Mapoly0091s0012



Description

Myb-like DNA-binding domain

Reference DB

Database ID Description
OrthoMCL OG5_131259
PFAM PF13921 Myb-like DNA-binding domain

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB18 transcription factor, MYB Mapoly0091s0012.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0091s0012.1 scaffold_91:170788..177025  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0091s0012.2 scaffold_91:170788..177025  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0091s0012.1  

Gene structure:

mRNA scaffold_91:170788..177025  ( + strand )
five_prime_UTR scaffold_91:170788..171817  ( + strand )
CDS scaffold_91:171818..171910  ( + strand )
CDS scaffold_91:172075..172228  ( + strand )
CDS scaffold_91:172354..172482  ( + strand )
CDS scaffold_91:172634..172753  ( + strand )
CDS scaffold_91:172870..172998  ( + strand )
CDS scaffold_91:173121..173228  ( + strand )
CDS scaffold_91:173547..173857  ( + strand )
CDS scaffold_91:174361..174460  ( + strand )
CDS scaffold_91:174549..174660  ( + strand )
CDS scaffold_91:174804..174925  ( + strand )
CDS scaffold_91:175089..175189  ( + strand )
CDS scaffold_91:175298..175371  ( + strand )
CDS scaffold_91:175557..175652  ( + strand )
CDS scaffold_91:175764..175826  ( + strand )
CDS scaffold_91:175917..176886  ( + strand )
three_prime_UTR scaffold_91:176887..177025  ( + strand )

Sequences:

Gene

>Mapoly0091s0012.1
GGGAATCTAATATCGCATTAAAGTCATCCCTCTGCAAGCAACAAGTTGTGTTTCCGTTTCGCACGTCGCAACTTCTGACCTCTGGCAATTTCCAGGACAAGAGTCCACCTGTTAAATATCTGCTATACTCGTCGGTACGAAGAGGATATCAGCAGCTGAATTCGTGAACGCACTTCTTATTTGAGCCGCTATATTCTAAAAAAAGATTCGGCCGTATTAGCTAATGACGAAAATTCGACAAAAAACTCGAGGCACAATGCTGTTCGAGTACGAGGGCGTTGACAGGAGTTCGTCATGGCCACTTGGTTGTTGGTGGAGGGTGCCTCCCCAACGTGACAGGTTTCCTTGTCTGTGCTTGACATGCACACCATTCACTGTTGGAACTGCCGTTTCTGATCAGAGCAAGTCCTGTTCCACTGAACTTATGACTAAATTCTGTCATAGAATTAGCCCGCGAAAAAAGAAAGAGAAATCACACACGAAGACTTCAGCTGCTCCTGCCGGGATATCAGAAGCAGGATTGGACTGTCACTGCCAAGGGCTTTTACTCGAATGGAGGAACAACTGAATTGCTCCACACGAATGGGGCAGCCCACTGACATTGATACAGTATCCGGAAGACTGTCGACAACCTTTGACCTGTACTGGACATTTGGAGAACTCGGATTTGGCTTTTGAGATCAGCACTCCAGCAATGAGAGGGGATTACAAGGGCGAATGTTTGATTTGTCTGTTATTGACACTGAACCTCACACCTCCAGTAGTCAGTTGCCGGAGACTAGTGTGCTGCCAAAATTGTGTGAGAGAGCAGGGATGTTGGGTCGAAGCGGCCCCCATTGATCTGCTCTTCTGAGGATCTCCTTCATAAGGTTTAACGAGCAAAACCTTCAGTCGAAATCGATCCAGACTCGTACTCAGTCAAATCTGAGAGGACTGTGAAACCGAAGTGTGTTTGTTTCTTCCTGGATCGTGAAAGGCTGTTTATTTACGAGGGCTCCACGTTATTCACGTTGGTTTCTTTGGAATACGGATGAAGAGCTCTCTGGTAGTCGATTGTCGGACTCATCCTGGGGACTGGAAATTCAAGAGGTCTAAACTCTTGGTACAAAGTGTTTGTTTCCAGGTTAGTTGTTTTTCAGTTGTATCTCAAGATTTTCTGGGCATGAGCAAGTGCAGTGAACTAGATTTTGAGAAGAAAATGGTTGCGATTAGCGCTCGGGCCATAGATATGTCTTACCCTTATAAGTCACGTATCCAGTACTTCTCAAACGATCACCTGTTATGTAGGATGTACTGTATAACTCTTACAGCAAGCTCTTTGATTCTTGGAACGGTCTGCATGAGGATATCGCAGGAGTAGCGTCTCCAGCTGACGTTAGTCAACGGCACTCGAGTCCAATGGGGAGGAAGCGCAATTCTCGTGACGACTCTGGGGAAAATGGTAGAACTCCATGGACTTGACTTCATTGAGCTACTTTGAGTGCGTTTGCAAGCCTTAATAAGCCCAGCTTTCGTACATCGCGGACTTTCGAAAAATCTGACCTGATCACGTGTCTACTTGCTTAGGACATGCCGATCAAGAGACCCCAGTTGAGGAGGTAGAGAGGCAGTACTGTGAGTTCTCGAAGTATAGTACATCTTTACCAGATCTTCAAGCAGGAAAGAGCCGAAGGAGTAAATCCTCTCGAAAGTCATGTAAGAGTTGCTCTACCCGACGTTATGCCTCACTTCAATTTATGCTTAAATTTATCTTGAAACTGCTTTCAAAGACAGACGATTATCAGCTCTTTGACGTCGTCAATCTTACTCCATTGTACCTGCTGGATGGTTGTAATTGTTTATGCAGTAACTTGGAAGGAGGAGGCGAAGAAGAGAAGCACGGAGTGTCTTAATTATAATCCTTCTACTCCTGAGGCCAAAATGAAGAAACCACTTGTATTAGATTTCAACCATTCGGAAGAACGCGGTGAGTAGAAAGTTCTGTAGGACATGCTGGGTTCAATCGCATTTGTGGACAATTAGTACCTTGACCCAGCGTCATGCACGTGGACAATTACGTGCACTAACAGCGGTTCTCATTAGGTCCTGATACTCGAAACACGCCGATTGGGGAAGTAAATAAGAAGAGTAGCTTCAGTTCGAAGTTCCCTGTTCGCACTTCAACACTGGAGATGGGGACGCGTAAGAGCAGAAATTACTCTGGAGTACCTGGTGAGGACGCCTTGCTATTGAACAGTGAATAGACGATCACTTCTTACATGTGTTAGAGACGTGAAATCTTGTCTGCCACATCGGGGTTTGAAAAAAATGCTCGTTGTTGTTAAATGTTACAGGGCCAGAATACGCTAGCAGTCTACCACGCGAGATAAATCGAGGCATTCGGGATTCAGAAGTCTCCATGTGTACCCCAGAAGAGAGGAGTTTGAGTACACCGAGTACCGGTAGGAATTCTAAGAACAACTTAAACGTGCTTGCCACACGTGTCTTGGAGAGTTGATTTTTTCTTGTTTGTAATATAGATTGCTGAGTATGCCAATCTGTACCATCGTGAGAAAGCATTCATAAACTCATCCTGTCGGCGGGGATTCAATTAAACATGCGTTCATTCTTGAACTCGTGACGTGAATCTATAATATGCTTGGAGACAATGGCTTTTATGATAAAAAAAATGCCAGGGCGATCATAGAAAGCCATTTCTTCAAATGTGTATCAAATTACGACGACGATGAATTCTCTAACCAAATCCCCGTTCTGATCAGGACTTGATCATGAAGCAACTCTAATTCACAAGACAAAGAGGCGGATGACCGAGGAATCTGAGCCTCCCCTGTTTACTCCACTTTCTCAGATTCGTGGGAGAGATGCCCATTGCATACCTCTCACAGTAAAGCTAGCTAAAAGCCAGAAAAAGCTTTTCTGTGGCCCCGATGACAAGGCCAAACGATGCAAAGACGATGATGAGGAGGAGAGGGGGTGGGCTTCAGATAGGAGGAGGAAGGACCTTGACCACGGGAAATTCACAGAAGATGAAATTATAAGCTTGAACTGCGGTTTGAATCAGTTAATGGAGGTAGTTTTTCTGAAGGATATCTGCAATACATATTCAGTTCACTGCCATGTGTCAGCTATTTTGTTCTTAGTGAGCGTAGATTTTCGCATTTTACACGTTCCAAGGCAGATAATTTACCGATTCCGGTTTTATGGCACCTTCTGAGAATAGCTGTGTTGCACTTGTCGTTAGAGCAAGTTTATTACGACTTCGGTACTCACGGTGCTTCTTAGATTTCATAACTTTAGCATCATCTTGACAGTCGCCAGTATCGGCTGAACCTTCGACAAATTTTGAAGGTTCTGCTGATGCACTATCTGCTTCCAGAATACTAGTGCTTAACTCAGGGAGAATGTGAAATCAACGAATCAAGGCTACTCTTAGTTGAAGTTGATATTTTATTGTGACGACGTTTCAACAACTTACTTTAATCTGAAATCATTCAACAGACAAAAATGTGTTTTCTGCCAATCACTGTACGCCTTTGCTAATATTGATAATCTTCTAATGTGCTCGTGTTTCAGGCACGGAATTGGACCAGGGAGGAGGCTGCCAAAATACTTACCCACCAAAGCGGTAGGGGAAATCCACATGCTGAAGCTCGGGGTGCCTGGAAAGAAATTGGTAAGTCACGTGAATAGATGCTCCAAGTTTCATAGTTTCATACTAAGTCGAAGTTCCTAACATTGAAGTCTGGAATTCATGGTTGCAGCCAAATTTCTACCCAGTTCTTCAATTGTACGAGTGAACATGAAGGTCCGTGAGCTTCTTTTTAAGGGGAAAACTGGCAGGTGGGACGCGGAGGAGACAGAACGGCTGAAACGGTAATCTACTCTTGTACATTAGCTCCAACTCATTTTCTAAGTTTCGCTTCTTTTTCTTCTCGCGGAGAAGTTTGAACTTTCTGTAAATTCATTCATACAAAAATGATTTACTCTTCTGATGGGTCGATTTGTTGTCTTGAAAGGCTGGTTCAGAAACATGGTAACAATTGGACCACTATCGCATGTCATTTGGGACGATCTAATGGAGCATGCGCGCGAAAGTGGAGGAGTATAAGAACGGACGAATGCACGTTCAGGAAGAGGGGTAACTAATTTGTGACTGTTGCCGTGTTAGATCTAATACATATGTTAAACCCGCTACACGCGATTTGGGAAGGGGCAAACTTGAAGAGATTAACAAGTTGGGAAGGGGCAAACTTGAATAGATTAACAAGTTACGGATTTCGTCGTGTCGTTATATTTTACAGGCAAATGGACCCAAGACGAGTACGATGAATTATGTAGGCATGTTCGTGACGCAAAAGCCACTAAGATCTTCAAGTCTACAAAGAGAATCGGCAAGCGCAAGGTTATTCGAAGAATTTCTCGATCATATTTTTATAACACATAAGTAATTATTTTATACTCATGTGCCTCTGCGAAAACTAAACTTATTCCTGTGGTATGCACATTACAGGTTAGAGATGATCTATGCTGGGAACCAATTGCATTGAGGATGTGTCGACCGGCAAACCAATGCAGTGCGGTGTGGTCTGTATACTCCCCTTCGTTCAGATCCAACGCACCAGTATTAATTCGTTACGCATAATCTAACTCACAATCTACGATGATGGTCTCATATAGAGGTTCTTGCTCGCCTTATATTATTTCAGTAAACAAGCTTCCTTCATACTCAATTGCAGTCATACTTGAACTTTTACCGTTGTCCTTTTTAGGTATGAACGACTGGCACCATCTATGCACAAGGAGCTTTGTCTTGATGAAAAAGATCGTCAATGGTCAGATGAGGATGATCGTCGGCTGCTTACAAGGTGATTTTTGGTTTGTTCTTATCTCGTTGTGGATTTATTATCGATGTATAAATGTTGTCAAATTGGGCCGTCTTTTTTCTGACTGCAGCTTGTTTGAACTTGTTCTACCAGGATGCTGAGGCTCATGTCACCTCATGGTAGTATCTGTTGGCGCAAAGTTTATCTAAAAAACAGGTAACTCTCGGACTCATTGAGTCAGATATAGTTGTTCAATCGATAGAATAGTGCGTGTGCTGATCCTGATACTCGTGAATGCACCTGTAGGAAAACTGCAACTTGTAAGGCCAGGTTCAACCAAATGACACACCCAAAATGCCTAGGAGAGAAGCACGAAGCAACTTTACACGAGAAATTAGAAATTTTGGTCAGACGATATGCGCCGGACTTGACAGTCCAGAATCCTATAGGTGGATTGGATGAGTCCAGAATTCATTTGGTTGAGGAGATGATCAAAAGGCACGATAGTGAAAGTGACTTTGATATTACGGAATCAAGGAGGGAAGAATACGAGTGGACAATGAATACGTTCGGGAGCGATGACAGAAGATCGACCTACAAAAGCCGTGCGGCACATTCTCAGGGTTGTGGTGACCAGCAAGAGGATAACATTTTACCACTGAGGATGGAAAAAGAGGTTGATTGCAGAGTAAGGGGAACTCCAGGTTTCGAAACAAAACGGAGCAAGGATCAACGCAAGATTGAAAGGGAGAGTACGCCTTCTGGTTACAAATTTGAGGAGAATGATAATTTGAGTGCAAATGATTCTATGGGAAGAGAAAGTGAGTGGGGTTGGAGTTCTCCCAGAAGGAAAGAAGAAGATGAGTATTCTGTACACTGTGCAGAGTGTGATCTGGACCCCGTCAGCCAGCATCGTCCGAGGGTCCAAGAACGTAAAACTGTAAGTAGGTATATTGTTTATAATTCAAATCAGAGGAATTTGGATCTAGTCAGAGAGACTAGAGAAGATTCTTCTGTCAAGGATGTCAGAGTTAGTAGGAAATGTTGTACGAGACCCAGTAGTGAAACTTCCTATTCTTTAGAATGCCAGAATTGTGATAGGAAAAACGGGGGTAATTTTTTTTACAATCTAACTAAGCACGATAGGAGTAAGAATAAGACTACATTCTATAGAGTCGAACAGGGAAACCAGTGTACATCCGTCGGCCTAAAAGATGGGAAAACCGTGCGGGAAAGTTCATATACTGATGACGAATCTACAAGCTTGGATTTTTGAGCCTGGTCATTAAGGTCCGATTGTCTCTAAAACTAGAGCACAGAATACAAAAGATATCAGCAGTCAATCCATCGATTAAGAAAGGTAAATATATTCTTGAAGACCATTCATATTTTTTTTGCGTTTATGTTTACTCAGG

