Mapoly0093s0028



Description

HOMEOBOX PROTEIN TRANSCRIPTION FACTORS

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0006355 Regulation of transcription, DNA-dependent
OrthoMCL OG5_158902
PFAM PF05920 Homeobox KN domain
PANTHER PTHR11850 HOMEOBOX PROTEIN TRANSCRIPTION FACTORS

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBELL5 Homeodomain protein Public
MpHD16 transcription factor, HD Mapoly0093s0028.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0093s0028.1 scaffold_93:376005..388588  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0093s0028.2 scaffold_93:376005..388588  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0093s0028.3 scaffold_93:376005..388588  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0093s0028.4 scaffold_93:376005..388588  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0093s0028.1  

Gene structure:

mRNA scaffold_93:376005..388588  ( - strand )
three_prime_UTR scaffold_93:376005..376405  ( - strand )
CDS scaffold_93:376406..376531  ( - strand )
CDS scaffold_93:377229..377276  ( - strand )
CDS scaffold_93:378070..378130  ( - strand )
CDS scaffold_93:378709..379061  ( - strand )
CDS scaffold_93:379761..379883  ( - strand )
CDS scaffold_93:380030..380224  ( - strand )
CDS scaffold_93:381548..381768  ( - strand )
CDS scaffold_93:381944..383092  ( - strand )
CDS scaffold_93:383580..384132  ( - strand )
five_prime_UTR scaffold_93:384133..386376  ( - strand )
five_prime_UTR scaffold_93:386515..388588  ( - strand )

Sequences:

Gene

>Mapoly0093s0028.1
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGTATTTTCAACTTCCAGACTCCCATGGCCAAGAAGTCGAGGCGTTGTATTGGCTTGACAGAAACATTGCGGCGACGATGCTCACTACTCGTTTGGGTGCATCTATGAAGTCCAATACTCTGTTGTGTTCGTTGTCTAGGATCCGCAGCGTTGGTAATCCTTCGAGTACACGACATACATTCATTCTCGTTTTGCAATTATTGAAGGTCCATAATGTTCTCGGATGACTGTGCCGTGAAGAGATCCGCCTCCATCATACAGGGAACAGGAGGCTACTTCGATCCTTCCTATCCGTAGCAGGAGGTAGGACTAGCCAGCCACCACAAAACTGGTGATGTGTTTGCCCCATGTCCCGTCCATCCATACGTTTGTCCAATAGGTGAGGTTAGATTTGCAGGAGCAGAAAATTTAGCGCTCGACTGCCTGCTAACCTTCCGGAGACAGGGTTAGCTTTACTTATATTTGCTGTAATTTCCCACGACTGACAGACTGACTGCGAGAAAGAACGACCGCGTGGGAGCTCGTCGATGTTGCAGCTCTTCCACACAGACAGAGAGCAGTCACTGAATCCACATGAATTTGTCACCGAAAAGGTCCGCTGGCTGAGAATGGAGCGTCAGGTCGACTGCGGTAATTTTCAGGGTTCTGTCGCTCTGTCTCCCACATGAATGAGTGAGTGTAGGGCCTTGTGGATCGAAACTTGCACCGTCCGCCGCGCGAAGTCTACGCTGGGGTGCCTGGCTAGCTACACTGTCGTGGTGAAACTTAGGCTGGCAGAGCTCTAGGAGAGTTGTCCGTGGCACCGTCCACCATCTGGGCGAGCTCAATGCAAGCTGAGCTGAGCTGAGCTGAGCGAGCTTGTGGGATAAGCGAGAAAGGCATACGTGTGTTCCTGTTTTCGCGCCTGTCCTTTGGCGTGGCCGGCCTTGACGGCTTTTGTGGACGCTCATCAGAATTATGACGGTTTCTCCCTCCTCGTGCCCCCCCACGGGACTCGGAAGACCTAAAGAATCGCACCCCCTTGCTCAGAGGGCACCATGTTGAAGCAAGGTCTCCCAGTCTCCGCTCATGTGGCATCTTGAACACTGACCTCCTGGCTGGCAGTCGGTCTACACTTCGTTGCTGCTCGTCAACCCGTTTTCTGCCGATTCGATCACTCTCCCTTGGCTTTCACGGAGGAAGAGCACAGGAACGAATGACAAACTGGAGGCTTACAGTGGCCGTCTCGGAAAGGCCACTCCGGACATTCTGTACCTGCCCTCGACGTCCATTCCAGAAGAGGCGATCCTCTCCGTCTGGGGGTCGTAGCCTTCAATATGTCGGACACATCTTGCGGAGGATTTGCCCTTTTGTTTAGCAGCAGGTTGTCTGCACACTCTCAGAGGTGTGTGACTGGCTACTAAGTAGATCGATGATATCCCAACGTGAGTCTGAAGACAGGCGGGAACAATAAATCTCTCATCTGTCATCGACTACACTAGAAAATTAGACCCTCCGCGTTATTCGATCGCATTAATTCTCCAACACGTTGACCTACCGAACGCCTCACTCCGCAAGTATTTCACCGGGACGCTGCCTACTGGATTTCGAAAGAAGATTGTGGGCGTATCAGACTAATCGTCAACGTCAGACGAATCCATTCTCTGAGAACTGAAAACATAAGAAAGTGATCAACATTAACAAGATGGGCGCTGAACGTGCTTGTCTGTCTTAACAAGAATCTTATTCCTGATGAGGTGTTTTGACTCATCCGTCCCTCCGTCAGAGTTAATTGCTTGTTGTCATTGCGCAGAAGTAGACTGTCAAGTACACTGACTCATTCTCACTGTCAGCCGTACTTGAGACTTTACTCTGGTTTAACTACCCTGGGCATTTCACGCCCGCCGCAGTGACCACTGATTTGCCTGGTCTCATACTTCGAGAAAATTGTAATGAAGCGGTTTCAGAAGAAGGCATTACTCGATTACACAGCGAGATGGCAGTGAACATTGTGCTTTAACATTGGAAGACACGGACTGCTGCTTTCTGCAGCATCATTGATCTCAGAGGATTTGTTCGCAAGACAAAGCCTGGGCCCTTGAGGAAGAACGACATGCTTATTGGAGTGATGCTTGAGGAGTTGGGATGTCTTACAGACGAGATTTCCAGTCATCTGAGATGTACGATCAAATTCACGCAGTTGTAATTTCAACTGTGTTTCGACATGTGCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGTAAGTTTCAATGAACTCTTTGGACGCTTGGAGTCACGCGTTTCTATTCCGCGTTTGAACCGCTACACGAGTCGTCGTATCGCTCTTTTAACTAAACTTCAAACCATCTGAATGGTCCCTGGACTTGTGGGTCGAAATGACGCATTTGAGACTAATGGGCCAATCTGATGCTTTAAAGATGTGGGAACTATTCGACACGTTTGTCTCGAGTAGAAATGTGGAGGGCCTGAAGTAGCAACTCTAGTGATGTAGACTCAAGGGTTGCTGATTGCAGAGACTTTGGAGGTAAGCGGTAGCGTCACTGAGTGAAGAAGGTACATGTGAGAGGGCGTTGGGAAGATTTATCTGGAGACATGAGTCGTCGACATGAATGAATTACCTCGTAAAGCAGTCTGCCTAGTAACCATCGCTTCGATATTGTCGGAACGGTGCTGGAAGTCAGATGTGATGTTTGTGAGCTTCAAGAATATCAATTCTGTCTGTGCAGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAGTACGTTAAGTTCCTCTGTTTCGCGAGATGCCCAATGGAAATTTGATTCGATTCGTAGGAGAACACGTCGGTCACAGTTGGTAATAGAATTGTTGGAGATGAGGAGAATTGCGTCCTGGGGAGTCAACACATGGTTTTGACTTGCGGAGGAGACTAACGGTAAGTTATGTTTCAGAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGGTAAGACCCAACACTCCGTGCCTAAAATCATGTTGCAGACCTATGTGGACAATAGTCCAATCCCAATTCCTGTAGAAGGACCAATTGTTCCACTATCCACGTATCCCAGCCCATGACAGCAACGCTAACACTTTCCTCCAAAACTCATCCAAAAAGACAATTGGACAGAGTACTGACTTCCTGTTGCCTAATCAGCCCTGCAGCTGCGCTTTATCCCCTCAAGGAGAAGCCCCGATTTTCTACCTTCAAGCTTCGCATCGCAGTTGCCTAGGTGGGGACAGAGAGTTTGAAGTGGACCCTCGATTACAGGCTTTGATCACGAAAAGCTCAGAAAATGAACTCGCAAATCTGATCACGGAGTCCAGTTTGTAGTGGTCGAGACAGAGAAGAGGTACAGCTCACCGTATGCGAGTGTTGTAGCGACGTAGGCTTGAGTATTACGTCCTTGACTGGTCTCGTACTGTGAGTGGTGGAACTTTCGAGTAATGTTCCCTGTTGCAGGTTTTCTTCTGGATACGAGCCAGAATATGCCAGTGAATAAGTAATGTGGCTCCCGCACGTCCATCAAGAAACGAAGAAACGAACAAGGGCCCTCTCCCTTGCACAGCATCTCTCGGACCTGTGAACTGTGTAGCTTAAATCTCAGGAGTCGACGAGATTCTGTTCTCGTCACATGGGGATGGGGGTGGGACGAAGAGTGGAGTACTTGAGTAGAACTGTCGACATTGACTGAGTCACGTTCCGATTTCCTCTAAAAGTATCATCATCTAAAAGCATGGCAGTGCTTCAGTTTTCCCCACGAGAGCATCCAATCAAAAGGTCCACGGGTGACCCAACAGGGTGAAGAGACCACTGCTGTGACCCGCGTCCAATCGGGGCAACATTGACAGGGGTAGAGCATCAGTGCGGCCTAACGCCCTCGGTTGTAACTGAGACTTGGAATCGGAGCGTCCAGTCCCTTCTTATCGGGACAGGGCCCAGGGTCCAGGGTCGAAACCAATTTGACCTTCATGTCCGAGAATGGCCTCTGGCCTTCTGTCTCGAAGAGAGGTGATCCTTGAACAAGACTCTTCTTCCCAACCGTCGTTGACACCGATTTGACTGGCTCCCAAAAGTATGCGCCACGCTAAATGCTGATGATGGCCTTGTCGTTGATGCTGACCGTGCAATCCATTAGGCAACTCTGATAGAACACGCAAAAAGGACGAAAGCAGTCGTCAACTTTGCAGTGGTCGTCCATGATCCAGCTCGCCGTTCACGTTCTGATATATTCGTCGAGCATCCAGCAATCGTGTAATTTGCAAGGCTGTATGTGTGAGGCAGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGGTACTGCGCTCATGTCATCTGATGCCTAGAGCGCGCTCTTCGAGCTCGTTGAGAGTAAATCTGGTCCAATTGCAAGAGTAAAGAATCACTCTGCATCTGCTGAAATCCTGCAGGACACGTACTAATCGTGTGGTTCGTCGATGCAGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGGTTCAAAGACTCTAATATTTGCATTCACAAGTTCAATTTGTCACACCAAAAAAACCCTTCTCTTTGATGGCGATTTTTTCCCGGATTGAGAGCGAATCATACATTCTGGCTAGTACTTCGCACCGACAAGGCCACAGACAAGAGTCGTAGGTCGCCGATTTTCACCCACATTTGACAGTCTGTCGGAACACTCCCCGTCTAGTACCGACTTAAGTTACTGCTATGGTGGAATCCAAACCACTCCCACTGTTTGCCAATTTTTAAAATCATGTCAACAATCGGAAAAGAATCGGTCCGCTTGTGAATAGTCGACTCTAGACCAGAAGGCTGCCTGCAAAAGTGAAGATCTTAGATGACCGCTGAATTTGCAAGAGTGAAACCAGCTCAGAGCATGTGTCAGCCTTGCAGAAAGCTAGAAAAGGCCGCGACACACAGAAAACATTCCTTGTCCTCAATGCTGTACTCGATGATGGAAGACGAGGGCTTAAACCGGAATACATAGATTGCATGATCAGTCTTCGGTCTCTTGGCTCAATGGGGCTGACTGCCACTGGTCATTTCTAGGTTTCGATTTGTCGACGTAAAAGATTATTGTGCACACATCGGCCGTGAATCCGACATCTAGTGGTCATGTCATGTTCATCGTTGCATGCTGTACTGCTGTGATCGAAGCGCCTAATCATCAGAATGCGGCTGCAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCGTAAGTGGCGATCCCCTGTTTGACGCAAGGATTTGTTGAATTCGCGCCTCTTGCAGCTAATGAAGACGGGCTTGTCCACAGTGTCAACTGGAGCAACTGTTCCCAAGACCAACAATCTCATGGCTGTCTGAACATGTAGCTTGTTTGTATGGTCTGCGCGTTTCAATCATGGAACTGGAAGCTCAGATTAACTTTACCCGGATTTCTTTGACAATGCATCTGCCTCTGAATATTCCTCTCTCTAAGTTCTGCACCGAAAACTGCTGGAGACTTTCTTTGGGGTTCCTGCTTAGATCATATAATCCGTGTAAAAATTGAAGGAGGTGGTGAATGGAAATTATCTGGAACATGCATGGGTAGAAATGCTTGAGGATTGCGGGGCCTCCTCCAGAATAGTCAAAGCATTGGTAACGAAGTCGCAGTCCGGGGCGAAACAGTTTGTAACTAGGTCAGTCACGTCTAAGCGTTGCTGGGGTCGTGATTGGCAGCGAGGAGCATTTTGTGTCCGTATGTGTCTGGGCAGGTTGACCATACACTATTTGCTTTCACCGTCACTGTTTGCATCTGTTGACCTGCAGCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGTGTCATCTCGGCTCCCCTCTGTTCCAATCAAATGCAACTGTTCTGTGGGCTCGGGGGCCCCGGGGGGTGTAGGGGAACCCTCGCGGCGAAAAGAAAAGGTTGGCTAGTGCACCGACGCCAAGCGCTCTACAATAAGGGAGCTGGCGTGGAATTAATCGCTGCAGATTGTGCTCAGCACATTGGAGACATTATCGGTTCCTGGCTTTTGACTGTTACTGCTAGAACAGTTGGCTTTCTGGAGACAGTTAGAGCTAGAGAAAGGGCGCATATTGCCGAAAAGCAGCTCATAGAAATGCTCTGCTCAGACTTCTGATGGTTTTAGGGTTCCCAGCACAAGCTTGCATCACACTCGTTGTCAAGTCCTTGTACAATCAGAGGGCATCCTTACTATGGCCTCACGATAACTTCTACGGCATGCTTGCATGAATGAGCGATGTGCTTTTGAGAGTAAGCATTCTTTGCACTTTCCTCCTTGAGCCTGAGCCTGAGCCTGAGGCGGTGAGGTGAGTAGAGTATCTGTAGGCCTCTCCCCCAACCCAAAGCCTTAGAATCAGTGTACACTGGATCAGTACTTGACATCTTGACGCAGCAGAGACAGAAGCTGCAGTAGCAGCAGCAGGAGGGACGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCTCAGTTGACTGCACCTACGGCAAGGGGATCACGGATCCTGCAGCTGAGGGCGTGCTAAATTGTCGTCAGATGATTCGTGCACTGTCAGACCTGCCTGAATTATCGCCGTACTGAGTTGTTGAAGTGGTTTACAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAATCCTCTCTCCTCAATTATGGATGTTGTGCAAGCAAGTCTCCAACTGGTAGTCCGAGACCTAAGTGGCATTCGCTTCGCTTGTGTACCTAAGCATCATTACCGGCGCACGAATACGGACGTCTACGTTGTGCACTTTATAGATTCATCCCAACTCATGACTTTAGCGCATTGACATTAGTGGCCACCACCACCACCCAGGACCCAATGTGTTCATGACATTATTCCACTTTGCCCCTCGCTGCTCAATTCATTCTTGCCTTCGCCCATCATCACGCGAAGCCAAGGTAAGTCCGGAAGCGTGCCCCGAAGCCGGCCGAGATACATTGTACCTTCATTCACAGCCTAAGAACTTTGTCTTTGTCGTAAACCGACCGTGATCACGAGCTGCCACGACGTTACGAGGGGCTCCGAGAAAAACGAACAGCTGTTGTTTCCAAGGCCCCGTGTTCGCTGTAAGCTTGGCCCTAATGTGGAAGCCCGACAGGGACTCGGCAACCCACTCGCCGACCCGACGATGGCCAGGCTCAACGCCGCCCTATGAGTCGATCATAGGTAGCGTGACGAGGGTACGTCTAAGCATCGACAAATCCATCGCTAAGTGGCGAATTCTAGAGGGAATGAACATTGTCTAGAGAAGAACAAGTCTTGTCCGGCGACTGACAGCTCGCGGTATGTCGATTGGCAGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

