGGTACGAGTTCCAGTGTGGATATACACTCCTCGGTGGGACCTGCGCTTAATACAAATGGGAAGCCTCGAGCACGTCGCGGATCTGCCACTGATCCACAAAGCGTCTATGCACGCGTGAGTATTCCTAGACCTTGATTAATTTCGAATAATGCCAAACACCGAGTCCACTTTCATTGAAGAGAAGTGAGGAGGTTTTGAAATTTAAGAGAAAATCACCAAAGAGATGGCCGAAGGTACATGTGGACCTTTAGCTTCTCTTGGCGTAGTAAGACCCCGTTCAGTAAGCATTTCATGAAGACTGGTAATGCTTCTAAGACTCCCTCATGCACACATGCATGTTCGTACTTCTCTACAGCTGCATCTTCTATCAGAATGCTCAATTATCAGTTAAGAACTACAAGTCCGGAGATGGGATCGCGTGCTCTCAGTAGCATTACGAATCAAATGTAGATCTCATAGCCAACCTGATGACTTATAAGAGTTTGTCAAGACACTCATTCAGAAAGTAAGAGAAATGTCAAGTGAGTTGTGATTGCACTGTTCGCGTTAAATGTGATGCGCTATCTTGGCAAAACCAATGTATGTCAATTTTGTACTCTAAGTAAACCACTCAATATGTTTTCAGCACAGACGGGAACGCATCACTGAGCGCCTGAAAATTCTACAACACCTTGTTCCCAATGGAGCTAAGGTATGCACCCCACTTCAGTACAATTTCACCACGGTATCTTGCACTCTTCACGTAATGGAAACACAGGAACGTCAGCAGGCTCACTGGATTGTCACTGACTTGATTCTTCCCTAGATTTACCTCCCTTATCTAAGACAGTCGTGATGTCTTTCTGAGCAATCTGATGTCTTTCTGATCTTGCCATGGTATGGCTAGGTTGATATAGTAACGATGCTGGAGGAGGCAATCAGCTACGTCAAATTTCTGCAACTGCAAGTGAGGGTGCGTGGATTTTGTTGCCCAGCTTATTATTATATTCACTGTTTGAAGGGGAGTTAAAGGAACCAAATAGTGACACTGAAGTGTATGCAGGCCTGAAGAAAGATCTGACGTCTGCTTCTGTATCGTGGAGGTTGCAGTATTTAAGTTCTGATGAATACTGGATATACGCACCTACAACTTACAACGGCGTGGACGTTTCGATGGGTATGCATTTCCAGGGCATGGACTCACAAGCTTGAACACACGACCTTCAACAAATTGATACAGATCGCTTTGGTCTACGAAAATTTCCAAACTTCTCCTCTTTATATATAATGACCTGAGTGTCCTCAATCCAACTCTGTAGGAAAGGACCTCCCACAAAATTTAGGAACCGCCTGGTGTAGAAGTTTCTCTGGCATTCTCAGGGGTGAGGCTTTAAACGACTTGAAGAGTTGCAGACTAGTATCATCTCCATACCAGTCAAAATTCAACATGATGATAGAAATATCAAATATCCATCTGTACAATTGTGAACCCTGAGTCGAATACCAGTGCGGTTCGAATAAACGAGAAATTCAGCAAGCAATTTTTCTATATCAAGAAGTGTTTACTACAAATTGAGAAGAC