mRNA

>Mapoly0091s0012.1
GGGAATCTAATATCGCATTAAAGTCATCCCTCTGCAAGCAACAAGTTGTGTTTCCGTTTCGCACGTCGCAACTTCTGACCTCTGGCAATTTCCAGGACAAGAGTCCACCTGTTAAATATCTGCTATACTCGTCGGTACGAAGAGGATATCAGCAGCTGAATTCGTGAACGCACTTCTTATTTGAGCCGCTATATTCTAAAAAAAGATTCGGCCGTATTAGCTAATGACGAAAATTCGACAAAAAACTCGAGGCACAATGCTGTTCGAGTACGAGGGCGTTGACAGGAGTTCGTCATGGCCACTTGGTTGTTGGTGGAGGGTGCCTCCCCAACGTGACAGGTTTCCTTGTCTGTGCTTGACATGCACACCATTCACTGTTGGAACTGCCGTTTCTGATCAGAGCAAGTCCTGTTCCACTGAACTTATGACTAAATTCTGTCATAGAATTAGCCCGCGAAAAAAGAAAGAGAAATCACACACGAAGACTTCAGCTGCTCCTGCCGGGATATCAGAAGCAGGATTGGACTGTCACTGCCAAGGGCTTTTACTCGAATGGAGGAACAACTGAATTGCTCCACACGAATGGGGCAGCCCACTGACATTGATACAGTATCCGGAAGACTGTCGACAACCTTTGACCTGTACTGGACATTTGGAGAACTCGGATTTGGCTTTTGAGATCAGCACTCCAGCAATGAGAGGGGATTACAAGGGCGAATGTTTGATTTGTCTGTTATTGACACTGAACCTCACACCTCCAGTAGTCAGTTGCCGGAGACTAGTGTGCTGCCAAAATTGTGTGAGAGAGCAGGGATGTTGGGTCGAAGCGGCCCCCATTGATCTGCTCTTCTGAGGATCTCCTTCATAAGGTTTAACGAGCAAAACCTTCAGTCGAAATCGATCCAGACTCGTACTCAGTCAAATCTGAGAGGACTGTGAAACCGAAGTGTGTTTGTTTCTTCCTGGATCGTGAAAGGCTGTTTATTTACGAGGGCTCCACGTTATTCACGTTGGTTTCTTTGGAATACGGATGAAGAGCTCTCTGGTAGTCGATTGTCGGACTCATCCTGGGGACTGGAAATTCAAGAGGTCTAAACTCTTGGTACAAAGTGTTTGTTTCCAGGATGTACTGTATAACTCTTACAGCAAGCTCTTTGATTCTTGGAACGGTCTGCATGAGGATATCGCAGGAGTAGCGTCTCCAGCTGACGTTAGTCAACGGCACTCGAGTCCAATGGGGAGGAAGCGCAATTCTCGTGACGACTCTGGGGAAAATGGACATGCCGATCAAGAGACCCCAGTTGAGGAGGTAGAGAGGCAGTACTGTGAGTTCTCGAAGTATAGTACATCTTTACCAGATCTTCAAGCAGGAAAGAGCCGAAGGAGTAAATCCTCTCGAAAGTCATTAACTTGGAAGGAGGAGGCGAAGAAGAGAAGCACGGAGTGTCTTAATTATAATCCTTCTACTCCTGAGGCCAAAATGAAGAAACCACTTGTATTAGATTTCAACCATTCGGAAGAACGCGGTCCTGATACTCGAAACACGCCGATTGGGGAAGTAAATAAGAAGAGTAGCTTCAGTTCGAAGTTCCCTGTTCGCACTTCAACACTGGAGATGGGGACGCGTAAGAGCAGAAATTACTCTGGAGTACCTGGGCCAGAATACGCTAGCAGTCTACCACGCGAGATAAATCGAGGCATTCGGGATTCAGAAGTCTCCATGTGTACCCCAGAAGAGAGGAGTTTGAGTACACCGAGTACCGGACTTGATCATGAAGCAACTCTAATTCACAAGACAAAGAGGCGGATGACCGAGGAATCTGAGCCTCCCCTGTTTACTCCACTTTCTCAGATTCGTGGGAGAGATGCCCATTGCATACCTCTCACAGTAAAGCTAGCTAAAAGCCAGAAAAAGCTTTTCTGTGGCCCCGATGACAAGGCCAAACGATGCAAAGACGATGATGAGGAGGAGAGGGGGTGGGCTTCAGATAGGAGGAGGAAGGACCTTGACCACGGGAAATTCACAGAAGATGAAATTATAAGCTTGAACTGCGGTTTGAATCAGTTAATGGAGGCACGGAATTGGACCAGGGAGGAGGCTGCCAAAATACTTACCCACCAAAGCGGTAGGGGAAATCCACATGCTGAAGCTCGGGGTGCCTGGAAAGAAATTGCCAAATTTCTACCCAGTTCTTCAATTGTACGAGTGAACATGAAGGTCCGTGAGCTTCTTTTTAAGGGGAAAACTGGCAGGTGGGACGCGGAGGAGACAGAACGGCTGAAACGGCTGGTTCAGAAACATGGTAACAATTGGACCACTATCGCATGTCATTTGGGACGATCTAATGGAGCATGCGCGCGAAAGTGGAGGAGTATAAGAACGGACGAATGCACGTTCAGGAAGAGGGGCAAATGGACCCAAGACGAGTACGATGAATTATGTAGGCATGTTCGTGACGCAAAAGCCACTAAGATCTTCAAGTCTACAAAGAGAATCGGCAAGCGCAAGGTTAGAGATGATCTATGCTGGGAACCAATTGCATTGAGGATGTGTCGACCGGCAAACCAATGCAGTGCGGTGTGGTATGAACGACTGGCACCATCTATGCACAAGGAGCTTTGTCTTGATGAAAAAGATCGTCAATGGTCAGATGAGGATGATCGTCGGCTGCTTACAAGGATGCTGAGGCTCATGTCACCTCATGGTAGTATCTGTTGGCGCAAAGTTTATCTAAAAAACAGGAAAACTGCAACTTGTAAGGCCAGGTTCAACCAAATGACACACCCAAAATGCCTAGGAGAGAAGCACGAAGCAACTTTACACGAGAAATTAGAAATTTTGGTCAGACGATATGCGCCGGACTTGACAGTCCAGAATCCTATAGGTGGATTGGATGAGTCCAGAATTCATTTGGTTGAGGAGATGATCAAAAGGCACGATAGTGAAAGTGACTTTGATATTACGGAATCAAGGAGGGAAGAATACGAGTGGACAATGAATACGTTCGGGAGCGATGACAGAAGATCGACCTACAAAAGCCGTGCGGCACATTCTCAGGGTTGTGGTGACCAGCAAGAGGATAACATTTTACCACTGAGGATGGAAAAAGAGGTTGATTGCAGAGTAAGGGGAACTCCAGGTTTCGAAACAAAACGGAGCAAGGATCAACGCAAGATTGAAAGGGAGAGTACGCCTTCTGGTTACAAATTTGAGGAGAATGATAATTTGAGTGCAAATGATTCTATGGGAAGAGAAAGTGAGTGGGGTTGGAGTTCTCCCAGAAGGAAAGAAGAAGATGAGTATTCTGTACACTGTGCAGAGTGTGATCTGGACCCCGTCAGCCAGCATCGTCCGAGGGTCCAAGAACGTAAAACTGTAAGTAGGTATATTGTTTATAATTCAAATCAGAGGAATTTGGATCTAGTCAGAGAGACTAGAGAAGATTCTTCTGTCAAGGATGTCAGAGTTAGTAGGAAATGTTGTACGAGACCCAGTAGTGAAACTTCCTATTCTTTAGAATGCCAGAATTGTGATAGGAAAAACGGGGGTAATTTTTTTTACAATCTAACTAAGCACGATAGGAGTAAGAATAAGACTACATTCTATAGAGTCGAACAGGGAAACCAGTGTACATCCGTCGGCCTAAAAGATGGGAAAACCGTGCGGGAAAGTTCATATACTGATGACGAATCTACAAGCTTGGATTTTTGAGCCTGGTCATTAAGGTCCGATTGTCTCTAAAACTAGAGCACAGAATACAAAAGATATCAGCAGTCAATCCATCGATTAAGAAAGGTAAATATATTCTTGAAGACCATTCATATTTTTTTTGCGTTTATGTTTACTCAGG