mRNA

>Mapoly0093s0028.1
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGATCCGCAGCGTTGGTAATCCTTCGAGTACACGACATACATTCATTCTCGTTTTGCAATTATTGAAGGTCCATAATGTTCTCGGATGACTGTGCCGTGAAGAGATCCGCCTCCATCATACAGGGAACAGGAGGCTACTTCGATCCTTCCTATCCGTAGCAGGAGGTAGGACTAGCCAGCCACCACAAAACTGGTGATGTGTTTGCCCCATGTCCCGTCCATCCATACGTTTGTCCAATAGGTGAGGTTAGATTTGCAGGAGCAGAAAATTTAGCGCTCGACTGCCTGCTAACCTTCCGGAGACAGGGTTAGCTTTACTTATATTTGCTGTAATTTCCCACGACTGACAGACTGACTGCGAGAAAGAACGACCGCGTGGGAGCTCGTCGATGTTGCAGCTCTTCCACACAGACAGAGAGCAGTCACTGAATCCACATGAATTTGTCACCGAAAAGGTCCGCTGGCTGAGAATGGAGCGTCAGGTCGACTGCGGTAATTTTCAGGGTTCTGTCGCTCTGTCTCCCACATGAATGAGTGAGTGTAGGGCCTTGTGGATCGAAACTTGCACCGTCCGCCGCGCGAAGTCTACGCTGGGGTGCCTGGCTAGCTACACTGTCGTGGTGAAACTTAGGCTGGCAGAGCTCTAGGAGAGTTGTCCGTGGCACCGTCCACCATCTGGGCGAGCTCAATGCAAGCTGAGCTGAGCTGAGCTGAGCGAGCTTGTGGGATAAGCGAGAAAGGCATACGTGTGTTCCTGTTTTCGCGCCTGTCCTTTGGCGTGGCCGGCCTTGACGGCTTTTGTGGACGCTCATCAGAATTATGACGGTTTCTCCCTCCTCGTGCCCCCCCACGGGACTCGGAAGACCTAAAGAATCGCACCCCCTTGCTCAGAGGGCACCATGTTGAAGCAAGGTCTCCCAGTCTCCGCTCATGTGGCATCTTGAACACTGACCTCCTGGCTGGCAGTCGGTCTACACTTCGTTGCTGCTCGTCAACCCGTTTTCTGCCGATTCGATCACTCTCCCTTGGCTTTCACGGAGGAAGAGCACAGGAACGAATGACAAACTGGAGGCTTACAGTGGCCGTCTCGGAAAGGCCACTCCGGACATTCTGTACCTGCCCTCGACGTCCATTCCAGAAGAGGCGATCCTCTCCGTCTGGGGGTCGTAGCCTTCAATATGTCGGACACATCTTGCGGAGGATTTGCCCTTTTGTTTAGCAGCAGGTTGTCTGCACACTCTCAGAGGTGTGTGACTGGCTACTAAGTAGATCGATGATATCCCAACGTGAGTCTGAAGACAGGCGGGAACAATAAATCTCTCATCTGTCATCGACTACACTAGAAAATTAGACCCTCCGCGTTATTCGATCGCATTAATTCTCCAACACGTTGACCTACCGAACGCCTCACTCCGCAAGTATTTCACCGGGACGCTGCCTACTGGATTTCGAAAGAAGATTGTGGGCGTATCAGACTAATCGTCAACGTCAGACGAATCCATTCTCTGAGAACTGAAAACATAAGAAAGTGATCAACATTAACAAGATGGGCGCTGAACGTGCTTGTCTGTCTTAACAAGAATCTTATTCCTGATGAGGTGTTTTGACTCATCCGTCCCTCCGTCAGAGTTAATTGCTTGTTGTCATTGCGCAGAAGTAGACTGTCAAGTACACTGACTCATTCTCACTGTCAGCCGTACTTGAGACTTTACTCTGGTTTAACTACCCTGGGCATTTCACGCCCGCCGCAGTGACCACTGATTTGCCTGGTCTCATACTTCGAGAAAATTGTAATGAAGCGGTTTCAGAAGAAGGCATTACTCGATTACACAGCGAGATGGCAGTGAACATTGTGCTTTAACATTGGAAGACACGGACTGCTGCTTTCTGCAGCATCATTGATCTCAGAGGATTTGTTCGCAAGACAAAGCCTGGGCCCTTGAGGAAGAACGACATGCTTATTGGAGTGATGCTTGAGGAGTTGGGATGTCTTACAGACGAGATTTCCAGTCATCTGAGATGTACGATCAAATTCACGCAGTTGTAATTTCAACTGTGTTTCGACATGTGCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

CDS

>Mapoly0093s0028.1
ATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGA

Protein

>Mapoly0093s0028.1
MVYVANPLETDKSIEHSQKQEDQPAAPGIDSMSRASKEVPRSTVKESESSDLQTQRSAGPVQAVPELHRILDSTNELWRLRGGAVNNHPTEVICVPDGERTAVPQISPSDYLNGTAKENVNYINWYQHGLTNSMPTGRIVTCYAGNNPSDSSTRGETGRNVDISVLTSFHKVSSEEKWDAQALYGDVYSDDPLFHIVPSACPGTASGAVACSEIEPKKFGIGFSTEENVCDLKGQRTIATLEGLKHDEPFAFDDYRADHFFLADPSGNQTLDNCVPELRSAFRVTNSSVAETVSQHLIHHGETSQSAVHPQEKVLPAPTSPIFQLEQYDDIMIFNHHAQQWQDELMNLNYHEANAEGNVGLTSGYKGSATMPVLPEQPQFEAINPFPTRHAVSAPDVATDCFSFWPGEHSSTYHSLEDQSTPYVWPGSPTSEQALTPSYPTEAGTSSYTWKTTDSSLVTAAVDDAKPEKTARKHGVPAEPCASSGDWLESRGSPTCSMSPCAKGKQIAVSTTSQIDKISICQRVSAEQGRTEMLEMLQTVFPDSLDLSQEDNKHVRDARLAWLQEHAKEDILQNSKRDRTNSTEMLSRPTSSLRKKKQKDQEIPEGRLRGTSICTDPDLSYGLAAVQNVLEDFHKSAGLILKAKKLQNQRPSVTDLLNAELEALCIGDALGPEVKGFIMTVIKIGHGKQPAATNPDMVEQILQLKWRLASLMEESRNHERSTLAQLRDTFTRYSFLFPSSASDSFDKRAIPSKYYQDLENVVCQYFRGCSLFFKRSASSASSSSGQQGHENSSNTGGAPDVHAKVRGPLPVEVLGEANAGTSPVVETSDRSRMASRKELSGARGNLPKVAADYMRQWLFQNFQNPNPTRETKLMIATMFNITEKQVTNHFVNLRARKFRPLLRSLQEDPRSDAGHDMQNPDAENKAGPEGPTSAKCAEKIRT

Mapoly0093s0028.2  

Gene structure:

mRNA scaffold_93:376005..388588  ( - strand )
three_prime_UTR scaffold_93:376005..376405  ( - strand )
CDS scaffold_93:376406..376531  ( - strand )
CDS scaffold_93:377229..377276  ( - strand )
CDS scaffold_93:378070..378130  ( - strand )
CDS scaffold_93:378709..379061  ( - strand )
CDS scaffold_93:379761..379883  ( - strand )
CDS scaffold_93:380030..380224  ( - strand )
CDS scaffold_93:381548..381768  ( - strand )
CDS scaffold_93:381944..383092  ( - strand )
CDS scaffold_93:383580..384132  ( - strand )
five_prime_UTR scaffold_93:384133..384304  ( - strand )
five_prime_UTR scaffold_93:386515..388588  ( - strand )