mRNA

>Mapoly0091s0008.1
GACGCTTCCCTGCAAACGGAGATAGAGAGAGGGAGTGAGAGAACTTACCTTGGGCTGTAGTCTGATCTATATTAGATCGAGCCAAGGCTTGCCGTGGGCTTGATATGAGCTTGAGTAGCAGGACGCATGTCAACTGAGCTGAATTCTGAAAATATCTGACACCTCCGATCTTCTGGATGTCTCAGAGATCTGAGAGAGGCTACTTATGAGCGTCGATTACTCACTGCTCGGAGGCCTTCACGAAGGATCGTCCATTGATTAGGAGCTTTCATGTCTACATGTATCACCAAACAGTGATTTTCATAGTTGTGCTCTGAGGACCTTATGATCATCATTTCGACTTGGTTGCGGTTGCTGTACGTAGGAGGGTGAAAATCAAAATCCCAACGCTCGAGGGACATTCAGAGATATGAGACTTTGACATGCAAGAGACCATGCATGCCTAGCTGTTGCATTTGCTTCTCCGGCTTCTTGATTCGAAATTCATTAAGAGATGCACCTCATCATATCAACGGTCTTATCAACACCTTGGAGATAAAGTTGAGAAATGCGCACTAAAACTTAACACAATGCTGAAAGCCAAGTGTTTAGTGTTGCAGAAACTCGGAGAAACTGCTGAAACAAAATCCGACTTTCGTGATCGGAACTGTACATAATTTACAGATAAAGTCTTTATTCCGGCGAGTATGGCGAATTATGATAGCAGCTTACAGTCTGGGAACTCGGAAGAAACAGCTGTGTCTACTTCGCAAGCACTGACAAGTCCTTGCGAAGCCATGTGGGATGGATGGACAACTCAGACATCCACTGCATCTGCAGGGCCTCCAAGCATCTCACTGACTGATCTCCAAGTGCAAGGCTCAATTGTACATATGAAGAGCTCTACAAATTTTCAATCAGACTTGCTCTCATCCTGGCTGTCTGGCTTCCAAACTCTGTCTCAGGCCGCGGGTGTGCTTGGTGCAGTCGACCATGATCAGCCACAGTCACAAGAGGGTACCGGTAGCTTAATGTATCCGGATGAATTCTCCCGGTTGAACATATGTTCCACGTCATCGGATGAGCGTCCAGACGGGGTGGCTCACTCAGAGAGCTCGCATGCCTCGCAGTTATTCATCGAGCGCTGCAGTGATCAGAATATCATGAGGGCAGATCGTGAATTTTGTGAGACTCCAGTTACGGAGGACAGTAGCAAAAGAGAGGAATCAGCTCCGTATTTTCGCAGCACAAGCGCTCCCAATCAATCTAGTAATTTTGACAAAGTGGTGAGGAATACTGAACAAGATCAGCATATGGTGCGGACTCCTGAAACAGACTTGAGCTCCAGAACATCGTCACCCCCCTCCATGCAGCTGGCTTCGTATGGTCAAATGATGCAGCATCTGGTTGGACAATACGAGAGCAACCCAGCCACCACTTGGCTTAGTTGCGTCACATCATCTTCCTCACAACTGCGACCATCTGACAACGGCTTACGTCCAGTCCAGGGTGATCTCAGCAGAGCCAACACAAGCAGTGAAAGTATAATACTACACCACCACAGGCCAGGAAGTAACCATTTTTCCAGCGCCAACGATCCGTACTGCAAGGCCTCTGCTGAGAACATGTACGCTGAATTGCATGGTCTTCTGACGAAAACTCAACAAGATTCCCTGACAGGCACAATTCAGCTTCCGCAGGCACCGGCTGCCACTTCTGCTTGTGGTTGGTCACAATTCACGGACGCGAACATGCAAGGCCAGCAGAGCATTTTTGCCTCCGATGCAAGTACCGCAGCCATAACTCCAAAGCCGACGAGAAGAACGGAAGATCCATCATCATCTCACGCAGGAAAGGCAAGAGCATCCGTTGTCAAAGTAGCCCGTTCAAATCCAGAGCGGCAAGAGAAAAGGTCTTCTCGGGGACATGACGATGAGTCGGGAAGTAGCAGTCCCGCCTTGAAACGATCCTGCATTGAACATGCAATTTGGCAGTCGAATGCAGCATTTCTGGGAAGAGTATCTGACCCGCAGTTTCATGCATCTCTTGGAAGCGGCTACGGAATTGGTACGAGTTCCAGTGTGGATATACACTCCTCGGTGGGACCTGCGCTTAATACAAATGGGAAGCCTCGAGCACGTCGCGGATCTGCCACTGATCCACAAAGCGTCTATGCACGCCACAGACGGGAACGCATCACTGAGCGCCTGAAAATTCTACAACACCTTGTTCCCAATGGAGCTAAGGTTGATATAGTAACGATGCTGGAGGAGGCAATCAGCTACGTCAAATTTCTGCAACTGCAAGTGAGGTATTTAAGTTCTGATGAATACTGGATATACGCACCTACAACTTACAACGGCGTGGACGTTTCGATGGGTATGCATTTCCAGGGCATGGACTCACAAGCTTGAACACACGACCTTCAACAAATTGATACAGATCGCTTTGGTCTACGAAAATTTCCAAACTTCTCCTCTTTATATATAATGACCTGAGTGTCCTCAATCCAACTCTGTAGGAAAGGACCTCCCACAAAATTTAGGAACCGCCTGGTGTAGAAGTTTCTCTGGCATTCTCAGGGGTGAGGCTTTAAACGACTTGAAGAGTTGCAGACTAGTATCATCTCCATACCAGTCAAAATTCAACATGATGATAGAAATATCAAATATCCATCTGTACAATTGTGAACCCTGAGTCGAATACCAGTGCGGTTCGAATAAACGAGAAATTCAGCAAGCAATTTTTCTATATCAAGAAGTGTTTACTACAAATTGAGAAGAC