CDS

>Mapoly0091s0012.1
ATGAAGAGCTCTCTGGTAGTCGATTGTCGGACTCATCCTGGGGACTGGAAATTCAAGAGGTCTAAACTCTTGGTACAAAGTGTTTGTTTCCAGGATGTACTGTATAACTCTTACAGCAAGCTCTTTGATTCTTGGAACGGTCTGCATGAGGATATCGCAGGAGTAGCGTCTCCAGCTGACGTTAGTCAACGGCACTCGAGTCCAATGGGGAGGAAGCGCAATTCTCGTGACGACTCTGGGGAAAATGGACATGCCGATCAAGAGACCCCAGTTGAGGAGGTAGAGAGGCAGTACTGTGAGTTCTCGAAGTATAGTACATCTTTACCAGATCTTCAAGCAGGAAAGAGCCGAAGGAGTAAATCCTCTCGAAAGTCATTAACTTGGAAGGAGGAGGCGAAGAAGAGAAGCACGGAGTGTCTTAATTATAATCCTTCTACTCCTGAGGCCAAAATGAAGAAACCACTTGTATTAGATTTCAACCATTCGGAAGAACGCGGTCCTGATACTCGAAACACGCCGATTGGGGAAGTAAATAAGAAGAGTAGCTTCAGTTCGAAGTTCCCTGTTCGCACTTCAACACTGGAGATGGGGACGCGTAAGAGCAGAAATTACTCTGGAGTACCTGGGCCAGAATACGCTAGCAGTCTACCACGCGAGATAAATCGAGGCATTCGGGATTCAGAAGTCTCCATGTGTACCCCAGAAGAGAGGAGTTTGAGTACACCGAGTACCGGACTTGATCATGAAGCAACTCTAATTCACAAGACAAAGAGGCGGATGACCGAGGAATCTGAGCCTCCCCTGTTTACTCCACTTTCTCAGATTCGTGGGAGAGATGCCCATTGCATACCTCTCACAGTAAAGCTAGCTAAAAGCCAGAAAAAGCTTTTCTGTGGCCCCGATGACAAGGCCAAACGATGCAAAGACGATGATGAGGAGGAGAGGGGGTGGGCTTCAGATAGGAGGAGGAAGGACCTTGACCACGGGAAATTCACAGAAGATGAAATTATAAGCTTGAACTGCGGTTTGAATCAGTTAATGGAGGCACGGAATTGGACCAGGGAGGAGGCTGCCAAAATACTTACCCACCAAAGCGGTAGGGGAAATCCACATGCTGAAGCTCGGGGTGCCTGGAAAGAAATTGCCAAATTTCTACCCAGTTCTTCAATTGTACGAGTGAACATGAAGGTCCGTGAGCTTCTTTTTAAGGGGAAAACTGGCAGGTGGGACGCGGAGGAGACAGAACGGCTGAAACGGCTGGTTCAGAAACATGGTAACAATTGGACCACTATCGCATGTCATTTGGGACGATCTAATGGAGCATGCGCGCGAAAGTGGAGGAGTATAAGAACGGACGAATGCACGTTCAGGAAGAGGGGCAAATGGACCCAAGACGAGTACGATGAATTATGTAGGCATGTTCGTGACGCAAAAGCCACTAAGATCTTCAAGTCTACAAAGAGAATCGGCAAGCGCAAGGTTAGAGATGATCTATGCTGGGAACCAATTGCATTGAGGATGTGTCGACCGGCAAACCAATGCAGTGCGGTGTGGTATGAACGACTGGCACCATCTATGCACAAGGAGCTTTGTCTTGATGAAAAAGATCGTCAATGGTCAGATGAGGATGATCGTCGGCTGCTTACAAGGATGCTGAGGCTCATGTCACCTCATGGTAGTATCTGTTGGCGCAAAGTTTATCTAAAAAACAGGAAAACTGCAACTTGTAAGGCCAGGTTCAACCAAATGACACACCCAAAATGCCTAGGAGAGAAGCACGAAGCAACTTTACACGAGAAATTAGAAATTTTGGTCAGACGATATGCGCCGGACTTGACAGTCCAGAATCCTATAGGTGGATTGGATGAGTCCAGAATTCATTTGGTTGAGGAGATGATCAAAAGGCACGATAGTGAAAGTGACTTTGATATTACGGAATCAAGGAGGGAAGAATACGAGTGGACAATGAATACGTTCGGGAGCGATGACAGAAGATCGACCTACAAAAGCCGTGCGGCACATTCTCAGGGTTGTGGTGACCAGCAAGAGGATAACATTTTACCACTGAGGATGGAAAAAGAGGTTGATTGCAGAGTAAGGGGAACTCCAGGTTTCGAAACAAAACGGAGCAAGGATCAACGCAAGATTGAAAGGGAGAGTACGCCTTCTGGTTACAAATTTGAGGAGAATGATAATTTGAGTGCAAATGATTCTATGGGAAGAGAAAGTGAGTGGGGTTGGAGTTCTCCCAGAAGGAAAGAAGAAGATGAGTATTCTGTACACTGTGCAGAGTGTGATCTGGACCCCGTCAGCCAGCATCGTCCGAGGGTCCAAGAACGTAAAACTGTAAGTAGGTATATTGTTTATAATTCAAATCAGAGGAATTTGGATCTAGTCAGAGAGACTAGAGAAGATTCTTCTGTCAAGGATGTCAGAGTTAGTAGGAAATGTTGTACGAGACCCAGTAGTGAAACTTCCTATTCTTTAGAATGCCAGAATTGTGATAGGAAAAACGGGGGTAATTTTTTTTACAATCTAACTAAGCACGATAGGAGTAAGAATAAGACTACATTCTATAGAGTCGAACAGGGAAACCAGTGTACATCCGTCGGCCTAAAAGATGGGAAAACCGTGCGGGAAAGTTCATATACTGATGACGAATCTACAAGCTTGGATTTTTGA

Protein

>Mapoly0091s0012.1
MKSSLVVDCRTHPGDWKFKRSKLLVQSVCFQDVLYNSYSKLFDSWNGLHEDIAGVASPADVSQRHSSPMGRKRNSRDDSGENGHADQETPVEEVERQYCEFSKYSTSLPDLQAGKSRRSKSSRKSLTWKEEAKKRSTECLNYNPSTPEAKMKKPLVLDFNHSEERGPDTRNTPIGEVNKKSSFSSKFPVRTSTLEMGTRKSRNYSGVPGPEYASSLPREINRGIRDSEVSMCTPEERSLSTPSTGLDHEATLIHKTKRRMTEESEPPLFTPLSQIRGRDAHCIPLTVKLAKSQKKLFCGPDDKAKRCKDDDEEERGWASDRRRKDLDHGKFTEDEIISLNCGLNQLMEARNWTREEAAKILTHQSGRGNPHAEARGAWKEIAKFLPSSSIVRVNMKVRELLFKGKTGRWDAEETERLKRLVQKHGNNWTTIACHLGRSNGACARKWRSIRTDECTFRKRGKWTQDEYDELCRHVRDAKATKIFKSTKRIGKRKVRDDLCWEPIALRMCRPANQCSAVWYERLAPSMHKELCLDEKDRQWSDEDDRRLLTRMLRLMSPHGSICWRKVYLKNRKTATCKARFNQMTHPKCLGEKHEATLHEKLEILVRRYAPDLTVQNPIGGLDESRIHLVEEMIKRHDSESDFDITESRREEYEWTMNTFGSDDRRSTYKSRAAHSQGCGDQQEDNILPLRMEKEVDCRVRGTPGFETKRSKDQRKIERESTPSGYKFEENDNLSANDSMGRESEWGWSSPRRKEEDEYSVHCAECDLDPVSQHRPRVQERKTVSRYIVYNSNQRNLDLVRETREDSSVKDVRVSRKCCTRPSSETSYSLECQNCDRKNGGNFFYNLTKHDRSKNKTTFYRVEQGNQCTSVGLKDGKTVRESSYTDDESTSLDF