Sequences:

Gene

>Mapoly0093s0028.2
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGTATTTTCAACTTCCAGACTCCCATGGCCAAGAAGTCGAGGCGTTGTATTGGCTTGACAGAAACATTGCGGCGACGATGCTCACTACTCGTTTGGGTGCATCTATGAAGTCCAATACTCTGTTGTGTTCGTTGTCTAGGATCCGCAGCGTTGGTAATCCTTCGAGTACACGACATACATTCATTCTCGTTTTGCAATTATTGAAGGTCCATAATGTTCTCGGATGACTGTGCCGTGAAGAGATCCGCCTCCATCATACAGGGAACAGGAGGCTACTTCGATCCTTCCTATCCGTAGCAGGAGGTAGGACTAGCCAGCCACCACAAAACTGGTGATGTGTTTGCCCCATGTCCCGTCCATCCATACGTTTGTCCAATAGGTGAGGTTAGATTTGCAGGAGCAGAAAATTTAGCGCTCGACTGCCTGCTAACCTTCCGGAGACAGGGTTAGCTTTACTTATATTTGCTGTAATTTCCCACGACTGACAGACTGACTGCGAGAAAGAACGACCGCGTGGGAGCTCGTCGATGTTGCAGCTCTTCCACACAGACAGAGAGCAGTCACTGAATCCACATGAATTTGTCACCGAAAAGGTCCGCTGGCTGAGAATGGAGCGTCAGGTCGACTGCGGTAATTTTCAGGGTTCTGTCGCTCTGTCTCCCACATGAATGAGTGAGTGTAGGGCCTTGTGGATCGAAACTTGCACCGTCCGCCGCGCGAAGTCTACGCTGGGGTGCCTGGCTAGCTACACTGTCGTGGTGAAACTTAGGCTGGCAGAGCTCTAGGAGAGTTGTCCGTGGCACCGTCCACCATCTGGGCGAGCTCAATGCAAGCTGAGCTGAGCTGAGCTGAGCGAGCTTGTGGGATAAGCGAGAAAGGCATACGTGTGTTCCTGTTTTCGCGCCTGTCCTTTGGCGTGGCCGGCCTTGACGGCTTTTGTGGACGCTCATCAGAATTATGACGGTTTCTCCCTCCTCGTGCCCCCCCACGGGACTCGGAAGACCTAAAGAATCGCACCCCCTTGCTCAGAGGGCACCATGTTGAAGCAAGGTCTCCCAGTCTCCGCTCATGTGGCATCTTGAACACTGACCTCCTGGCTGGCAGTCGGTCTACACTTCGTTGCTGCTCGTCAACCCGTTTTCTGCCGATTCGATCACTCTCCCTTGGCTTTCACGGAGGAAGAGCACAGGAACGAATGACAAACTGGAGGCTTACAGTGGCCGTCTCGGAAAGGCCACTCCGGACATTCTGTACCTGCCCTCGACGTCCATTCCAGAAGAGGCGATCCTCTCCGTCTGGGGGTCGTAGCCTTCAATATGTCGGACACATCTTGCGGAGGATTTGCCCTTTTGTTTAGCAGCAGGTTGTCTGCACACTCTCAGAGGTGTGTGACTGGCTACTAAGTAGATCGATGATATCCCAACGTGAGTCTGAAGACAGGCGGGAACAATAAATCTCTCATCTGTCATCGACTACACTAGAAAATTAGACCCTCCGCGTTATTCGATCGCATTAATTCTCCAACACGTTGACCTACCGAACGCCTCACTCCGCAAGTATTTCACCGGGACGCTGCCTACTGGATTTCGAAAGAAGATTGTGGGCGTATCAGACTAATCGTCAACGTCAGACGAATCCATTCTCTGAGAACTGAAAACATAAGAAAGTGATCAACATTAACAAGATGGGCGCTGAACGTGCTTGTCTGTCTTAACAAGAATCTTATTCCTGATGAGGTGTTTTGACTCATCCGTCCCTCCGTCAGAGTTAATTGCTTGTTGTCATTGCGCAGAAGTAGACTGTCAAGTACACTGACTCATTCTCACTGTCAGCCGTACTTGAGACTTTACTCTGGTTTAACTACCCTGGGCATTTCACGCCCGCCGCAGTGACCACTGATTTGCCTGGTCTCATACTTCGAGAAAATTGTAATGAAGCGGTTTCAGAAGAAGGCATTACTCGATTACACAGCGAGATGGCAGTGAACATTGTGCTTTAACATTGGAAGACACGGACTGCTGCTTTCTGCAGCATCATTGATCTCAGAGGATTTGTTCGCAAGACAAAGCCTGGGCCCTTGAGGAAGAACGACATGCTTATTGGAGTGATGCTTGAGGAGTTGGGATGTCTTACAGACGAGATTTCCAGTCATCTGAGATGTACGATCAAATTCACGCAGTTGTAATTTCAACTGTGTTTCGACATGTGCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGTAAGTTTCAATGAACTCTTTGGACGCTTGGAGTCACGCGTTTCTATTCCGCGTTTGAACCGCTACACGAGTCGTCGTATCGCTCTTTTAACTAAACTTCAAACCATCTGAATGGTCCCTGGACTTGTGGGTCGAAATGACGCATTTGAGACTAATGGGCCAATCTGATGCTTTAAAGATGTGGGAACTATTCGACACGTTTGTCTCGAGTAGAAATGTGGAGGGCCTGAAGTAGCAACTCTAGTGATGTAGACTCAAGGGTTGCTGATTGCAGAGACTTTGGAGGTAAGCGGTAGCGTCACTGAGTGAAGAAGGTACATGTGAGAGGGCGTTGGGAAGATTTATCTGGAGACATGAGTCGTCGACATGAATGAATTACCTCGTAAAGCAGTCTGCCTAGTAACCATCGCTTCGATATTGTCGGAACGGTGCTGGAAGTCAGATGTGATGTTTGTGAGCTTCAAGAATATCAATTCTGTCTGTGCAGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAGTACGTTAAGTTCCTCTGTTTCGCGAGATGCCCAATGGAAATTTGATTCGATTCGTAGGAGAACACGTCGGTCACAGTTGGTAATAGAATTGTTGGAGATGAGGAGAATTGCGTCCTGGGGAGTCAACACATGGTTTTGACTTGCGGAGGAGACTAACGGTAAGTTATGTTTCAGAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGGTAAGACCCAACACTCCGTGCCTAAAATCATGTTGCAGACCTATGTGGACAATAGTCCAATCCCAATTCCTGTAGAAGGACCAATTGTTCCACTATCCACGTATCCCAGCCCATGACAGCAACGCTAACACTTTCCTCCAAAACTCATCCAAAAAGACAATTGGACAGAGTACTGACTTCCTGTTGCCTAATCAGCCCTGCAGCTGCGCTTTATCCCCTCAAGGAGAAGCCCCGATTTTCTACCTTCAAGCTTCGCATCGCAGTTGCCTAGGTGGGGACAGAGAGTTTGAAGTGGACCCTCGATTACAGGCTTTGATCACGAAAAGCTCAGAAAATGAACTCGCAAATCTGATCACGGAGTCCAGTTTGTAGTGGTCGAGACAGAGAAGAGGTACAGCTCACCGTATGCGAGTGTTGTAGCGACGTAGGCTTGAGTATTACGTCCTTGACTGGTCTCGTACTGTGAGTGGTGGAACTTTCGAGTAATGTTCCCTGTTGCAGGTTTTCTTCTGGATACGAGCCAGAATATGCCAGTGAATAAGTAATGTGGCTCCCGCACGTCCATCAAGAAACGAAGAAACGAACAAGGGCCCTCTCCCTTGCACAGCATCTCTCGGACCTGTGAACTGTGTAGCTTAAATCTCAGGAGTCGACGAGATTCTGTTCTCGTCACATGGGGATGGGGGTGGGACGAAGAGTGGAGTACTTGAGTAGAACTGTCGACATTGACTGAGTCACGTTCCGATTTCCTCTAAAAGTATCATCATCTAAAAGCATGGCAGTGCTTCAGTTTTCCCCACGAGAGCATCCAATCAAAAGGTCCACGGGTGACCCAACAGGGTGAAGAGACCACTGCTGTGACCCGCGTCCAATCGGGGCAACATTGACAGGGGTAGAGCATCAGTGCGGCCTAACGCCCTCGGTTGTAACTGAGACTTGGAATCGGAGCGTCCAGTCCCTTCTTATCGGGACAGGGCCCAGGGTCCAGGGTCGAAACCAATTTGACCTTCATGTCCGAGAATGGCCTCTGGCCTTCTGTCTCGAAGAGAGGTGATCCTTGAACAAGACTCTTCTTCCCAACCGTCGTTGACACCGATTTGACTGGCTCCCAAAAGTATGCGCCACGCTAAATGCTGATGATGGCCTTGTCGTTGATGCTGACCGTGCAATCCATTAGGCAACTCTGATAGAACACGCAAAAAGGACGAAAGCAGTCGTCAACTTTGCAGTGGTCGTCCATGATCCAGCTCGCCGTTCACGTTCTGATATATTCGTCGAGCATCCAGCAATCGTGTAATTTGCAAGGCTGTATGTGTGAGGCAGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGGTACTGCGCTCATGTCATCTGATGCCTAGAGCGCGCTCTTCGAGCTCGTTGAGAGTAAATCTGGTCCAATTGCAAGAGTAAAGAATCACTCTGCATCTGCTGAAATCCTGCAGGACACGTACTAATCGTGTGGTTCGTCGATGCAGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGGTTCAAAGACTCTAATATTTGCATTCACAAGTTCAATTTGTCACACCAAAAAAACCCTTCTCTTTGATGGCGATTTTTTCCCGGATTGAGAGCGAATCATACATTCTGGCTAGTACTTCGCACCGACAAGGCCACAGACAAGAGTCGTAGGTCGCCGATTTTCACCCACATTTGACAGTCTGTCGGAACACTCCCCGTCTAGTACCGACTTAAGTTACTGCTATGGTGGAATCCAAACCACTCCCACTGTTTGCCAATTTTTAAAATCATGTCAACAATCGGAAAAGAATCGGTCCGCTTGTGAATAGTCGACTCTAGACCAGAAGGCTGCCTGCAAAAGTGAAGATCTTAGATGACCGCTGAATTTGCAAGAGTGAAACCAGCTCAGAGCATGTGTCAGCCTTGCAGAAAGCTAGAAAAGGCCGCGACACACAGAAAACATTCCTTGTCCTCAATGCTGTACTCGATGATGGAAGACGAGGGCTTAAACCGGAATACATAGATTGCATGATCAGTCTTCGGTCTCTTGGCTCAATGGGGCTGACTGCCACTGGTCATTTCTAGGTTTCGATTTGTCGACGTAAAAGATTATTGTGCACACATCGGCCGTGAATCCGACATCTAGTGGTCATGTCATGTTCATCGTTGCATGCTGTACTGCTGTGATCGAAGCGCCTAATCATCAGAATGCGGCTGCAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCGTAAGTGGCGATCCCCTGTTTGACGCAAGGATTTGTTGAATTCGCGCCTCTTGCAGCTAATGAAGACGGGCTTGTCCACAGTGTCAACTGGAGCAACTGTTCCCAAGACCAACAATCTCATGGCTGTCTGAACATGTAGCTTGTTTGTATGGTCTGCGCGTTTCAATCATGGAACTGGAAGCTCAGATTAACTTTACCCGGATTTCTTTGACAATGCATCTGCCTCTGAATATTCCTCTCTCTAAGTTCTGCACCGAAAACTGCTGGAGACTTTCTTTGGGGTTCCTGCTTAGATCATATAATCCGTGTAAAAATTGAAGGAGGTGGTGAATGGAAATTATCTGGAACATGCATGGGTAGAAATGCTTGAGGATTGCGGGGCCTCCTCCAGAATAGTCAAAGCATTGGTAACGAAGTCGCAGTCCGGGGCGAAACAGTTTGTAACTAGGTCAGTCACGTCTAAGCGTTGCTGGGGTCGTGATTGGCAGCGAGGAGCATTTTGTGTCCGTATGTGTCTGGGCAGGTTGACCATACACTATTTGCTTTCACCGTCACTGTTTGCATCTGTTGACCTGCAGCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGTGTCATCTCGGCTCCCCTCTGTTCCAATCAAATGCAACTGTTCTGTGGGCTCGGGGGCCCCGGGGGGTGTAGGGGAACCCTCGCGGCGAAAAGAAAAGGTTGGCTAGTGCACCGACGCCAAGCGCTCTACAATAAGGGAGCTGGCGTGGAATTAATCGCTGCAGATTGTGCTCAGCACATTGGAGACATTATCGGTTCCTGGCTTTTGACTGTTACTGCTAGAACAGTTGGCTTTCTGGAGACAGTTAGAGCTAGAGAAAGGGCGCATATTGCCGAAAAGCAGCTCATAGAAATGCTCTGCTCAGACTTCTGATGGTTTTAGGGTTCCCAGCACAAGCTTGCATCACACTCGTTGTCAAGTCCTTGTACAATCAGAGGGCATCCTTACTATGGCCTCACGATAACTTCTACGGCATGCTTGCATGAATGAGCGATGTGCTTTTGAGAGTAAGCATTCTTTGCACTTTCCTCCTTGAGCCTGAGCCTGAGCCTGAGGCGGTGAGGTGAGTAGAGTATCTGTAGGCCTCTCCCCCAACCCAAAGCCTTAGAATCAGTGTACACTGGATCAGTACTTGACATCTTGACGCAGCAGAGACAGAAGCTGCAGTAGCAGCAGCAGGAGGGACGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCTCAGTTGACTGCACCTACGGCAAGGGGATCACGGATCCTGCAGCTGAGGGCGTGCTAAATTGTCGTCAGATGATTCGTGCACTGTCAGACCTGCCTGAATTATCGCCGTACTGAGTTGTTGAAGTGGTTTACAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAATCCTCTCTCCTCAATTATGGATGTTGTGCAAGCAAGTCTCCAACTGGTAGTCCGAGACCTAAGTGGCATTCGCTTCGCTTGTGTACCTAAGCATCATTACCGGCGCACGAATACGGACGTCTACGTTGTGCACTTTATAGATTCATCCCAACTCATGACTTTAGCGCATTGACATTAGTGGCCACCACCACCACCCAGGACCCAATGTGTTCATGACATTATTCCACTTTGCCCCTCGCTGCTCAATTCATTCTTGCCTTCGCCCATCATCACGCGAAGCCAAGGTAAGTCCGGAAGCGTGCCCCGAAGCCGGCCGAGATACATTGTACCTTCATTCACAGCCTAAGAACTTTGTCTTTGTCGTAAACCGACCGTGATCACGAGCTGCCACGACGTTACGAGGGGCTCCGAGAAAAACGAACAGCTGTTGTTTCCAAGGCCCCGTGTTCGCTGTAAGCTTGGCCCTAATGTGGAAGCCCGACAGGGACTCGGCAACCCACTCGCCGACCCGACGATGGCCAGGCTCAACGCCGCCCTATGAGTCGATCATAGGTAGCGTGACGAGGGTACGTCTAAGCATCGACAAATCCATCGCTAAGTGGCGAATTCTAGAGGGAATGAACATTGTCTAGAGAAGAACAAGTCTTGTCCGGCGACTGACAGCTCGCGGTATGTCGATTGGCAGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