CDS

>Mapoly0091s0008.1
ATGGCGAATTATGATAGCAGCTTACAGTCTGGGAACTCGGAAGAAACAGCTGTGTCTACTTCGCAAGCACTGACAAGTCCTTGCGAAGCCATGTGGGATGGATGGACAACTCAGACATCCACTGCATCTGCAGGGCCTCCAAGCATCTCACTGACTGATCTCCAAGTGCAAGGCTCAATTGTACATATGAAGAGCTCTACAAATTTTCAATCAGACTTGCTCTCATCCTGGCTGTCTGGCTTCCAAACTCTGTCTCAGGCCGCGGGTGTGCTTGGTGCAGTCGACCATGATCAGCCACAGTCACAAGAGGGTACCGGTAGCTTAATGTATCCGGATGAATTCTCCCGGTTGAACATATGTTCCACGTCATCGGATGAGCGTCCAGACGGGGTGGCTCACTCAGAGAGCTCGCATGCCTCGCAGTTATTCATCGAGCGCTGCAGTGATCAGAATATCATGAGGGCAGATCGTGAATTTTGTGAGACTCCAGTTACGGAGGACAGTAGCAAAAGAGAGGAATCAGCTCCGTATTTTCGCAGCACAAGCGCTCCCAATCAATCTAGTAATTTTGACAAAGTGGTGAGGAATACTGAACAAGATCAGCATATGGTGCGGACTCCTGAAACAGACTTGAGCTCCAGAACATCGTCACCCCCCTCCATGCAGCTGGCTTCGTATGGTCAAATGATGCAGCATCTGGTTGGACAATACGAGAGCAACCCAGCCACCACTTGGCTTAGTTGCGTCACATCATCTTCCTCACAACTGCGACCATCTGACAACGGCTTACGTCCAGTCCAGGGTGATCTCAGCAGAGCCAACACAAGCAGTGAAAGTATAATACTACACCACCACAGGCCAGGAAGTAACCATTTTTCCAGCGCCAACGATCCGTACTGCAAGGCCTCTGCTGAGAACATGTACGCTGAATTGCATGGTCTTCTGACGAAAACTCAACAAGATTCCCTGACAGGCACAATTCAGCTTCCGCAGGCACCGGCTGCCACTTCTGCTTGTGGTTGGTCACAATTCACGGACGCGAACATGCAAGGCCAGCAGAGCATTTTTGCCTCCGATGCAAGTACCGCAGCCATAACTCCAAAGCCGACGAGAAGAACGGAAGATCCATCATCATCTCACGCAGGAAAGGCAAGAGCATCCGTTGTCAAAGTAGCCCGTTCAAATCCAGAGCGGCAAGAGAAAAGGTCTTCTCGGGGACATGACGATGAGTCGGGAAGTAGCAGTCCCGCCTTGAAACGATCCTGCATTGAACATGCAATTTGGCAGTCGAATGCAGCATTTCTGGGAAGAGTATCTGACCCGCAGTTTCATGCATCTCTTGGAAGCGGCTACGGAATTGGTACGAGTTCCAGTGTGGATATACACTCCTCGGTGGGACCTGCGCTTAATACAAATGGGAAGCCTCGAGCACGTCGCGGATCTGCCACTGATCCACAAAGCGTCTATGCACGCCACAGACGGGAACGCATCACTGAGCGCCTGAAAATTCTACAACACCTTGTTCCCAATGGAGCTAAGGTTGATATAGTAACGATGCTGGAGGAGGCAATCAGCTACGTCAAATTTCTGCAACTGCAAGTGAGGTATTTAAGTTCTGATGAATACTGGATATACGCACCTACAACTTACAACGGCGTGGACGTTTCGATGGGTATGCATTTCCAGGGCATGGACTCACAAGCTTGA