Mapoly0091s0012.2  

Gene structure:

mRNA scaffold_91:170788..177025  ( + strand )
five_prime_UTR scaffold_91:170788..171910  ( + strand )
five_prime_UTR scaffold_91:172142..172185  ( + strand )
CDS scaffold_91:172186..172228  ( + strand )
CDS scaffold_91:172354..172482  ( + strand )
CDS scaffold_91:172634..172753  ( + strand )
CDS scaffold_91:172870..172998  ( + strand )
CDS scaffold_91:173121..173228  ( + strand )
CDS scaffold_91:173547..173857  ( + strand )
CDS scaffold_91:174361..174460  ( + strand )
CDS scaffold_91:174549..174660  ( + strand )
CDS scaffold_91:174804..174925  ( + strand )
CDS scaffold_91:175089..175189  ( + strand )
CDS scaffold_91:175298..175371  ( + strand )
CDS scaffold_91:175557..175652  ( + strand )
CDS scaffold_91:175764..175826  ( + strand )
CDS scaffold_91:175917..176886  ( + strand )
three_prime_UTR scaffold_91:176887..177025  ( + strand )

Sequences:

Gene

>Mapoly0091s0012.2
GGGAATCTAATATCGCATTAAAGTCATCCCTCTGCAAGCAACAAGTTGTGTTTCCGTTTCGCACGTCGCAACTTCTGACCTCTGGCAATTTCCAGGACAAGAGTCCACCTGTTAAATATCTGCTATACTCGTCGGTACGAAGAGGATATCAGCAGCTGAATTCGTGAACGCACTTCTTATTTGAGCCGCTATATTCTAAAAAAAGATTCGGCCGTATTAGCTAATGACGAAAATTCGACAAAAAACTCGAGGCACAATGCTGTTCGAGTACGAGGGCGTTGACAGGAGTTCGTCATGGCCACTTGGTTGTTGGTGGAGGGTGCCTCCCCAACGTGACAGGTTTCCTTGTCTGTGCTTGACATGCACACCATTCACTGTTGGAACTGCCGTTTCTGATCAGAGCAAGTCCTGTTCCACTGAACTTATGACTAAATTCTGTCATAGAATTAGCCCGCGAAAAAAGAAAGAGAAATCACACACGAAGACTTCAGCTGCTCCTGCCGGGATATCAGAAGCAGGATTGGACTGTCACTGCCAAGGGCTTTTACTCGAATGGAGGAACAACTGAATTGCTCCACACGAATGGGGCAGCCCACTGACATTGATACAGTATCCGGAAGACTGTCGACAACCTTTGACCTGTACTGGACATTTGGAGAACTCGGATTTGGCTTTTGAGATCAGCACTCCAGCAATGAGAGGGGATTACAAGGGCGAATGTTTGATTTGTCTGTTATTGACACTGAACCTCACACCTCCAGTAGTCAGTTGCCGGAGACTAGTGTGCTGCCAAAATTGTGTGAGAGAGCAGGGATGTTGGGTCGAAGCGGCCCCCATTGATCTGCTCTTCTGAGGATCTCCTTCATAAGGTTTAACGAGCAAAACCTTCAGTCGAAATCGATCCAGACTCGTACTCAGTCAAATCTGAGAGGACTGTGAAACCGAAGTGTGTTTGTTTCTTCCTGGATCGTGAAAGGCTGTTTATTTACGAGGGCTCCACGTTATTCACGTTGGTTTCTTTGGAATACGGATGAAGAGCTCTCTGGTAGTCGATTGTCGGACTCATCCTGGGGACTGGAAATTCAAGAGGTCTAAACTCTTGGTACAAAGTGTTTGTTTCCAGGTTAGTTGTTTTTCAGTTGTATCTCAAGATTTTCTGGGCATGAGCAAGTGCAGTGAACTAGATTTTGAGAAGAAAATGGTTGCGATTAGCGCTCGGGCCATAGATATGTCTTACCCTTATAAGTCACGTATCCAGTACTTCTCAAACGATCACCTGTTATGTAGGATGTACTGTATAACTCTTACAGCAAGCTCTTTGATTCTTGGAACGGTCTGCATGAGGATATCGCAGGAGTAGCGTCTCCAGCTGACGTTAGTCAACGGCACTCGAGTCCAATGGGGAGGAAGCGCAATTCTCGTGACGACTCTGGGGAAAATGGTAGAACTCCATGGACTTGACTTCATTGAGCTACTTTGAGTGCGTTTGCAAGCCTTAATAAGCCCAGCTTTCGTACATCGCGGACTTTCGAAAAATCTGACCTGATCACGTGTCTACTTGCTTAGGACATGCCGATCAAGAGACCCCAGTTGAGGAGGTAGAGAGGCAGTACTGTGAGTTCTCGAAGTATAGTACATCTTTACCAGATCTTCAAGCAGGAAAGAGCCGAAGGAGTAAATCCTCTCGAAAGTCATGTAAGAGTTGCTCTACCCGACGTTATGCCTCACTTCAATTTATGCTTAAATTTATCTTGAAACTGCTTTCAAAGACAGACGATTATCAGCTCTTTGACGTCGTCAATCTTACTCCATTGTACCTGCTGGATGGTTGTAATTGTTTATGCAGTAACTTGGAAGGAGGAGGCGAAGAAGAGAAGCACGGAGTGTCTTAATTATAATCCTTCTACTCCTGAGGCCAAAATGAAGAAACCACTTGTATTAGATTTCAACCATTCGGAAGAACGCGGTGAGTAGAAAGTTCTGTAGGACATGCTGGGTTCAATCGCATTTGTGGACAATTAGTACCTTGACCCAGCGTCATGCACGTGGACAATTACGTGCACTAACAGCGGTTCTCATTAGGTCCTGATACTCGAAACACGCCGATTGGGGAAGTAAATAAGAAGAGTAGCTTCAGTTCGAAGTTCCCTGTTCGCACTTCAACACTGGAGATGGGGACGCGTAAGAGCAGAAATTACTCTGGAGTACCTGGTGAGGACGCCTTGCTATTGAACAGTGAATAGACGATCACTTCTTACATGTGTTAGAGACGTGAAATCTTGTCTGCCACATCGGGGTTTGAAAAAAATGCTCGTTGTTGTTAAATGTTACAGGGCCAGAATACGCTAGCAGTCTACCACGCGAGATAAATCGAGGCATTCGGGATTCAGAAGTCTCCATGTGTACCCCAGAAGAGAGGAGTTTGAGTACACCGAGTACCGGTAGGAATTCTAAGAACAACTTAAACGTGCTTGCCACACGTGTCTTGGAGAGTTGATTTTTTCTTGTTTGTAATATAGATTGCTGAGTATGCCAATCTGTACCATCGTGAGAAAGCATTCATAAACTCATCCTGTCGGCGGGGATTCAATTAAACATGCGTTCATTCTTGAACTCGTGACGTGAATCTATAATATGCTTGGAGACAATGGCTTTTATGATAAAAAAAATGCCAGGGCGATCATAGAAAGCCATTTCTTCAAATGTGTATCAAATTACGACGACGATGAATTCTCTAACCAAATCCCCGTTCTGATCAGGACTTGATCATGAAGCAACTCTAATTCACAAGACAAAGAGGCGGATGACCGAGGAATCTGAGCCTCCCCTGTTTACTCCACTTTCTCAGATTCGTGGGAGAGATGCCCATTGCATACCTCTCACAGTAAAGCTAGCTAAAAGCCAGAAAAAGCTTTTCTGTGGCCCCGATGACAAGGCCAAACGATGCAAAGACGATGATGAGGAGGAGAGGGGGTGGGCTTCAGATAGGAGGAGGAAGGACCTTGACCACGGGAAATTCACAGAAGATGAAATTATAAGCTTGAACTGCGGTTTGAATCAGTTAATGGAGGTAGTTTTTCTGAAGGATATCTGCAATACATATTCAGTTCACTGCCATGTGTCAGCTATTTTGTTCTTAGTGAGCGTAGATTTTCGCATTTTACACGTTCCAAGGCAGATAATTTACCGATTCCGGTTTTATGGCACCTTCTGAGAATAGCTGTGTTGCACTTGTCGTTAGAGCAAGTTTATTACGACTTCGGTACTCACGGTGCTTCTTAGATTTCATAACTTTAGCATCATCTTGACAGTCGCCAGTATCGGCTGAACCTTCGACAAATTTTGAAGGTTCTGCTGATGCACTATCTGCTTCCAGAATACTAGTGCTTAACTCAGGGAGAATGTGAAATCAACGAATCAAGGCTACTCTTAGTTGAAGTTGATATTTTATTGTGACGACGTTTCAACAACTTACTTTAATCTGAAATCATTCAACAGACAAAAATGTGTTTTCTGCCAATCACTGTACGCCTTTGCTAATATTGATAATCTTCTAATGTGCTCGTGTTTCAGGCACGGAATTGGACCAGGGAGGAGGCTGCCAAAATACTTACCCACCAAAGCGGTAGGGGAAATCCACATGCTGAAGCTCGGGGTGCCTGGAAAGAAATTGGTAAGTCACGTGAATAGATGCTCCAAGTTTCATAGTTTCATACTAAGTCGAAGTTCCTAACATTGAAGTCTGGAATTCATGGTTGCAGCCAAATTTCTACCCAGTTCTTCAATTGTACGAGTGAACATGAAGGTCCGTGAGCTTCTTTTTAAGGGGAAAACTGGCAGGTGGGACGCGGAGGAGACAGAACGGCTGAAACGGTAATCTACTCTTGTACATTAGCTCCAACTCATTTTCTAAGTTTCGCTTCTTTTTCTTCTCGCGGAGAAGTTTGAACTTTCTGTAAATTCATTCATACAAAAATGATTTACTCTTCTGATGGGTCGATTTGTTGTCTTGAAAGGCTGGTTCAGAAACATGGTAACAATTGGACCACTATCGCATGTCATTTGGGACGATCTAATGGAGCATGCGCGCGAAAGTGGAGGAGTATAAGAACGGACGAATGCACGTTCAGGAAGAGGGGTAACTAATTTGTGACTGTTGCCGTGTTAGATCTAATACATATGTTAAACCCGCTACACGCGATTTGGGAAGGGGCAAACTTGAAGAGATTAACAAGTTGGGAAGGGGCAAACTTGAATAGATTAACAAGTTACGGATTTCGTCGTGTCGTTATATTTTACAGGCAAATGGACCCAAGACGAGTACGATGAATTATGTAGGCATGTTCGTGACGCAAAAGCCACTAAGATCTTCAAGTCTACAAAGAGAATCGGCAAGCGCAAGGTTATTCGAAGAATTTCTCGATCATATTTTTATAACACATAAGTAATTATTTTATACTCATGTGCCTCTGCGAAAACTAAACTTATTCCTGTGGTATGCACATTACAGGTTAGAGATGATCTATGCTGGGAACCAATTGCATTGAGGATGTGTCGACCGGCAAACCAATGCAGTGCGGTGTGGTCTGTATACTCCCCTTCGTTCAGATCCAACGCACCAGTATTAATTCGTTACGCATAATCTAACTCACAATCTACGATGATGGTCTCATATAGAGGTTCTTGCTCGCCTTATATTATTTCAGTAAACAAGCTTCCTTCATACTCAATTGCAGTCATACTTGAACTTTTACCGTTGTCCTTTTTAGGTATGAACGACTGGCACCATCTATGCACAAGGAGCTTTGTCTTGATGAAAAAGATCGTCAATGGTCAGATGAGGATGATCGTCGGCTGCTTACAAGGTGATTTTTGGTTTGTTCTTATCTCGTTGTGGATTTATTATCGATGTATAAATGTTGTCAAATTGGGCCGTCTTTTTTCTGACTGCAGCTTGTTTGAACTTGTTCTACCAGGATGCTGAGGCTCATGTCACCTCATGGTAGTATCTGTTGGCGCAAAGTTTATCTAAAAAACAGGTAACTCTCGGACTCATTGAGTCAGATATAGTTGTTCAATCGATAGAATAGTGCGTGTGCTGATCCTGATACTCGTGAATGCACCTGTAGGAAAACTGCAACTTGTAAGGCCAGGTTCAACCAAATGACACACCCAAAATGCCTAGGAGAGAAGCACGAAGCAACTTTACACGAGAAATTAGAAATTTTGGTCAGACGATATGCGCCGGACTTGACAGTCCAGAATCCTATAGGTGGATTGGATGAGTCCAGAATTCATTTGGTTGAGGAGATGATCAAAAGGCACGATAGTGAAAGTGACTTTGATATTACGGAATCAAGGAGGGAAGAATACGAGTGGACAATGAATACGTTCGGGAGCGATGACAGAAGATCGACCTACAAAAGCCGTGCGGCACATTCTCAGGGTTGTGGTGACCAGCAAGAGGATAACATTTTACCACTGAGGATGGAAAAAGAGGTTGATTGCAGAGTAAGGGGAACTCCAGGTTTCGAAACAAAACGGAGCAAGGATCAACGCAAGATTGAAAGGGAGAGTACGCCTTCTGGTTACAAATTTGAGGAGAATGATAATTTGAGTGCAAATGATTCTATGGGAAGAGAAAGTGAGTGGGGTTGGAGTTCTCCCAGAAGGAAAGAAGAAGATGAGTATTCTGTACACTGTGCAGAGTGTGATCTGGACCCCGTCAGCCAGCATCGTCCGAGGGTCCAAGAACGTAAAACTGTAAGTAGGTATATTGTTTATAATTCAAATCAGAGGAATTTGGATCTAGTCAGAGAGACTAGAGAAGATTCTTCTGTCAAGGATGTCAGAGTTAGTAGGAAATGTTGTACGAGACCCAGTAGTGAAACTTCCTATTCTTTAGAATGCCAGAATTGTGATAGGAAAAACGGGGGTAATTTTTTTTACAATCTAACTAAGCACGATAGGAGTAAGAATAAGACTACATTCTATAGAGTCGAACAGGGAAACCAGTGTACATCCGTCGGCCTAAAAGATGGGAAAACCGTGCGGGAAAGTTCATATACTGATGACGAATCTACAAGCTTGGATTTTTGAGCCTGGTCATTAAGGTCCGATTGTCTCTAAAACTAGAGCACAGAATACAAAAGATATCAGCAGTCAATCCATCGATTAAGAAAGGTAAATATATTCTTGAAGACCATTCATATTTTTTTTGCGTTTATGTTTACTCAGG