mRNA

>Mapoly0093s0028.2
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

CDS

>Mapoly0093s0028.2
ATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGA

Protein

>Mapoly0093s0028.2
MVYVANPLETDKSIEHSQKQEDQPAAPGIDSMSRASKEVPRSTVKESESSDLQTQRSAGPVQAVPELHRILDSTNELWRLRGGAVNNHPTEVICVPDGERTAVPQISPSDYLNGTAKENVNYINWYQHGLTNSMPTGRIVTCYAGNNPSDSSTRGETGRNVDISVLTSFHKVSSEEKWDAQALYGDVYSDDPLFHIVPSACPGTASGAVACSEIEPKKFGIGFSTEENVCDLKGQRTIATLEGLKHDEPFAFDDYRADHFFLADPSGNQTLDNCVPELRSAFRVTNSSVAETVSQHLIHHGETSQSAVHPQEKVLPAPTSPIFQLEQYDDIMIFNHHAQQWQDELMNLNYHEANAEGNVGLTSGYKGSATMPVLPEQPQFEAINPFPTRHAVSAPDVATDCFSFWPGEHSSTYHSLEDQSTPYVWPGSPTSEQALTPSYPTEAGTSSYTWKTTDSSLVTAAVDDAKPEKTARKHGVPAEPCASSGDWLESRGSPTCSMSPCAKGKQIAVSTTSQIDKISICQRVSAEQGRTEMLEMLQTVFPDSLDLSQEDNKHVRDARLAWLQEHAKEDILQNSKRDRTNSTEMLSRPTSSLRKKKQKDQEIPEGRLRGTSICTDPDLSYGLAAVQNVLEDFHKSAGLILKAKKLQNQRPSVTDLLNAELEALCIGDALGPEVKGFIMTVIKIGHGKQPAATNPDMVEQILQLKWRLASLMEESRNHERSTLAQLRDTFTRYSFLFPSSASDSFDKRAIPSKYYQDLENVVCQYFRGCSLFFKRSASSASSSSGQQGHENSSNTGGAPDVHAKVRGPLPVEVLGEANAGTSPVVETSDRSRMASRKELSGARGNLPKVAADYMRQWLFQNFQNPNPTRETKLMIATMFNITEKQVTNHFVNLRARKFRPLLRSLQEDPRSDAGHDMQNPDAENKAGPEGPTSAKCAEKIRT

Mapoly0093s0028.3  

Gene structure:

mRNA scaffold_93:376005..388588  ( - strand )
three_prime_UTR scaffold_93:376005..376531  ( - strand )
three_prime_UTR scaffold_93:376651..377216  ( - strand )
CDS scaffold_93:377217..377276  ( - strand )
CDS scaffold_93:378070..378130  ( - strand )
CDS scaffold_93:378709..379061  ( - strand )
CDS scaffold_93:379761..379883  ( - strand )
CDS scaffold_93:380030..380224  ( - strand )
CDS scaffold_93:381548..381768  ( - strand )
CDS scaffold_93:381944..383092  ( - strand )
CDS scaffold_93:383580..384132  ( - strand )
five_prime_UTR scaffold_93:384133..386376  ( - strand )
five_prime_UTR scaffold_93:386515..388588  ( - strand )

Sequences:

Gene

>Mapoly0093s0028.3
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGTATTTTCAACTTCCAGACTCCCATGGCCAAGAAGTCGAGGCGTTGTATTGGCTTGACAGAAACATTGCGGCGACGATGCTCACTACTCGTTTGGGTGCATCTATGAAGTCCAATACTCTGTTGTGTTCGTTGTCTAGGATCCGCAGCGTTGGTAATCCTTCGAGTACACGACATACATTCATTCTCGTTTTGCAATTATTGAAGGTCCATAATGTTCTCGGATGACTGTGCCGTGAAGAGATCCGCCTCCATCATACAGGGAACAGGAGGCTACTTCGATCCTTCCTATCCGTAGCAGGAGGTAGGACTAGCCAGCCACCACAAAACTGGTGATGTGTTTGCCCCATGTCCCGTCCATCCATACGTTTGTCCAATAGGTGAGGTTAGATTTGCAGGAGCAGAAAATTTAGCGCTCGACTGCCTGCTAACCTTCCGGAGACAGGGTTAGCTTTACTTATATTTGCTGTAATTTCCCACGACTGACAGACTGACTGCGAGAAAGAACGACCGCGTGGGAGCTCGTCGATGTTGCAGCTCTTCCACACAGACAGAGAGCAGTCACTGAATCCACATGAATTTGTCACCGAAAAGGTCCGCTGGCTGAGAATGGAGCGTCAGGTCGACTGCGGTAATTTTCAGGGTTCTGTCGCTCTGTCTCCCACATGAATGAGTGAGTGTAGGGCCTTGTGGATCGAAACTTGCACCGTCCGCCGCGCGAAGTCTACGCTGGGGTGCCTGGCTAGCTACACTGTCGTGGTGAAACTTAGGCTGGCAGAGCTCTAGGAGAGTTGTCCGTGGCACCGTCCACCATCTGGGCGAGCTCAATGCAAGCTGAGCTGAGCTGAGCTGAGCGAGCTTGTGGGATAAGCGAGAAAGGCATACGTGTGTTCCTGTTTTCGCGCCTGTCCTTTGGCGTGGCCGGCCTTGACGGCTTTTGTGGACGCTCATCAGAATTATGACGGTTTCTCCCTCCTCGTGCCCCCCCACGGGACTCGGAAGACCTAAAGAATCGCACCCCCTTGCTCAGAGGGCACCATGTTGAAGCAAGGTCTCCCAGTCTCCGCTCATGTGGCATCTTGAACACTGACCTCCTGGCTGGCAGTCGGTCTACACTTCGTTGCTGCTCGTCAACCCGTTTTCTGCCGATTCGATCACTCTCCCTTGGCTTTCACGGAGGAAGAGCACAGGAACGAATGACAAACTGGAGGCTTACAGTGGCCGTCTCGGAAAGGCCACTCCGGACATTCTGTACCTGCCCTCGACGTCCATTCCAGAAGAGGCGATCCTCTCCGTCTGGGGGTCGTAGCCTTCAATATGTCGGACACATCTTGCGGAGGATTTGCCCTTTTGTTTAGCAGCAGGTTGTCTGCACACTCTCAGAGGTGTGTGACTGGCTACTAAGTAGATCGATGATATCCCAACGTGAGTCTGAAGACAGGCGGGAACAATAAATCTCTCATCTGTCATCGACTACACTAGAAAATTAGACCCTCCGCGTTATTCGATCGCATTAATTCTCCAACACGTTGACCTACCGAACGCCTCACTCCGCAAGTATTTCACCGGGACGCTGCCTACTGGATTTCGAAAGAAGATTGTGGGCGTATCAGACTAATCGTCAACGTCAGACGAATCCATTCTCTGAGAACTGAAAACATAAGAAAGTGATCAACATTAACAAGATGGGCGCTGAACGTGCTTGTCTGTCTTAACAAGAATCTTATTCCTGATGAGGTGTTTTGACTCATCCGTCCCTCCGTCAGAGTTAATTGCTTGTTGTCATTGCGCAGAAGTAGACTGTCAAGTACACTGACTCATTCTCACTGTCAGCCGTACTTGAGACTTTACTCTGGTTTAACTACCCTGGGCATTTCACGCCCGCCGCAGTGACCACTGATTTGCCTGGTCTCATACTTCGAGAAAATTGTAATGAAGCGGTTTCAGAAGAAGGCATTACTCGATTACACAGCGAGATGGCAGTGAACATTGTGCTTTAACATTGGAAGACACGGACTGCTGCTTTCTGCAGCATCATTGATCTCAGAGGATTTGTTCGCAAGACAAAGCCTGGGCCCTTGAGGAAGAACGACATGCTTATTGGAGTGATGCTTGAGGAGTTGGGATGTCTTACAGACGAGATTTCCAGTCATCTGAGATGTACGATCAAATTCACGCAGTTGTAATTTCAACTGTGTTTCGACATGTGCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGTAAGTTTCAATGAACTCTTTGGACGCTTGGAGTCACGCGTTTCTATTCCGCGTTTGAACCGCTACACGAGTCGTCGTATCGCTCTTTTAACTAAACTTCAAACCATCTGAATGGTCCCTGGACTTGTGGGTCGAAATGACGCATTTGAGACTAATGGGCCAATCTGATGCTTTAAAGATGTGGGAACTATTCGACACGTTTGTCTCGAGTAGAAATGTGGAGGGCCTGAAGTAGCAACTCTAGTGATGTAGACTCAAGGGTTGCTGATTGCAGAGACTTTGGAGGTAAGCGGTAGCGTCACTGAGTGAAGAAGGTACATGTGAGAGGGCGTTGGGAAGATTTATCTGGAGACATGAGTCGTCGACATGAATGAATTACCTCGTAAAGCAGTCTGCCTAGTAACCATCGCTTCGATATTGTCGGAACGGTGCTGGAAGTCAGATGTGATGTTTGTGAGCTTCAAGAATATCAATTCTGTCTGTGCAGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAGTACGTTAAGTTCCTCTGTTTCGCGAGATGCCCAATGGAAATTTGATTCGATTCGTAGGAGAACACGTCGGTCACAGTTGGTAATAGAATTGTTGGAGATGAGGAGAATTGCGTCCTGGGGAGTCAACACATGGTTTTGACTTGCGGAGGAGACTAACGGTAAGTTATGTTTCAGAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGGTAAGACCCAACACTCCGTGCCTAAAATCATGTTGCAGACCTATGTGGACAATAGTCCAATCCCAATTCCTGTAGAAGGACCAATTGTTCCACTATCCACGTATCCCAGCCCATGACAGCAACGCTAACACTTTCCTCCAAAACTCATCCAAAAAGACAATTGGACAGAGTACTGACTTCCTGTTGCCTAATCAGCCCTGCAGCTGCGCTTTATCCCCTCAAGGAGAAGCCCCGATTTTCTACCTTCAAGCTTCGCATCGCAGTTGCCTAGGTGGGGACAGAGAGTTTGAAGTGGACCCTCGATTACAGGCTTTGATCACGAAAAGCTCAGAAAATGAACTCGCAAATCTGATCACGGAGTCCAGTTTGTAGTGGTCGAGACAGAGAAGAGGTACAGCTCACCGTATGCGAGTGTTGTAGCGACGTAGGCTTGAGTATTACGTCCTTGACTGGTCTCGTACTGTGAGTGGTGGAACTTTCGAGTAATGTTCCCTGTTGCAGGTTTTCTTCTGGATACGAGCCAGAATATGCCAGTGAATAAGTAATGTGGCTCCCGCACGTCCATCAAGAAACGAAGAAACGAACAAGGGCCCTCTCCCTTGCACAGCATCTCTCGGACCTGTGAACTGTGTAGCTTAAATCTCAGGAGTCGACGAGATTCTGTTCTCGTCACATGGGGATGGGGGTGGGACGAAGAGTGGAGTACTTGAGTAGAACTGTCGACATTGACTGAGTCACGTTCCGATTTCCTCTAAAAGTATCATCATCTAAAAGCATGGCAGTGCTTCAGTTTTCCCCACGAGAGCATCCAATCAAAAGGTCCACGGGTGACCCAACAGGGTGAAGAGACCACTGCTGTGACCCGCGTCCAATCGGGGCAACATTGACAGGGGTAGAGCATCAGTGCGGCCTAACGCCCTCGGTTGTAACTGAGACTTGGAATCGGAGCGTCCAGTCCCTTCTTATCGGGACAGGGCCCAGGGTCCAGGGTCGAAACCAATTTGACCTTCATGTCCGAGAATGGCCTCTGGCCTTCTGTCTCGAAGAGAGGTGATCCTTGAACAAGACTCTTCTTCCCAACCGTCGTTGACACCGATTTGACTGGCTCCCAAAAGTATGCGCCACGCTAAATGCTGATGATGGCCTTGTCGTTGATGCTGACCGTGCAATCCATTAGGCAACTCTGATAGAACACGCAAAAAGGACGAAAGCAGTCGTCAACTTTGCAGTGGTCGTCCATGATCCAGCTCGCCGTTCACGTTCTGATATATTCGTCGAGCATCCAGCAATCGTGTAATTTGCAAGGCTGTATGTGTGAGGCAGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGGTACTGCGCTCATGTCATCTGATGCCTAGAGCGCGCTCTTCGAGCTCGTTGAGAGTAAATCTGGTCCAATTGCAAGAGTAAAGAATCACTCTGCATCTGCTGAAATCCTGCAGGACACGTACTAATCGTGTGGTTCGTCGATGCAGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGGTTCAAAGACTCTAATATTTGCATTCACAAGTTCAATTTGTCACACCAAAAAAACCCTTCTCTTTGATGGCGATTTTTTCCCGGATTGAGAGCGAATCATACATTCTGGCTAGTACTTCGCACCGACAAGGCCACAGACAAGAGTCGTAGGTCGCCGATTTTCACCCACATTTGACAGTCTGTCGGAACACTCCCCGTCTAGTACCGACTTAAGTTACTGCTATGGTGGAATCCAAACCACTCCCACTGTTTGCCAATTTTTAAAATCATGTCAACAATCGGAAAAGAATCGGTCCGCTTGTGAATAGTCGACTCTAGACCAGAAGGCTGCCTGCAAAAGTGAAGATCTTAGATGACCGCTGAATTTGCAAGAGTGAAACCAGCTCAGAGCATGTGTCAGCCTTGCAGAAAGCTAGAAAAGGCCGCGACACACAGAAAACATTCCTTGTCCTCAATGCTGTACTCGATGATGGAAGACGAGGGCTTAAACCGGAATACATAGATTGCATGATCAGTCTTCGGTCTCTTGGCTCAATGGGGCTGACTGCCACTGGTCATTTCTAGGTTTCGATTTGTCGACGTAAAAGATTATTGTGCACACATCGGCCGTGAATCCGACATCTAGTGGTCATGTCATGTTCATCGTTGCATGCTGTACTGCTGTGATCGAAGCGCCTAATCATCAGAATGCGGCTGCAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCGTAAGTGGCGATCCCCTGTTTGACGCAAGGATTTGTTGAATTCGCGCCTCTTGCAGCTAATGAAGACGGGCTTGTCCACAGTGTCAACTGGAGCAACTGTTCCCAAGACCAACAATCTCATGGCTGTCTGAACATGTAGCTTGTTTGTATGGTCTGCGCGTTTCAATCATGGAACTGGAAGCTCAGATTAACTTTACCCGGATTTCTTTGACAATGCATCTGCCTCTGAATATTCCTCTCTCTAAGTTCTGCACCGAAAACTGCTGGAGACTTTCTTTGGGGTTCCTGCTTAGATCATATAATCCGTGTAAAAATTGAAGGAGGTGGTGAATGGAAATTATCTGGAACATGCATGGGTAGAAATGCTTGAGGATTGCGGGGCCTCCTCCAGAATAGTCAAAGCATTGGTAACGAAGTCGCAGTCCGGGGCGAAACAGTTTGTAACTAGGTCAGTCACGTCTAAGCGTTGCTGGGGTCGTGATTGGCAGCGAGGAGCATTTTGTGTCCGTATGTGTCTGGGCAGGTTGACCATACACTATTTGCTTTCACCGTCACTGTTTGCATCTGTTGACCTGCAGCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGTGTCATCTCGGCTCCCCTCTGTTCCAATCAAATGCAACTGTTCTGTGGGCTCGGGGGCCCCGGGGGGTGTAGGGGAACCCTCGCGGCGAAAAGAAAAGGTTGGCTAGTGCACCGACGCCAAGCGCTCTACAATAAGGGAGCTGGCGTGGAATTAATCGCTGCAGATTGTGCTCAGCACATTGGAGACATTATCGGTTCCTGGCTTTTGACTGTTACTGCTAGAACAGTTGGCTTTCTGGAGACAGTTAGAGCTAGAGAAAGGGCGCATATTGCCGAAAAGCAGCTCATAGAAATGCTCTGCTCAGACTTCTGATGGTTTTAGGGTTCCCAGCACAAGCTTGCATCACACTCGTTGTCAAGTCCTTGTACAATCAGAGGGCATCCTTACTATGGCCTCACGATAACTTCTACGGCATGCTTGCATGAATGAGCGATGTGCTTTTGAGAGTAAGCATTCTTTGCACTTTCCTCCTTGAGCCTGAGCCTGAGCCTGAGGCGGTGAGGTGAGTAGAGTATCTGTAGGCCTCTCCCCCAACCCAAAGCCTTAGAATCAGTGTACACTGGATCAGTACTTGACATCTTGACGCAGCAGAGACAGAAGCTGCAGTAGCAGCAGCAGGAGGGACGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCTCAGTTGACTGCACCTACGGCAAGGGGATCACGGATCCTGCAGCTGAGGGCGTGCTAAATTGTCGTCAGATGATTCGTGCACTGTCAGACCTGCCTGAATTATCGCCGTACTGAGTTGTTGAAGTGGTTTACAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAATCCTCTCTCCTCAATTATGGATGTTGTGCAAGCAAGTCTCCAACTGGTAGTCCGAGACCTAAGTGGCATTCGCTTCGCTTGTGTACCTAAGCATCATTACCGGCGCACGAATACGGACGTCTACGTTGTGCACTTTATAGATTCATCCCAACTCATGACTTTAGCGCATTGACATTAGTGGCCACCACCACCACCCAGGACCCAATGTGTTCATGACATTATTCCACTTTGCCCCTCGCTGCTCAATTCATTCTTGCCTTCGCCCATCATCACGCGAAGCCAAGGTAAGTCCGGAAGCGTGCCCCGAAGCCGGCCGAGATACATTGTACCTTCATTCACAGCCTAAGAACTTTGTCTTTGTCGTAAACCGACCGTGATCACGAGCTGCCACGACGTTACGAGGGGCTCCGAGAAAAACGAACAGCTGTTGTTTCCAAGGCCCCGTGTTCGCTGTAAGCTTGGCCCTAATGTGGAAGCCCGACAGGGACTCGGCAACCCACTCGCCGACCCGACGATGGCCAGGCTCAACGCCGCCCTATGAGTCGATCATAGGTAGCGTGACGAGGGTACGTCTAAGCATCGACAAATCCATCGCTAAGTGGCGAATTCTAGAGGGAATGAACATTGTCTAGAGAAGAACAAGTCTTGTCCGGCGACTGACAGCTCGCGGTATGTCGATTGGCAGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