Protein

>Mapoly0091s0008.1
MANYDSSLQSGNSEETAVSTSQALTSPCEAMWDGWTTQTSTASAGPPSISLTDLQVQGSIVHMKSSTNFQSDLLSSWLSGFQTLSQAAGVLGAVDHDQPQSQEGTGSLMYPDEFSRLNICSTSSDERPDGVAHSESSHASQLFIERCSDQNIMRADREFCETPVTEDSSKREESAPYFRSTSAPNQSSNFDKVVRNTEQDQHMVRTPETDLSSRTSSPPSMQLASYGQMMQHLVGQYESNPATTWLSCVTSSSSQLRPSDNGLRPVQGDLSRANTSSESIILHHHRPGSNHFSSANDPYCKASAENMYAELHGLLTKTQQDSLTGTIQLPQAPAATSACGWSQFTDANMQGQQSIFASDASTAAITPKPTRRTEDPSSSHAGKARASVVKVARSNPERQEKRSSRGHDDESGSSSPALKRSCIEHAIWQSNAAFLGRVSDPQFHASLGSGYGIGTSSSVDIHSSVGPALNTNGKPRARRGSATDPQSVYARHRRERITERLKILQHLVPNGAKVDIVTMLEEAISYVKFLQLQVRYLSSDEYWIYAPTTYNGVDVSMGMHFQGMDSQA

Mapoly0091s0008.2  

Gene structure:

mRNA scaffold_91:115987..120754  ( + strand )
five_prime_UTR scaffold_91:115987..116479  ( + strand )
five_prime_UTR scaffold_91:117272..117359  ( + strand )
CDS scaffold_91:117360..118628  ( + strand )
CDS scaffold_91:119104..119307  ( + strand )
CDS scaffold_91:119819..119884  ( + strand )
CDS scaffold_91:120080..120145  ( + strand )
CDS scaffold_91:120283..120384  ( + strand )
three_prime_UTR scaffold_91:120385..120754  ( + strand )

Sequences:

Gene

>Mapoly0091s0008.2
GACGCTTCCCTGCAAACGGAGATAGAGAGAGGGAGTGAGAGAACTTACCTTGGGCTGTAGTCTGATCTATATTAGATCGAGCCAAGGCTTGCCGTGGGCTTGATATGAGCTTGAGTAGCAGGACGCATGTCAACTGAGCTGAATTCTGAAAATATCTGACACCTCCGATCTTCTGGATGTCTCAGAGATCTGAGAGAGGCTACTTATGAGCGTCGATTACTCACTGCTCGGAGGCCTTCACGAAGGATCGTCCATTGATTAGGAGCTTTCATGTCTACATGTATCACCAAACAGTGATTTTCATAGTTGTGCTCTGAGGACCTTATGATCATCATTTCGACTTGGTTGCGGTTGCTGTACGTAGGAGGGTGAAAATCAAAATCCCAACGCTCGAGGGACATTCAGAGATATGAGACTTTGACATGCAAGAGACCATGCATGCCTAGCTGTTGCATTTGCTTCTCCGGCTTCTTGATTCGAAATTCATTAAGAGGTGGGTGCTACGTATGGTTTGCCGCAAGAGGGACCTACATCATGTACGAACAAGCTTCAGAGTTCTGCTCGATGAAACACAGATCATAAGTATAGTCGATGACAGCTTCTTCTTGAATACCAGCCTCGTCCTTTCCAAGATTCAACAGGGTCCAGCCCAAATTGATCATTTCCTTGCTTCTACAAATCCCCCGGTTGCGTCCATTTATACGTATCTGAAGCGAATAGCTGGTTACCATAATCTCTCCCCTACGATCGATCCACCATCTCATGAATATTTAGGTAATGTTTTTTGTCGCCTTTACTCCCAGTTTATACACAACTTCTTGATTCGACCATCTAGTCACGATCGGGGTCTTATCTCAGAAAGAGCATGGAGAACTCAAGAAAAGTGATTTTTGTAGGTTGCTTGTTCGAACAGATGCACCTCATCATATCAACGGTCTTATCAACACCTTGGAGATAAAGTTGAGAAATGCGCACTAAAACTTAACACAATGCTGAAAGCCAAGTGTTTAGTGTTGCAGTAAGTTTTCCTCATCCGGATCTTGACAGTTGTATGCATAAAGTATCTCCAACGTTTAGATTTAGTTTGATTCTGGGTAAATCCTGAAGGGCTTCAACTCTAACCTTCTTGACAACTGTTGCTCCATTTTGTTCTCGTTGATTCTCTTCTTCTGTTCAAGCCTGAAAGGTTCAATCGAACCCGCCTTCAAATGAAATCGGGCCCAGAAGTTTATAGCAATCTTGCTCTTGTTGTCGATCATAACTCAAGATTTTGTGCACTGCGCAGGAAACTCGGAGAAACTGCTGAAACAAAATCCGACTTTCGTGATCGGAACTGTACATAATTTACAGATAAAGTCTTTATTCCGGCGAGTATGGCGAATTATGATAGCAGCTTACAGTCTGGGAACTCGGAAGAAACAGCTGTGTCTACTTCGCAAGCACTGACAAGTCCTTGCGAAGCCATGTGGGATGGATGGACAACTCAGACATCCACTGCATCTGCAGGGCCTCCAAGCATCTCACTGACTGATCTCCAAGTGCAAGGCTCAATTGTACATATGAAGAGCTCTACAAATTTTCAATCAGACTTGCTCTCATCCTGGCTGTCTGGCTTCCAAACTCTGTCTCAGGCCGCGGGTGTGCTTGGTGCAGTCGACCATGATCAGCCACAGTCACAAGAGGGTACCGGTAGCTTAATGTATCCGGATGAATTCTCCCGGTTGAACATATGTTCCACGTCATCGGATGAGCGTCCAGACGGGGTGGCTCACTCAGAGAGCTCGCATGCCTCGCAGTTATTCATCGAGCGCTGCAGTGATCAGAATATCATGAGGGCAGATCGTGAATTTTGTGAGACTCCAGTTACGGAGGACAGTAGCAAAAGAGAGGAATCAGCTCCGTATTTTCGCAGCACAAGCGCTCCCAATCAATCTAGTAATTTTGACAAAGTGGTGAGGAATACTGAACAAGATCAGCATATGGTGCGGACTCCTGAAACAGACTTGAGCTCCAGAACATCGTCACCCCCCTCCATGCAGCTGGCTTCGTATGGTCAAATGATGCAGCATCTGGTTGGACAATACGAGAGCAACCCAGCCACCACTTGGCTTAGTTGCGTCACATCATCTTCCTCACAACTGCGACCATCTGACAACGGCTTACGTCCAGTCCAGGGTGATCTCAGCAGAGCCAACACAAGCAGTGAAAGTATAATACTACACCACCACAGGCCAGGAAGTAACCATTTTTCCAGCGCCAACGATCCGTACTGCAAGGCCTCTGCTGAGAACATGTACGCTGAATTGCATGGTCTTCTGACGAAAACTCAACAAGATTCCCTGACAGGCACAATTCAGCTTCCGCAGGCACCGGCTGCCACTTCTGCTTGTGGTTGGTCACAATTCACGGACGCGAACATGCAAGGCCAGCAGAGCATTTTTGCCTCCGATGCAAGTACCGCAGCCATAACTCCAAAGCCGACGAGAAGAACGGAAGATCCATCATCATCTCACGCAGGAAAGGCAAGAGCATCCGTTGTCAAAGTAGCCCGTTCAAATCCAGAGCGGCAAGAGAAAAGGTCTTCTCGGGGACATGACGATGAGTCGGGAAGTAGCAGTCCCGCCTTGAAACGATCCTGCATTGTACGTCCATTTTGATCGATAAGATCAATTTCCAGAATTTTGCCCAATTTTTCACCATCTTCGCTTGTTCATGATCCTTGTATCACCACTAGTTTGTACATAGATTTCCTTGCTTTTGCAACAAAGTCCGAAGTTGAGAGTAGGATTCAGACGATTTTCAATCTACTAGAAATGAAACTTCTTACATCATTAACTGTGACGACGAGTGCTCCTCCTATCACGATGCTAAAGTGGGGCTCGAAGAATGAGAATACTCTTTGGTATTTTTATTATCGTTCGGTACTGCTGCTCGAGCCTTCCAGTCTACAGATTTAATTCCCAGTAACCCGCAGAATGGCCTCATCTCTGTCTACCTGTTAGTTCACAGTGCTCCGACACGAGAGTGGTTCTTACATTTTCTTAAAACAACTTCCTCTTACTATGGAAGGAGAGCCTGAGTTTCTGATGGAGTTGTTGGCGTATGCATCCAATTCAGGAACATGCAATTTGGCAGTCGAATGCAGCATTTCTGGGAAGAGTATCTGACCCGCAGTTTCATGCATCTCTTGGAAGCGGCTACGGAATTGGTACGAGTTCCAGTGTGGATATACACTCCTCGGTGGGACCTGCGCTTAATACAAATGGGAAGCCTCGAGCACGTCGCGGATCTGCCACTGATCCACAAAGCGTCTATGCACGCGTGAGTATTCCTAGACCTTGATTAATTTCGAATAATGCCAAACACCGAGTCCACTTTCATTGAAGAGAAGTGAGGAGGTTTTGAAATTTAAGAGAAAATCACCAAAGAGATGGCCGAAGGTACATGTGGACCTTTAGCTTCTCTTGGCGTAGTAAGACCCCGTTCAGTAAGCATTTCATGAAGACTGGTAATGCTTCTAAGACTCCCTCATGCACACATGCATGTTCGTACTTCTCTACAGCTGCATCTTCTATCAGAATGCTCAATTATCAGTTAAGAACTACAAGTCCGGAGATGGGATCGCGTGCTCTCAGTAGCATTACGAATCAAATGTAGATCTCATAGCCAACCTGATGACTTATAAGAGTTTGTCAAGACACTCATTCAGAAAGTAAGAGAAATGTCAAGTGAGTTGTGATTGCACTGTTCGCGTTAAATGTGATGCGCTATCTTGGCAAAACCAATGTATGTCAATTTTGTACTCTAAGTAAACCACTCAATATGTTTTCAGCACAGACGGGAACGCATCACTGAGCGCCTGAAAATTCTACAACACCTTGTTCCCAATGGAGCTAAGGTATGCACCCCACTTCAGTACAATTTCACCACGGTATCTTGCACTCTTCACGTAATGGAAACACAGGAACGTCAGCAGGCTCACTGGATTGTCACTGACTTGATTCTTCCCTAGATTTACCTCCCTTATCTAAGACAGTCGTGATGTCTTTCTGAGCAATCTGATGTCTTTCTGATCTTGCCATGGTATGGCTAGGTTGATATAGTAACGATGCTGGAGGAGGCAATCAGCTACGTCAAATTTCTGCAACTGCAAGTGAGGGTGCGTGGATTTTGTTGCCCAGCTTATTATTATATTCACTGTTTGAAGGGGAGTTAAAGGAACCAAATAGTGACACTGAAGTGTATGCAGGCCTGAAGAAAGATCTGACGTCTGCTTCTGTATCGTGGAGGTTGCAGTATTTAAGTTCTGATGAATACTGGATATACGCACCTACAACTTACAACGGCGTGGACGTTTCGATGGGTATGCATTTCCAGGGCATGGACTCACAAGCTTGAACACACGACCTTCAACAAATTGATACAGATCGCTTTGGTCTACGAAAATTTCCAAACTTCTCCTCTTTATATATAATGACCTGAGTGTCCTCAATCCAACTCTGTAGGAAAGGACCTCCCACAAAATTTAGGAACCGCCTGGTGTAGAAGTTTCTCTGGCATTCTCAGGGGTGAGGCTTTAAACGACTTGAAGAGTTGCAGACTAGTATCATCTCCATACCAGTCAAAATTCAACATGATGATAGAAATATCAAATATCCATCTGTACAATTGTGAACCCTGAGTCGAATACCAGTGCGGTTCGAATAAACGAGAAATTCAGCAAGCAATTTTTCTATATCAAGAAGTGTTTACTACAAATTGAGAAGAC

mRNA

>Mapoly0091s0008.2
GACGCTTCCCTGCAAACGGAGATAGAGAGAGGGAGTGAGAGAACTTACCTTGGGCTGTAGTCTGATCTATATTAGATCGAGCCAAGGCTTGCCGTGGGCTTGATATGAGCTTGAGTAGCAGGACGCATGTCAACTGAGCTGAATTCTGAAAATATCTGACACCTCCGATCTTCTGGATGTCTCAGAGATCTGAGAGAGGCTACTTATGAGCGTCGATTACTCACTGCTCGGAGGCCTTCACGAAGGATCGTCCATTGATTAGGAGCTTTCATGTCTACATGTATCACCAAACAGTGATTTTCATAGTTGTGCTCTGAGGACCTTATGATCATCATTTCGACTTGGTTGCGGTTGCTGTACGTAGGAGGGTGAAAATCAAAATCCCAACGCTCGAGGGACATTCAGAGATATGAGACTTTGACATGCAAGAGACCATGCATGCCTAGCTGTTGCATTTGCTTCTCCGGCTTCTTGATTCGAAATTCATTAAGAGGAAACTCGGAGAAACTGCTGAAACAAAATCCGACTTTCGTGATCGGAACTGTACATAATTTACAGATAAAGTCTTTATTCCGGCGAGTATGGCGAATTATGATAGCAGCTTACAGTCTGGGAACTCGGAAGAAACAGCTGTGTCTACTTCGCAAGCACTGACAAGTCCTTGCGAAGCCATGTGGGATGGATGGACAACTCAGACATCCACTGCATCTGCAGGGCCTCCAAGCATCTCACTGACTGATCTCCAAGTGCAAGGCTCAATTGTACATATGAAGAGCTCTACAAATTTTCAATCAGACTTGCTCTCATCCTGGCTGTCTGGCTTCCAAACTCTGTCTCAGGCCGCGGGTGTGCTTGGTGCAGTCGACCATGATCAGCCACAGTCACAAGAGGGTACCGGTAGCTTAATGTATCCGGATGAATTCTCCCGGTTGAACATATGTTCCACGTCATCGGATGAGCGTCCAGACGGGGTGGCTCACTCAGAGAGCTCGCATGCCTCGCAGTTATTCATCGAGCGCTGCAGTGATCAGAATATCATGAGGGCAGATCGTGAATTTTGTGAGACTCCAGTTACGGAGGACAGTAGCAAAAGAGAGGAATCAGCTCCGTATTTTCGCAGCACAAGCGCTCCCAATCAATCTAGTAATTTTGACAAAGTGGTGAGGAATACTGAACAAGATCAGCATATGGTGCGGACTCCTGAAACAGACTTGAGCTCCAGAACATCGTCACCCCCCTCCATGCAGCTGGCTTCGTATGGTCAAATGATGCAGCATCTGGTTGGACAATACGAGAGCAACCCAGCCACCACTTGGCTTAGTTGCGTCACATCATCTTCCTCACAACTGCGACCATCTGACAACGGCTTACGTCCAGTCCAGGGTGATCTCAGCAGAGCCAACACAAGCAGTGAAAGTATAATACTACACCACCACAGGCCAGGAAGTAACCATTTTTCCAGCGCCAACGATCCGTACTGCAAGGCCTCTGCTGAGAACATGTACGCTGAATTGCATGGTCTTCTGACGAAAACTCAACAAGATTCCCTGACAGGCACAATTCAGCTTCCGCAGGCACCGGCTGCCACTTCTGCTTGTGGTTGGTCACAATTCACGGACGCGAACATGCAAGGCCAGCAGAGCATTTTTGCCTCCGATGCAAGTACCGCAGCCATAACTCCAAAGCCGACGAGAAGAACGGAAGATCCATCATCATCTCACGCAGGAAAGGCAAGAGCATCCGTTGTCAAAGTAGCCCGTTCAAATCCAGAGCGGCAAGAGAAAAGGTCTTCTCGGGGACATGACGATGAGTCGGGAAGTAGCAGTCCCGCCTTGAAACGATCCTGCATTGAACATGCAATTTGGCAGTCGAATGCAGCATTTCTGGGAAGAGTATCTGACCCGCAGTTTCATGCATCTCTTGGAAGCGGCTACGGAATTGGTACGAGTTCCAGTGTGGATATACACTCCTCGGTGGGACCTGCGCTTAATACAAATGGGAAGCCTCGAGCACGTCGCGGATCTGCCACTGATCCACAAAGCGTCTATGCACGCCACAGACGGGAACGCATCACTGAGCGCCTGAAAATTCTACAACACCTTGTTCCCAATGGAGCTAAGGTTGATATAGTAACGATGCTGGAGGAGGCAATCAGCTACGTCAAATTTCTGCAACTGCAAGTGAGGTATTTAAGTTCTGATGAATACTGGATATACGCACCTACAACTTACAACGGCGTGGACGTTTCGATGGGTATGCATTTCCAGGGCATGGACTCACAAGCTTGAACACACGACCTTCAACAAATTGATACAGATCGCTTTGGTCTACGAAAATTTCCAAACTTCTCCTCTTTATATATAATGACCTGAGTGTCCTCAATCCAACTCTGTAGGAAAGGACCTCCCACAAAATTTAGGAACCGCCTGGTGTAGAAGTTTCTCTGGCATTCTCAGGGGTGAGGCTTTAAACGACTTGAAGAGTTGCAGACTAGTATCATCTCCATACCAGTCAAAATTCAACATGATGATAGAAATATCAAATATCCATCTGTACAATTGTGAACCCTGAGTCGAATACCAGTGCGGTTCGAATAAACGAGAAATTCAGCAAGCAATTTTTCTATATCAAGAAGTGTTTACTACAAATTGAGAAGAC