mRNA

>Mapoly0091s0012.2
GGGAATCTAATATCGCATTAAAGTCATCCCTCTGCAAGCAACAAGTTGTGTTTCCGTTTCGCACGTCGCAACTTCTGACCTCTGGCAATTTCCAGGACAAGAGTCCACCTGTTAAATATCTGCTATACTCGTCGGTACGAAGAGGATATCAGCAGCTGAATTCGTGAACGCACTTCTTATTTGAGCCGCTATATTCTAAAAAAAGATTCGGCCGTATTAGCTAATGACGAAAATTCGACAAAAAACTCGAGGCACAATGCTGTTCGAGTACGAGGGCGTTGACAGGAGTTCGTCATGGCCACTTGGTTGTTGGTGGAGGGTGCCTCCCCAACGTGACAGGTTTCCTTGTCTGTGCTTGACATGCACACCATTCACTGTTGGAACTGCCGTTTCTGATCAGAGCAAGTCCTGTTCCACTGAACTTATGACTAAATTCTGTCATAGAATTAGCCCGCGAAAAAAGAAAGAGAAATCACACACGAAGACTTCAGCTGCTCCTGCCGGGATATCAGAAGCAGGATTGGACTGTCACTGCCAAGGGCTTTTACTCGAATGGAGGAACAACTGAATTGCTCCACACGAATGGGGCAGCCCACTGACATTGATACAGTATCCGGAAGACTGTCGACAACCTTTGACCTGTACTGGACATTTGGAGAACTCGGATTTGGCTTTTGAGATCAGCACTCCAGCAATGAGAGGGGATTACAAGGGCGAATGTTTGATTTGTCTGTTATTGACACTGAACCTCACACCTCCAGTAGTCAGTTGCCGGAGACTAGTGTGCTGCCAAAATTGTGTGAGAGAGCAGGGATGTTGGGTCGAAGCGGCCCCCATTGATCTGCTCTTCTGAGGATCTCCTTCATAAGGTTTAACGAGCAAAACCTTCAGTCGAAATCGATCCAGACTCGTACTCAGTCAAATCTGAGAGGACTGTGAAACCGAAGTGTGTTTGTTTCTTCCTGGATCGTGAAAGGCTGTTTATTTACGAGGGCTCCACGTTATTCACGTTGGTTTCTTTGGAATACGGATGAAGAGCTCTCTGGTAGTCGATTGTCGGACTCATCCTGGGGACTGGAAATTCAAGAGGTCTAAACTCTTGGTACAAAGTGTTTGTTTCCAGGAGTAGCGTCTCCAGCTGACGTTAGTCAACGGCACTCGAGTCCAATGGGGAGGAAGCGCAATTCTCGTGACGACTCTGGGGAAAATGGACATGCCGATCAAGAGACCCCAGTTGAGGAGGTAGAGAGGCAGTACTGTGAGTTCTCGAAGTATAGTACATCTTTACCAGATCTTCAAGCAGGAAAGAGCCGAAGGAGTAAATCCTCTCGAAAGTCATTAACTTGGAAGGAGGAGGCGAAGAAGAGAAGCACGGAGTGTCTTAATTATAATCCTTCTACTCCTGAGGCCAAAATGAAGAAACCACTTGTATTAGATTTCAACCATTCGGAAGAACGCGGTCCTGATACTCGAAACACGCCGATTGGGGAAGTAAATAAGAAGAGTAGCTTCAGTTCGAAGTTCCCTGTTCGCACTTCAACACTGGAGATGGGGACGCGTAAGAGCAGAAATTACTCTGGAGTACCTGGGCCAGAATACGCTAGCAGTCTACCACGCGAGATAAATCGAGGCATTCGGGATTCAGAAGTCTCCATGTGTACCCCAGAAGAGAGGAGTTTGAGTACACCGAGTACCGGACTTGATCATGAAGCAACTCTAATTCACAAGACAAAGAGGCGGATGACCGAGGAATCTGAGCCTCCCCTGTTTACTCCACTTTCTCAGATTCGTGGGAGAGATGCCCATTGCATACCTCTCACAGTAAAGCTAGCTAAAAGCCAGAAAAAGCTTTTCTGTGGCCCCGATGACAAGGCCAAACGATGCAAAGACGATGATGAGGAGGAGAGGGGGTGGGCTTCAGATAGGAGGAGGAAGGACCTTGACCACGGGAAATTCACAGAAGATGAAATTATAAGCTTGAACTGCGGTTTGAATCAGTTAATGGAGGCACGGAATTGGACCAGGGAGGAGGCTGCCAAAATACTTACCCACCAAAGCGGTAGGGGAAATCCACATGCTGAAGCTCGGGGTGCCTGGAAAGAAATTGCCAAATTTCTACCCAGTTCTTCAATTGTACGAGTGAACATGAAGGTCCGTGAGCTTCTTTTTAAGGGGAAAACTGGCAGGTGGGACGCGGAGGAGACAGAACGGCTGAAACGGCTGGTTCAGAAACATGGTAACAATTGGACCACTATCGCATGTCATTTGGGACGATCTAATGGAGCATGCGCGCGAAAGTGGAGGAGTATAAGAACGGACGAATGCACGTTCAGGAAGAGGGGCAAATGGACCCAAGACGAGTACGATGAATTATGTAGGCATGTTCGTGACGCAAAAGCCACTAAGATCTTCAAGTCTACAAAGAGAATCGGCAAGCGCAAGGTTAGAGATGATCTATGCTGGGAACCAATTGCATTGAGGATGTGTCGACCGGCAAACCAATGCAGTGCGGTGTGGTATGAACGACTGGCACCATCTATGCACAAGGAGCTTTGTCTTGATGAAAAAGATCGTCAATGGTCAGATGAGGATGATCGTCGGCTGCTTACAAGGATGCTGAGGCTCATGTCACCTCATGGTAGTATCTGTTGGCGCAAAGTTTATCTAAAAAACAGGAAAACTGCAACTTGTAAGGCCAGGTTCAACCAAATGACACACCCAAAATGCCTAGGAGAGAAGCACGAAGCAACTTTACACGAGAAATTAGAAATTTTGGTCAGACGATATGCGCCGGACTTGACAGTCCAGAATCCTATAGGTGGATTGGATGAGTCCAGAATTCATTTGGTTGAGGAGATGATCAAAAGGCACGATAGTGAAAGTGACTTTGATATTACGGAATCAAGGAGGGAAGAATACGAGTGGACAATGAATACGTTCGGGAGCGATGACAGAAGATCGACCTACAAAAGCCGTGCGGCACATTCTCAGGGTTGTGGTGACCAGCAAGAGGATAACATTTTACCACTGAGGATGGAAAAAGAGGTTGATTGCAGAGTAAGGGGAACTCCAGGTTTCGAAACAAAACGGAGCAAGGATCAACGCAAGATTGAAAGGGAGAGTACGCCTTCTGGTTACAAATTTGAGGAGAATGATAATTTGAGTGCAAATGATTCTATGGGAAGAGAAAGTGAGTGGGGTTGGAGTTCTCCCAGAAGGAAAGAAGAAGATGAGTATTCTGTACACTGTGCAGAGTGTGATCTGGACCCCGTCAGCCAGCATCGTCCGAGGGTCCAAGAACGTAAAACTGTAAGTAGGTATATTGTTTATAATTCAAATCAGAGGAATTTGGATCTAGTCAGAGAGACTAGAGAAGATTCTTCTGTCAAGGATGTCAGAGTTAGTAGGAAATGTTGTACGAGACCCAGTAGTGAAACTTCCTATTCTTTAGAATGCCAGAATTGTGATAGGAAAAACGGGGGTAATTTTTTTTACAATCTAACTAAGCACGATAGGAGTAAGAATAAGACTACATTCTATAGAGTCGAACAGGGAAACCAGTGTACATCCGTCGGCCTAAAAGATGGGAAAACCGTGCGGGAAAGTTCATATACTGATGACGAATCTACAAGCTTGGATTTTTGAGCCTGGTCATTAAGGTCCGATTGTCTCTAAAACTAGAGCACAGAATACAAAAGATATCAGCAGTCAATCCATCGATTAAGAAAGGTAAATATATTCTTGAAGACCATTCATATTTTTTTTGCGTTTATGTTTACTCAGG