mRNA

>Mapoly0093s0028.3
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGATCCGCAGCGTTGGTAATCCTTCGAGTACACGACATACATTCATTCTCGTTTTGCAATTATTGAAGGTCCATAATGTTCTCGGATGACTGTGCCGTGAAGAGATCCGCCTCCATCATACAGGGAACAGGAGGCTACTTCGATCCTTCCTATCCGTAGCAGGAGGTAGGACTAGCCAGCCACCACAAAACTGGTGATGTGTTTGCCCCATGTCCCGTCCATCCATACGTTTGTCCAATAGGTGAGGTTAGATTTGCAGGAGCAGAAAATTTAGCGCTCGACTGCCTGCTAACCTTCCGGAGACAGGGTTAGCTTTACTTATATTTGCTGTAATTTCCCACGACTGACAGACTGACTGCGAGAAAGAACGACCGCGTGGGAGCTCGTCGATGTTGCAGCTCTTCCACACAGACAGAGAGCAGTCACTGAATCCACATGAATTTGTCACCGAAAAGGTCCGCTGGCTGAGAATGGAGCGTCAGGTCGACTGCGGTAATTTTCAGGGTTCTGTCGCTCTGTCTCCCACATGAATGAGTGAGTGTAGGGCCTTGTGGATCGAAACTTGCACCGTCCGCCGCGCGAAGTCTACGCTGGGGTGCCTGGCTAGCTACACTGTCGTGGTGAAACTTAGGCTGGCAGAGCTCTAGGAGAGTTGTCCGTGGCACCGTCCACCATCTGGGCGAGCTCAATGCAAGCTGAGCTGAGCTGAGCTGAGCGAGCTTGTGGGATAAGCGAGAAAGGCATACGTGTGTTCCTGTTTTCGCGCCTGTCCTTTGGCGTGGCCGGCCTTGACGGCTTTTGTGGACGCTCATCAGAATTATGACGGTTTCTCCCTCCTCGTGCCCCCCCACGGGACTCGGAAGACCTAAAGAATCGCACCCCCTTGCTCAGAGGGCACCATGTTGAAGCAAGGTCTCCCAGTCTCCGCTCATGTGGCATCTTGAACACTGACCTCCTGGCTGGCAGTCGGTCTACACTTCGTTGCTGCTCGTCAACCCGTTTTCTGCCGATTCGATCACTCTCCCTTGGCTTTCACGGAGGAAGAGCACAGGAACGAATGACAAACTGGAGGCTTACAGTGGCCGTCTCGGAAAGGCCACTCCGGACATTCTGTACCTGCCCTCGACGTCCATTCCAGAAGAGGCGATCCTCTCCGTCTGGGGGTCGTAGCCTTCAATATGTCGGACACATCTTGCGGAGGATTTGCCCTTTTGTTTAGCAGCAGGTTGTCTGCACACTCTCAGAGGTGTGTGACTGGCTACTAAGTAGATCGATGATATCCCAACGTGAGTCTGAAGACAGGCGGGAACAATAAATCTCTCATCTGTCATCGACTACACTAGAAAATTAGACCCTCCGCGTTATTCGATCGCATTAATTCTCCAACACGTTGACCTACCGAACGCCTCACTCCGCAAGTATTTCACCGGGACGCTGCCTACTGGATTTCGAAAGAAGATTGTGGGCGTATCAGACTAATCGTCAACGTCAGACGAATCCATTCTCTGAGAACTGAAAACATAAGAAAGTGATCAACATTAACAAGATGGGCGCTGAACGTGCTTGTCTGTCTTAACAAGAATCTTATTCCTGATGAGGTGTTTTGACTCATCCGTCCCTCCGTCAGAGTTAATTGCTTGTTGTCATTGCGCAGAAGTAGACTGTCAAGTACACTGACTCATTCTCACTGTCAGCCGTACTTGAGACTTTACTCTGGTTTAACTACCCTGGGCATTTCACGCCCGCCGCAGTGACCACTGATTTGCCTGGTCTCATACTTCGAGAAAATTGTAATGAAGCGGTTTCAGAAGAAGGCATTACTCGATTACACAGCGAGATGGCAGTGAACATTGTGCTTTAACATTGGAAGACACGGACTGCTGCTTTCTGCAGCATCATTGATCTCAGAGGATTTGTTCGCAAGACAAAGCCTGGGCCCTTGAGGAAGAACGACATGCTTATTGGAGTGATGCTTGAGGAGTTGGGATGTCTTACAGACGAGATTTCCAGTCATCTGAGATGTACGATCAAATTCACGCAGTTGTAATTTCAACTGTGTTTCGACATGTGCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAATCCTCTCTCCTCAATTATGGATGTTGTGCAAGCAAGTCTCCAACTGGTAGTCCGAGACCTAAGTGGCATTCGCTTCGCTTGTGTACCTAAGCATCATTACCGGCGCACGAATACGGACGTCTACGTTGTGCACTTTATAGATTCATCCCAACTCATGACTTTAGCGCATTGACATTAGTGGCCACCACCACCACCCAGGACCCAATGTGTTCATGACATTATTCCACTTTGCCCCTCGCTGCTCAATTCATTCTTGCCTTCGCCCATCATCACGCGAAGCCAAGGTAAGTCCGGAAGCGTGCCCCGAAGCCGGCCGAGATACATTGTACCTTCATTCACAGCCTAAGAACTTTGTCTTTGTCGTAAACCGACCGTGATCACGAGCTGCCACGACGTTACGAGGGGCTCCGAGAAAAACGAACAGCTGTTGTTTCCAAGGCCCCGTGTTCGCTGTAAGCTTGGCCCTAATGTGGAAGCCCGACAGGGACTCGGCAACCCACTCGCCGACCCGACGATGGCCAGGCTCAACGCCGCCCTATGAGTCGATCATAGGTAGCGTGACGAGGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

CDS

>Mapoly0093s0028.3
ATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAA

Protein

>Mapoly0093s0028.3
MVYVANPLETDKSIEHSQKQEDQPAAPGIDSMSRASKEVPRSTVKESESSDLQTQRSAGPVQAVPELHRILDSTNELWRLRGGAVNNHPTEVICVPDGERTAVPQISPSDYLNGTAKENVNYINWYQHGLTNSMPTGRIVTCYAGNNPSDSSTRGETGRNVDISVLTSFHKVSSEEKWDAQALYGDVYSDDPLFHIVPSACPGTASGAVACSEIEPKKFGIGFSTEENVCDLKGQRTIATLEGLKHDEPFAFDDYRADHFFLADPSGNQTLDNCVPELRSAFRVTNSSVAETVSQHLIHHGETSQSAVHPQEKVLPAPTSPIFQLEQYDDIMIFNHHAQQWQDELMNLNYHEANAEGNVGLTSGYKGSATMPVLPEQPQFEAINPFPTRHAVSAPDVATDCFSFWPGEHSSTYHSLEDQSTPYVWPGSPTSEQALTPSYPTEAGTSSYTWKTTDSSLVTAAVDDAKPEKTARKHGVPAEPCASSGDWLESRGSPTCSMSPCAKGKQIAVSTTSQIDKISICQRVSAEQGRTEMLEMLQTVFPDSLDLSQEDNKHVRDARLAWLQEHAKEDILQNSKRDRTNSTEMLSRPTSSLRKKKQKDQEIPEGRLRGTSICTDPDLSYGLAAVQNVLEDFHKSAGLILKAKKLQNQRPSVTDLLNAELEALCIGDALGPEVKGFIMTVIKIGHGKQPAATNPDMVEQILQLKWRLASLMEESRNHERSTLAQLRDTFTRYSFLFPSSASDSFDKRAIPSKYYQDLENVVCQYFRGCSLFFKRSASSASSSSGQQGHENSSNTGGAPDVHAKVRGPLPVEVLGEANAGTSPVVETSDRSRMASRKELSGARGNLPKVAADYMRQWLFQNFQNPNPTRETKLMIATMFNITEKQVTNHFVNLRARKFRPLVCS

Mapoly0093s0028.4  

Gene structure:

mRNA scaffold_93:376005..388588  ( - strand )
three_prime_UTR scaffold_93:376005..376531  ( - strand )
three_prime_UTR scaffold_93:376651..377216  ( - strand )
CDS scaffold_93:377217..377276  ( - strand )
CDS scaffold_93:378070..378130  ( - strand )
CDS scaffold_93:378709..379061  ( - strand )
CDS scaffold_93:379761..379883  ( - strand )
CDS scaffold_93:380030..380224  ( - strand )
CDS scaffold_93:381548..381768  ( - strand )
CDS scaffold_93:381944..383092  ( - strand )
CDS scaffold_93:383580..384132  ( - strand )
five_prime_UTR scaffold_93:384133..384304  ( - strand )
five_prime_UTR scaffold_93:386515..388588  ( - strand )

Sequences:

Gene

>Mapoly0093s0028.4
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGTATTTTCAACTTCCAGACTCCCATGGCCAAGAAGTCGAGGCGTTGTATTGGCTTGACAGAAACATTGCGGCGACGATGCTCACTACTCGTTTGGGTGCATCTATGAAGTCCAATACTCTGTTGTGTTCGTTGTCTAGGATCCGCAGCGTTGGTAATCCTTCGAGTACACGACATACATTCATTCTCGTTTTGCAATTATTGAAGGTCCATAATGTTCTCGGATGACTGTGCCGTGAAGAGATCCGCCTCCATCATACAGGGAACAGGAGGCTACTTCGATCCTTCCTATCCGTAGCAGGAGGTAGGACTAGCCAGCCACCACAAAACTGGTGATGTGTTTGCCCCATGTCCCGTCCATCCATACGTTTGTCCAATAGGTGAGGTTAGATTTGCAGGAGCAGAAAATTTAGCGCTCGACTGCCTGCTAACCTTCCGGAGACAGGGTTAGCTTTACTTATATTTGCTGTAATTTCCCACGACTGACAGACTGACTGCGAGAAAGAACGACCGCGTGGGAGCTCGTCGATGTTGCAGCTCTTCCACACAGACAGAGAGCAGTCACTGAATCCACATGAATTTGTCACCGAAAAGGTCCGCTGGCTGAGAATGGAGCGTCAGGTCGACTGCGGTAATTTTCAGGGTTCTGTCGCTCTGTCTCCCACATGAATGAGTGAGTGTAGGGCCTTGTGGATCGAAACTTGCACCGTCCGCCGCGCGAAGTCTACGCTGGGGTGCCTGGCTAGCTACACTGTCGTGGTGAAACTTAGGCTGGCAGAGCTCTAGGAGAGTTGTCCGTGGCACCGTCCACCATCTGGGCGAGCTCAATGCAAGCTGAGCTGAGCTGAGCTGAGCGAGCTTGTGGGATAAGCGAGAAAGGCATACGTGTGTTCCTGTTTTCGCGCCTGTCCTTTGGCGTGGCCGGCCTTGACGGCTTTTGTGGACGCTCATCAGAATTATGACGGTTTCTCCCTCCTCGTGCCCCCCCACGGGACTCGGAAGACCTAAAGAATCGCACCCCCTTGCTCAGAGGGCACCATGTTGAAGCAAGGTCTCCCAGTCTCCGCTCATGTGGCATCTTGAACACTGACCTCCTGGCTGGCAGTCGGTCTACACTTCGTTGCTGCTCGTCAACCCGTTTTCTGCCGATTCGATCACTCTCCCTTGGCTTTCACGGAGGAAGAGCACAGGAACGAATGACAAACTGGAGGCTTACAGTGGCCGTCTCGGAAAGGCCACTCCGGACATTCTGTACCTGCCCTCGACGTCCATTCCAGAAGAGGCGATCCTCTCCGTCTGGGGGTCGTAGCCTTCAATATGTCGGACACATCTTGCGGAGGATTTGCCCTTTTGTTTAGCAGCAGGTTGTCTGCACACTCTCAGAGGTGTGTGACTGGCTACTAAGTAGATCGATGATATCCCAACGTGAGTCTGAAGACAGGCGGGAACAATAAATCTCTCATCTGTCATCGACTACACTAGAAAATTAGACCCTCCGCGTTATTCGATCGCATTAATTCTCCAACACGTTGACCTACCGAACGCCTCACTCCGCAAGTATTTCACCGGGACGCTGCCTACTGGATTTCGAAAGAAGATTGTGGGCGTATCAGACTAATCGTCAACGTCAGACGAATCCATTCTCTGAGAACTGAAAACATAAGAAAGTGATCAACATTAACAAGATGGGCGCTGAACGTGCTTGTCTGTCTTAACAAGAATCTTATTCCTGATGAGGTGTTTTGACTCATCCGTCCCTCCGTCAGAGTTAATTGCTTGTTGTCATTGCGCAGAAGTAGACTGTCAAGTACACTGACTCATTCTCACTGTCAGCCGTACTTGAGACTTTACTCTGGTTTAACTACCCTGGGCATTTCACGCCCGCCGCAGTGACCACTGATTTGCCTGGTCTCATACTTCGAGAAAATTGTAATGAAGCGGTTTCAGAAGAAGGCATTACTCGATTACACAGCGAGATGGCAGTGAACATTGTGCTTTAACATTGGAAGACACGGACTGCTGCTTTCTGCAGCATCATTGATCTCAGAGGATTTGTTCGCAAGACAAAGCCTGGGCCCTTGAGGAAGAACGACATGCTTATTGGAGTGATGCTTGAGGAGTTGGGATGTCTTACAGACGAGATTTCCAGTCATCTGAGATGTACGATCAAATTCACGCAGTTGTAATTTCAACTGTGTTTCGACATGTGCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGTAAGTTTCAATGAACTCTTTGGACGCTTGGAGTCACGCGTTTCTATTCCGCGTTTGAACCGCTACACGAGTCGTCGTATCGCTCTTTTAACTAAACTTCAAACCATCTGAATGGTCCCTGGACTTGTGGGTCGAAATGACGCATTTGAGACTAATGGGCCAATCTGATGCTTTAAAGATGTGGGAACTATTCGACACGTTTGTCTCGAGTAGAAATGTGGAGGGCCTGAAGTAGCAACTCTAGTGATGTAGACTCAAGGGTTGCTGATTGCAGAGACTTTGGAGGTAAGCGGTAGCGTCACTGAGTGAAGAAGGTACATGTGAGAGGGCGTTGGGAAGATTTATCTGGAGACATGAGTCGTCGACATGAATGAATTACCTCGTAAAGCAGTCTGCCTAGTAACCATCGCTTCGATATTGTCGGAACGGTGCTGGAAGTCAGATGTGATGTTTGTGAGCTTCAAGAATATCAATTCTGTCTGTGCAGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAGTACGTTAAGTTCCTCTGTTTCGCGAGATGCCCAATGGAAATTTGATTCGATTCGTAGGAGAACACGTCGGTCACAGTTGGTAATAGAATTGTTGGAGATGAGGAGAATTGCGTCCTGGGGAGTCAACACATGGTTTTGACTTGCGGAGGAGACTAACGGTAAGTTATGTTTCAGAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGGTAAGACCCAACACTCCGTGCCTAAAATCATGTTGCAGACCTATGTGGACAATAGTCCAATCCCAATTCCTGTAGAAGGACCAATTGTTCCACTATCCACGTATCCCAGCCCATGACAGCAACGCTAACACTTTCCTCCAAAACTCATCCAAAAAGACAATTGGACAGAGTACTGACTTCCTGTTGCCTAATCAGCCCTGCAGCTGCGCTTTATCCCCTCAAGGAGAAGCCCCGATTTTCTACCTTCAAGCTTCGCATCGCAGTTGCCTAGGTGGGGACAGAGAGTTTGAAGTGGACCCTCGATTACAGGCTTTGATCACGAAAAGCTCAGAAAATGAACTCGCAAATCTGATCACGGAGTCCAGTTTGTAGTGGTCGAGACAGAGAAGAGGTACAGCTCACCGTATGCGAGTGTTGTAGCGACGTAGGCTTGAGTATTACGTCCTTGACTGGTCTCGTACTGTGAGTGGTGGAACTTTCGAGTAATGTTCCCTGTTGCAGGTTTTCTTCTGGATACGAGCCAGAATATGCCAGTGAATAAGTAATGTGGCTCCCGCACGTCCATCAAGAAACGAAGAAACGAACAAGGGCCCTCTCCCTTGCACAGCATCTCTCGGACCTGTGAACTGTGTAGCTTAAATCTCAGGAGTCGACGAGATTCTGTTCTCGTCACATGGGGATGGGGGTGGGACGAAGAGTGGAGTACTTGAGTAGAACTGTCGACATTGACTGAGTCACGTTCCGATTTCCTCTAAAAGTATCATCATCTAAAAGCATGGCAGTGCTTCAGTTTTCCCCACGAGAGCATCCAATCAAAAGGTCCACGGGTGACCCAACAGGGTGAAGAGACCACTGCTGTGACCCGCGTCCAATCGGGGCAACATTGACAGGGGTAGAGCATCAGTGCGGCCTAACGCCCTCGGTTGTAACTGAGACTTGGAATCGGAGCGTCCAGTCCCTTCTTATCGGGACAGGGCCCAGGGTCCAGGGTCGAAACCAATTTGACCTTCATGTCCGAGAATGGCCTCTGGCCTTCTGTCTCGAAGAGAGGTGATCCTTGAACAAGACTCTTCTTCCCAACCGTCGTTGACACCGATTTGACTGGCTCCCAAAAGTATGCGCCACGCTAAATGCTGATGATGGCCTTGTCGTTGATGCTGACCGTGCAATCCATTAGGCAACTCTGATAGAACACGCAAAAAGGACGAAAGCAGTCGTCAACTTTGCAGTGGTCGTCCATGATCCAGCTCGCCGTTCACGTTCTGATATATTCGTCGAGCATCCAGCAATCGTGTAATTTGCAAGGCTGTATGTGTGAGGCAGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGGTACTGCGCTCATGTCATCTGATGCCTAGAGCGCGCTCTTCGAGCTCGTTGAGAGTAAATCTGGTCCAATTGCAAGAGTAAAGAATCACTCTGCATCTGCTGAAATCCTGCAGGACACGTACTAATCGTGTGGTTCGTCGATGCAGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGGTTCAAAGACTCTAATATTTGCATTCACAAGTTCAATTTGTCACACCAAAAAAACCCTTCTCTTTGATGGCGATTTTTTCCCGGATTGAGAGCGAATCATACATTCTGGCTAGTACTTCGCACCGACAAGGCCACAGACAAGAGTCGTAGGTCGCCGATTTTCACCCACATTTGACAGTCTGTCGGAACACTCCCCGTCTAGTACCGACTTAAGTTACTGCTATGGTGGAATCCAAACCACTCCCACTGTTTGCCAATTTTTAAAATCATGTCAACAATCGGAAAAGAATCGGTCCGCTTGTGAATAGTCGACTCTAGACCAGAAGGCTGCCTGCAAAAGTGAAGATCTTAGATGACCGCTGAATTTGCAAGAGTGAAACCAGCTCAGAGCATGTGTCAGCCTTGCAGAAAGCTAGAAAAGGCCGCGACACACAGAAAACATTCCTTGTCCTCAATGCTGTACTCGATGATGGAAGACGAGGGCTTAAACCGGAATACATAGATTGCATGATCAGTCTTCGGTCTCTTGGCTCAATGGGGCTGACTGCCACTGGTCATTTCTAGGTTTCGATTTGTCGACGTAAAAGATTATTGTGCACACATCGGCCGTGAATCCGACATCTAGTGGTCATGTCATGTTCATCGTTGCATGCTGTACTGCTGTGATCGAAGCGCCTAATCATCAGAATGCGGCTGCAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCGTAAGTGGCGATCCCCTGTTTGACGCAAGGATTTGTTGAATTCGCGCCTCTTGCAGCTAATGAAGACGGGCTTGTCCACAGTGTCAACTGGAGCAACTGTTCCCAAGACCAACAATCTCATGGCTGTCTGAACATGTAGCTTGTTTGTATGGTCTGCGCGTTTCAATCATGGAACTGGAAGCTCAGATTAACTTTACCCGGATTTCTTTGACAATGCATCTGCCTCTGAATATTCCTCTCTCTAAGTTCTGCACCGAAAACTGCTGGAGACTTTCTTTGGGGTTCCTGCTTAGATCATATAATCCGTGTAAAAATTGAAGGAGGTGGTGAATGGAAATTATCTGGAACATGCATGGGTAGAAATGCTTGAGGATTGCGGGGCCTCCTCCAGAATAGTCAAAGCATTGGTAACGAAGTCGCAGTCCGGGGCGAAACAGTTTGTAACTAGGTCAGTCACGTCTAAGCGTTGCTGGGGTCGTGATTGGCAGCGAGGAGCATTTTGTGTCCGTATGTGTCTGGGCAGGTTGACCATACACTATTTGCTTTCACCGTCACTGTTTGCATCTGTTGACCTGCAGCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGTGTCATCTCGGCTCCCCTCTGTTCCAATCAAATGCAACTGTTCTGTGGGCTCGGGGGCCCCGGGGGGTGTAGGGGAACCCTCGCGGCGAAAAGAAAAGGTTGGCTAGTGCACCGACGCCAAGCGCTCTACAATAAGGGAGCTGGCGTGGAATTAATCGCTGCAGATTGTGCTCAGCACATTGGAGACATTATCGGTTCCTGGCTTTTGACTGTTACTGCTAGAACAGTTGGCTTTCTGGAGACAGTTAGAGCTAGAGAAAGGGCGCATATTGCCGAAAAGCAGCTCATAGAAATGCTCTGCTCAGACTTCTGATGGTTTTAGGGTTCCCAGCACAAGCTTGCATCACACTCGTTGTCAAGTCCTTGTACAATCAGAGGGCATCCTTACTATGGCCTCACGATAACTTCTACGGCATGCTTGCATGAATGAGCGATGTGCTTTTGAGAGTAAGCATTCTTTGCACTTTCCTCCTTGAGCCTGAGCCTGAGCCTGAGGCGGTGAGGTGAGTAGAGTATCTGTAGGCCTCTCCCCCAACCCAAAGCCTTAGAATCAGTGTACACTGGATCAGTACTTGACATCTTGACGCAGCAGAGACAGAAGCTGCAGTAGCAGCAGCAGGAGGGACGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCTCAGTTGACTGCACCTACGGCAAGGGGATCACGGATCCTGCAGCTGAGGGCGTGCTAAATTGTCGTCAGATGATTCGTGCACTGTCAGACCTGCCTGAATTATCGCCGTACTGAGTTGTTGAAGTGGTTTACAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAATCCTCTCTCCTCAATTATGGATGTTGTGCAAGCAAGTCTCCAACTGGTAGTCCGAGACCTAAGTGGCATTCGCTTCGCTTGTGTACCTAAGCATCATTACCGGCGCACGAATACGGACGTCTACGTTGTGCACTTTATAGATTCATCCCAACTCATGACTTTAGCGCATTGACATTAGTGGCCACCACCACCACCCAGGACCCAATGTGTTCATGACATTATTCCACTTTGCCCCTCGCTGCTCAATTCATTCTTGCCTTCGCCCATCATCACGCGAAGCCAAGGTAAGTCCGGAAGCGTGCCCCGAAGCCGGCCGAGATACATTGTACCTTCATTCACAGCCTAAGAACTTTGTCTTTGTCGTAAACCGACCGTGATCACGAGCTGCCACGACGTTACGAGGGGCTCCGAGAAAAACGAACAGCTGTTGTTTCCAAGGCCCCGTGTTCGCTGTAAGCTTGGCCCTAATGTGGAAGCCCGACAGGGACTCGGCAACCCACTCGCCGACCCGACGATGGCCAGGCTCAACGCCGCCCTATGAGTCGATCATAGGTAGCGTGACGAGGGTACGTCTAAGCATCGACAAATCCATCGCTAAGTGGCGAATTCTAGAGGGAATGAACATTGTCTAGAGAAGAACAAGTCTTGTCCGGCGACTGACAGCTCGCGGTATGTCGATTGGCAGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