CDS

>Mapoly0091s0008.2
ATGGCGAATTATGATAGCAGCTTACAGTCTGGGAACTCGGAAGAAACAGCTGTGTCTACTTCGCAAGCACTGACAAGTCCTTGCGAAGCCATGTGGGATGGATGGACAACTCAGACATCCACTGCATCTGCAGGGCCTCCAAGCATCTCACTGACTGATCTCCAAGTGCAAGGCTCAATTGTACATATGAAGAGCTCTACAAATTTTCAATCAGACTTGCTCTCATCCTGGCTGTCTGGCTTCCAAACTCTGTCTCAGGCCGCGGGTGTGCTTGGTGCAGTCGACCATGATCAGCCACAGTCACAAGAGGGTACCGGTAGCTTAATGTATCCGGATGAATTCTCCCGGTTGAACATATGTTCCACGTCATCGGATGAGCGTCCAGACGGGGTGGCTCACTCAGAGAGCTCGCATGCCTCGCAGTTATTCATCGAGCGCTGCAGTGATCAGAATATCATGAGGGCAGATCGTGAATTTTGTGAGACTCCAGTTACGGAGGACAGTAGCAAAAGAGAGGAATCAGCTCCGTATTTTCGCAGCACAAGCGCTCCCAATCAATCTAGTAATTTTGACAAAGTGGTGAGGAATACTGAACAAGATCAGCATATGGTGCGGACTCCTGAAACAGACTTGAGCTCCAGAACATCGTCACCCCCCTCCATGCAGCTGGCTTCGTATGGTCAAATGATGCAGCATCTGGTTGGACAATACGAGAGCAACCCAGCCACCACTTGGCTTAGTTGCGTCACATCATCTTCCTCACAACTGCGACCATCTGACAACGGCTTACGTCCAGTCCAGGGTGATCTCAGCAGAGCCAACACAAGCAGTGAAAGTATAATACTACACCACCACAGGCCAGGAAGTAACCATTTTTCCAGCGCCAACGATCCGTACTGCAAGGCCTCTGCTGAGAACATGTACGCTGAATTGCATGGTCTTCTGACGAAAACTCAACAAGATTCCCTGACAGGCACAATTCAGCTTCCGCAGGCACCGGCTGCCACTTCTGCTTGTGGTTGGTCACAATTCACGGACGCGAACATGCAAGGCCAGCAGAGCATTTTTGCCTCCGATGCAAGTACCGCAGCCATAACTCCAAAGCCGACGAGAAGAACGGAAGATCCATCATCATCTCACGCAGGAAAGGCAAGAGCATCCGTTGTCAAAGTAGCCCGTTCAAATCCAGAGCGGCAAGAGAAAAGGTCTTCTCGGGGACATGACGATGAGTCGGGAAGTAGCAGTCCCGCCTTGAAACGATCCTGCATTGAACATGCAATTTGGCAGTCGAATGCAGCATTTCTGGGAAGAGTATCTGACCCGCAGTTTCATGCATCTCTTGGAAGCGGCTACGGAATTGGTACGAGTTCCAGTGTGGATATACACTCCTCGGTGGGACCTGCGCTTAATACAAATGGGAAGCCTCGAGCACGTCGCGGATCTGCCACTGATCCACAAAGCGTCTATGCACGCCACAGACGGGAACGCATCACTGAGCGCCTGAAAATTCTACAACACCTTGTTCCCAATGGAGCTAAGGTTGATATAGTAACGATGCTGGAGGAGGCAATCAGCTACGTCAAATTTCTGCAACTGCAAGTGAGGTATTTAAGTTCTGATGAATACTGGATATACGCACCTACAACTTACAACGGCGTGGACGTTTCGATGGGTATGCATTTCCAGGGCATGGACTCACAAGCTTGA

Protein

>Mapoly0091s0008.2
MANYDSSLQSGNSEETAVSTSQALTSPCEAMWDGWTTQTSTASAGPPSISLTDLQVQGSIVHMKSSTNFQSDLLSSWLSGFQTLSQAAGVLGAVDHDQPQSQEGTGSLMYPDEFSRLNICSTSSDERPDGVAHSESSHASQLFIERCSDQNIMRADREFCETPVTEDSSKREESAPYFRSTSAPNQSSNFDKVVRNTEQDQHMVRTPETDLSSRTSSPPSMQLASYGQMMQHLVGQYESNPATTWLSCVTSSSSQLRPSDNGLRPVQGDLSRANTSSESIILHHHRPGSNHFSSANDPYCKASAENMYAELHGLLTKTQQDSLTGTIQLPQAPAATSACGWSQFTDANMQGQQSIFASDASTAAITPKPTRRTEDPSSSHAGKARASVVKVARSNPERQEKRSSRGHDDESGSSSPALKRSCIEHAIWQSNAAFLGRVSDPQFHASLGSGYGIGTSSSVDIHSSVGPALNTNGKPRARRGSATDPQSVYARHRRERITERLKILQHLVPNGAKVDIVTMLEEAISYVKFLQLQVRYLSSDEYWIYAPTTYNGVDVSMGMHFQGMDSQA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>