CDS

>Mapoly0091s0012.2
ATGGGGAGGAAGCGCAATTCTCGTGACGACTCTGGGGAAAATGGACATGCCGATCAAGAGACCCCAGTTGAGGAGGTAGAGAGGCAGTACTGTGAGTTCTCGAAGTATAGTACATCTTTACCAGATCTTCAAGCAGGAAAGAGCCGAAGGAGTAAATCCTCTCGAAAGTCATTAACTTGGAAGGAGGAGGCGAAGAAGAGAAGCACGGAGTGTCTTAATTATAATCCTTCTACTCCTGAGGCCAAAATGAAGAAACCACTTGTATTAGATTTCAACCATTCGGAAGAACGCGGTCCTGATACTCGAAACACGCCGATTGGGGAAGTAAATAAGAAGAGTAGCTTCAGTTCGAAGTTCCCTGTTCGCACTTCAACACTGGAGATGGGGACGCGTAAGAGCAGAAATTACTCTGGAGTACCTGGGCCAGAATACGCTAGCAGTCTACCACGCGAGATAAATCGAGGCATTCGGGATTCAGAAGTCTCCATGTGTACCCCAGAAGAGAGGAGTTTGAGTACACCGAGTACCGGACTTGATCATGAAGCAACTCTAATTCACAAGACAAAGAGGCGGATGACCGAGGAATCTGAGCCTCCCCTGTTTACTCCACTTTCTCAGATTCGTGGGAGAGATGCCCATTGCATACCTCTCACAGTAAAGCTAGCTAAAAGCCAGAAAAAGCTTTTCTGTGGCCCCGATGACAAGGCCAAACGATGCAAAGACGATGATGAGGAGGAGAGGGGGTGGGCTTCAGATAGGAGGAGGAAGGACCTTGACCACGGGAAATTCACAGAAGATGAAATTATAAGCTTGAACTGCGGTTTGAATCAGTTAATGGAGGCACGGAATTGGACCAGGGAGGAGGCTGCCAAAATACTTACCCACCAAAGCGGTAGGGGAAATCCACATGCTGAAGCTCGGGGTGCCTGGAAAGAAATTGCCAAATTTCTACCCAGTTCTTCAATTGTACGAGTGAACATGAAGGTCCGTGAGCTTCTTTTTAAGGGGAAAACTGGCAGGTGGGACGCGGAGGAGACAGAACGGCTGAAACGGCTGGTTCAGAAACATGGTAACAATTGGACCACTATCGCATGTCATTTGGGACGATCTAATGGAGCATGCGCGCGAAAGTGGAGGAGTATAAGAACGGACGAATGCACGTTCAGGAAGAGGGGCAAATGGACCCAAGACGAGTACGATGAATTATGTAGGCATGTTCGTGACGCAAAAGCCACTAAGATCTTCAAGTCTACAAAGAGAATCGGCAAGCGCAAGGTTAGAGATGATCTATGCTGGGAACCAATTGCATTGAGGATGTGTCGACCGGCAAACCAATGCAGTGCGGTGTGGTATGAACGACTGGCACCATCTATGCACAAGGAGCTTTGTCTTGATGAAAAAGATCGTCAATGGTCAGATGAGGATGATCGTCGGCTGCTTACAAGGATGCTGAGGCTCATGTCACCTCATGGTAGTATCTGTTGGCGCAAAGTTTATCTAAAAAACAGGAAAACTGCAACTTGTAAGGCCAGGTTCAACCAAATGACACACCCAAAATGCCTAGGAGAGAAGCACGAAGCAACTTTACACGAGAAATTAGAAATTTTGGTCAGACGATATGCGCCGGACTTGACAGTCCAGAATCCTATAGGTGGATTGGATGAGTCCAGAATTCATTTGGTTGAGGAGATGATCAAAAGGCACGATAGTGAAAGTGACTTTGATATTACGGAATCAAGGAGGGAAGAATACGAGTGGACAATGAATACGTTCGGGAGCGATGACAGAAGATCGACCTACAAAAGCCGTGCGGCACATTCTCAGGGTTGTGGTGACCAGCAAGAGGATAACATTTTACCACTGAGGATGGAAAAAGAGGTTGATTGCAGAGTAAGGGGAACTCCAGGTTTCGAAACAAAACGGAGCAAGGATCAACGCAAGATTGAAAGGGAGAGTACGCCTTCTGGTTACAAATTTGAGGAGAATGATAATTTGAGTGCAAATGATTCTATGGGAAGAGAAAGTGAGTGGGGTTGGAGTTCTCCCAGAAGGAAAGAAGAAGATGAGTATTCTGTACACTGTGCAGAGTGTGATCTGGACCCCGTCAGCCAGCATCGTCCGAGGGTCCAAGAACGTAAAACTGTAAGTAGGTATATTGTTTATAATTCAAATCAGAGGAATTTGGATCTAGTCAGAGAGACTAGAGAAGATTCTTCTGTCAAGGATGTCAGAGTTAGTAGGAAATGTTGTACGAGACCCAGTAGTGAAACTTCCTATTCTTTAGAATGCCAGAATTGTGATAGGAAAAACGGGGGTAATTTTTTTTACAATCTAACTAAGCACGATAGGAGTAAGAATAAGACTACATTCTATAGAGTCGAACAGGGAAACCAGTGTACATCCGTCGGCCTAAAAGATGGGAAAACCGTGCGGGAAAGTTCATATACTGATGACGAATCTACAAGCTTGGATTTTTGA

Protein

>Mapoly0091s0012.2
MGRKRNSRDDSGENGHADQETPVEEVERQYCEFSKYSTSLPDLQAGKSRRSKSSRKSLTWKEEAKKRSTECLNYNPSTPEAKMKKPLVLDFNHSEERGPDTRNTPIGEVNKKSSFSSKFPVRTSTLEMGTRKSRNYSGVPGPEYASSLPREINRGIRDSEVSMCTPEERSLSTPSTGLDHEATLIHKTKRRMTEESEPPLFTPLSQIRGRDAHCIPLTVKLAKSQKKLFCGPDDKAKRCKDDDEEERGWASDRRRKDLDHGKFTEDEIISLNCGLNQLMEARNWTREEAAKILTHQSGRGNPHAEARGAWKEIAKFLPSSSIVRVNMKVRELLFKGKTGRWDAEETERLKRLVQKHGNNWTTIACHLGRSNGACARKWRSIRTDECTFRKRGKWTQDEYDELCRHVRDAKATKIFKSTKRIGKRKVRDDLCWEPIALRMCRPANQCSAVWYERLAPSMHKELCLDEKDRQWSDEDDRRLLTRMLRLMSPHGSICWRKVYLKNRKTATCKARFNQMTHPKCLGEKHEATLHEKLEILVRRYAPDLTVQNPIGGLDESRIHLVEEMIKRHDSESDFDITESRREEYEWTMNTFGSDDRRSTYKSRAAHSQGCGDQQEDNILPLRMEKEVDCRVRGTPGFETKRSKDQRKIERESTPSGYKFEENDNLSANDSMGRESEWGWSSPRRKEEDEYSVHCAECDLDPVSQHRPRVQERKTVSRYIVYNSNQRNLDLVRETREDSSVKDVRVSRKCCTRPSSETSYSLECQNCDRKNGGNFFYNLTKHDRSKNKTTFYRVEQGNQCTSVGLKDGKTVRESSYTDDESTSLDF

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>