mRNA

>Mapoly0093s0028.4
TGCTCGCGAGCGCAGCTGGTGGCATACACGCGTGGTGCGCCCAGTTCCATGTCTATCTAGCCTAGGCAGCTTGTCTTCAAGTCTCCACGAGCTCTCACTCACCACCTAGCTCTGGTTGCTAGGTTGATTCGTTCTCGAGGACCTAAAGTCCAGCTGAAAATCCGCGATCCTCGAACAAGTACCATTGGTCTGCTCTTGCTTTCCTGACGAAGGGATACTTGTTGTGTTTCATGACAACGATCATAAGCTGGAGCATGAGCTGGAGACCGGAATTCAAACCCTCCAATGCACCAGAAGAATCAAAATCGAGTATGAGACTGTCACGTCCGTTGTTTCAGGATTGCATACACTGAGCTGAGCTGAGCATGCAACCCGTCACAACACTTGTGTCGTGAGTTGTCTTCTGGCTTGCAAGTGAGCGGTGAAACAAAGCTGTGATCGAGTATATTTGCGATTCGGCTGCCCATGTTCTCGATTTGAGGCAAGAGCAGTTCGTCTGCCGGGGGCTGAGTCGCGCTGTTGGCTGTTCTAGATCTCTAAGGACTTTGGGTCATAGATGGATGCACGGAAGAGTTGGCTCATACGGACATCGGGATTCTGCCCAGTTTGCCGACATGCGTCTCGCGCTGCGGCAGTCAAAGTCAAATGATTGCATCTTACGAGTCAAAAGGCAGAGCTTGCCAATCTCTCCACGTACGAGGTGCTCTTCTAAGAAACACAGAGAGATCAACAACAGCCTGCAGCCAAATGACGATCTGCTCGCGGTGACGACTTCAGATCGAGTCTCGGCATGACCCTGAGAACCGCTCCGAAGCTCGAGCTTCGATCCTATCCACGCGTTAACGATTCGTCGATGACCTGAAGATGCTCGTTGCCTCCAACTCCACGCAGCTACGAGCTCGCACCGACGAGATCAAAACCGTTGACCTGTATTTCTGTCAAACAAGAAGAAGAAGAAGACGAAGAAGCTGAATATACACCCTAAATCGATGACCATAGCCGTGCGAGAAGAGAAGGCCTCTCCTTCTCCCTCTGCGGAATGCGAGCAGATCGCCAACTAGACAGAGCTCTTCGCAGTCGCCCCTCCACACATTTGGAATCTAGGTACAGTCGAAACCCTGCATCTTGGGGACAACCGATCCACTTCGTCGTCCCACGGCTGGCGGCTCCCTGCCGTATCGATTGACCGACTGCCAAAAAACTGAGCTCGCGCATTTGTGCTTAGACGGTGGGACTCGAGGAAATTCCACTGGAAACGAACTCACAAGGTGTCAATTGTGTGGAGAGGGCATGCATCAACTGTTCATGATCTTAGACTCAGTAAAGCTGACACACTCGGGGTCGTTACGCTGCCAGCAACATACGGAGTATTCTTGGTATCTTGATGGCTGAGCTGCTGTGGTGGAGCCAGCTAAGATTGAGATCTCATATTTCACTTCTGTACTCGATCGTCAGAGTAGCTCGACGGACGATATGGCGCAGCCTGCCAACAGTCCGTATGGGGTTGGAGGCAAGGTCGGAAGGAGCATGGACAACAGGTGCAGAGAATGAAACGCAGTTTTAGTGCGGCCGTCACCCCAGGGGCTGAATTTGGGCCCGGGATTGTCAATCGTCGTGGACGCTATCGATTTCCCCTGCAGCCAGCACGGAGTTCCATACAATCACTACCTTTTGAGAGGCGAGAGCTTTCCTGTCCACGACGATTTGAAATCCTCCACCGCGCAGCGCAATACTGCTGGAAGTACAAAAATCGGAATCGAGTCCAGTTTACCACATATCAATGATTGAGATGTAACGGAACGAGAAACTTGCGGCGATTCTCTGTAACTGCATTTTCTCGCTGCAGTGCGGGCGACGACTGGCTGTTGGTTTCCATCTCTTCACGACATATCAGCAATGTTAAAGTCCAGTCGGCCCTCGTACGTGTTCTGCGGCGATAAAACCCTCTTGCGCACTTCTCCTCTCGGGTCTCGCGGCGCACTTCCTTTCCGGAGTATTCTGCCGACTCGTACTTGCAGCACACTCGAGCGAGAGGAGGACTTTCATTCATATGATCAAATTTCGATGATGCCAGGGTGCTGCTGAGGTAGATCTCGTTCACACTGCGGAAACAGGTTCATTCATTGGGCATAATTATGCAGAGGGAAGGCGAACAGCCGGACAATCTCGTGTCAAGGTAGTGAAAAGATTCGAGCATGCGGAGGTTTCGACTTCAAAATTGAATAAAGACACAGGCACTCCTCAACATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAATCCTCTCTCCTCAATTATGGATGTTGTGCAAGCAAGTCTCCAACTGGTAGTCCGAGACCTAAGTGGCATTCGCTTCGCTTGTGTACCTAAGCATCATTACCGGCGCACGAATACGGACGTCTACGTTGTGCACTTTATAGATTCATCCCAACTCATGACTTTAGCGCATTGACATTAGTGGCCACCACCACCACCCAGGACCCAATGTGTTCATGACATTATTCCACTTTGCCCCTCGCTGCTCAATTCATTCTTGCCTTCGCCCATCATCACGCGAAGCCAAGGTAAGTCCGGAAGCGTGCCCCGAAGCCGGCCGAGATACATTGTACCTTCATTCACAGCCTAAGAACTTTGTCTTTGTCGTAAACCGACCGTGATCACGAGCTGCCACGACGTTACGAGGGGCTCCGAGAAAAACGAACAGCTGTTGTTTCCAAGGCCCCGTGTTCGCTGTAAGCTTGGCCCTAATGTGGAAGCCCGACAGGGACTCGGCAACCCACTCGCCGACCCGACGATGGCCAGGCTCAACGCCGCCCTATGAGTCGATCATAGGTAGCGTGACGAGGTTGCGGAGTTTGCAAGAGGATCCGAGATCGGACGCCGGTCACGACATGCAAAACCCCGATGCCGAAAACAAAGCTGGTCCAGAGGGTCCGACTTCTGCCAAATGTGCCGAGAAAATCAGGACCTGAGCGTTCGGAAGAACAAACGCATCTAGAATGAAGTAGTAGCCCCTAGGGACAAACACACGCCTACCTCGTCGCTAGGATCTGTGATGATGAGAGGAACCGCTACGAGTGTAGACCACTCGGAATTGTCGAACGAGCAGAGCAGGATACGGGGCGACACCCTGAACTTTACTTCTATGTTGAGCTCGTTCTCCCGGTGGGTAACCGCATTCCTTGACACAGGAGGCAGAGAGAGTAGTAGGCAATTCAGAATCGCCTCTAGACCGATAATTGCGAAGTGAAACTGAATTCTTCCGAGCAATAAAATGGAAGCAATGACAATGCAAACATGACAATGCCAAATTTGGTATGTGGGACTCGATCTCAAACCGCAGGCCTGCGGGAAATGGCTGTAATTTTGCAAC

CDS

>Mapoly0093s0028.4
ATGGTCTATGTAGCAAATCCTCTTGAGACAGATAAGAGCATCGAGCACTCCCAGAAGCAAGAAGATCAACCCGCAGCCCCCGGAATTGACTCCATGTCAAGGGCCAGTAAAGAGGTCCCCCGATCGACCGTCAAGGAATCGGAGAGTTCAGACTTGCAGACGCAGCGGTCAGCAGGTCCAGTCCAAGCTGTTCCGGAACTGCATCGAATCTTGGACTCCACTAATGAATTGTGGCGTCTCAGAGGCGGTGCAGTCAACAATCACCCCACAGAAGTCATCTGTGTACCGGACGGTGAGAGGACAGCCGTACCACAAATCTCACCGTCCGACTACTTGAACGGGACTGCAAAGGAGAATGTGAATTACATCAATTGGTATCAACATGGGCTTACAAATTCTATGCCAACTGGTCGGATCGTAACATGCTACGCTGGTAACAATCCCAGTGATTCGTCCACCCGTGGAGAAACTGGACGTAACGTAGACATTTCTGTTTTAACATCATTTCACAAGGTCTCTTCGGAGGAGAAATGGGATGCACAAGCTCTGTATGGAGACGTATACAGCGATGATCCCCTGTTCCACATAGTGCCGAGCGCATGTCCCGGCACTGCATCCGGAGCAGTCGCTTGTTCCGAAATTGAGCCCAAGAAATTCGGCATTGGCTTCTCCACCGAGGAAAATGTCTGCGACCTCAAAGGCCAGCGGACCATAGCAACATTGGAAGGCTTGAAACACGATGAACCGTTTGCATTCGACGATTACAGAGCCGATCATTTCTTCTTGGCCGACCCCTCAGGAAATCAAACCCTTGACAATTGCGTTCCTGAGCTCAGATCCGCATTCCGTGTCACCAACAGTTCTGTTGCAGAAACTGTGTCCCAGCATCTCATTCATCATGGGGAAACGTCTCAGTCCGCAGTTCATCCTCAAGAGAAAGTGTTACCTGCTCCCACATCTCCCATATTCCAACTTGAACAATACGATGACATCATGATCTTTAACCATCATGCACAACAATGGCAGGATGAGCTCATGAACCTCAACTACCACGAAGCAAACGCTGAGGGAAATGTGGGCCTTACGAGTGGCTACAAAGGTTCTGCAACGATGCCGGTCCTTCCAGAGCAGCCTCAGTTTGAGGCCATCAATCCATTTCCCACCCGTCACGCCGTTAGTGCCCCTGATGTTGCCACAGATTGTTTCAGCTTTTGGCCTGGAGAACATTCATCCACCTACCATAGTCTGGAGGACCAGTCCACTCCATATGTGTGGCCTGGAAGTCCCACCTCTGAACAGGCTCTAACACCATCCTATCCCACCGAGGCAGGCACCTCGTCCTATACATGGAAAACCACGGACTCATCACTGGTCACGGCAGCGGTAGACGATGCAAAACCGGAGAAAACTGCTAGAAAACACGGGGTACCAGCCGAACCTTGTGCCTCCTCAGGAGACTGGCTGGAATCACGCGGATCCCCTACTTGCTCCATGTCTCCATGTGCCAAAGGCAAGCAAATCGCAGTCTCTACAACATCACAAATTGACAAAATCTCCATTTGCCAGCGGGTCTCTGCAGAACAGGGAAGGACGGAAATGCTGGAAATGCTGCAGACCGTATTTCCTGACTCGCTCGACCTTTCCCAAGAGGACAACAAACATGTTCGTGATGCTCGACTCGCCTGGTTGCAAGAGCATGCAAAAGAAGATATACTGCAGAACAGCAAGCGGGATCGGACGAACTCCACTGAAATGCTCTCGAGGCCAACAAGCTCATTGCGGAAGAAGAAGCAGAAAGACCAGGAAATTCCCGAGGGAAGACTCCGGGGAACATCTATTTGCACGGACCCAGATCTGTCCTACGGCCTGGCGGCGGTGCAAAACGTGCTGGAGGATTTCCATAAAAGTGCCGGTCTTATTCTGAAGGCGAAGAAGCTGCAGAACCAACGGCCTTCGGTGACGGACCTGCTCAACGCGGAACTCGAAGCCCTCTGCATCGGGGACGCTTTGGGCCCAGAGGTCAAAGGTTTCATCATGACAGTGATCAAGATCGGACATGGCAAGCAGCCGGCGGCAACAAACCCAGACATGGTTGAGCAGATTTTGCAGCTGAAATGGCGCCTCGCCTCTCTCATGGAAGAAAGTCGCAATCACGAACGTTCGACCCTCGCGCAATTGAGAGACACGTTCACGAGATACTCTTTTCTTTTCCCAAGCTCAGCAAGCGACTCATTCGACAAGAGAGCAATTCCAAGCAAGTACTACCAGGATCTCGAAAACGTCGTTTGTCAGTACTTCCGAGGATGTAGTCTTTTCTTCAAGCGATCAGCGTCATCGGCGTCTTCATCATCAGGGCAACAAGGTCACGAGAATTCGAGCAACACAGGGGGTGCACCCGATGTACATGCCAAAGTCCGAGGGCCGCTTCCAGTAGAAGTGTTGGGAGAAGCCAACGCGGGCACGTCACCCGTCGTTGAAACAAGTGACAGGAGCCGAATGGCCTCACGCAAGGAGCTGTCCGGAGCCAGGGGTAATCTGCCCAAGGTGGCAGCTGACTACATGCGTCAATGGCTATTCCAGAACTTCCAGAATCCCAATCCAACGAGGGAAACGAAGCTTATGATAGCGACGATGTTCAACATCACAGAAAAGCAGGTGACAAATCATTTTGTCAACCTCAGGGCGCGGAAATTCAGACCACTGGTATGCAGCTAA

Protein

>Mapoly0093s0028.4
MVYVANPLETDKSIEHSQKQEDQPAAPGIDSMSRASKEVPRSTVKESESSDLQTQRSAGPVQAVPELHRILDSTNELWRLRGGAVNNHPTEVICVPDGERTAVPQISPSDYLNGTAKENVNYINWYQHGLTNSMPTGRIVTCYAGNNPSDSSTRGETGRNVDISVLTSFHKVSSEEKWDAQALYGDVYSDDPLFHIVPSACPGTASGAVACSEIEPKKFGIGFSTEENVCDLKGQRTIATLEGLKHDEPFAFDDYRADHFFLADPSGNQTLDNCVPELRSAFRVTNSSVAETVSQHLIHHGETSQSAVHPQEKVLPAPTSPIFQLEQYDDIMIFNHHAQQWQDELMNLNYHEANAEGNVGLTSGYKGSATMPVLPEQPQFEAINPFPTRHAVSAPDVATDCFSFWPGEHSSTYHSLEDQSTPYVWPGSPTSEQALTPSYPTEAGTSSYTWKTTDSSLVTAAVDDAKPEKTARKHGVPAEPCASSGDWLESRGSPTCSMSPCAKGKQIAVSTTSQIDKISICQRVSAEQGRTEMLEMLQTVFPDSLDLSQEDNKHVRDARLAWLQEHAKEDILQNSKRDRTNSTEMLSRPTSSLRKKKQKDQEIPEGRLRGTSICTDPDLSYGLAAVQNVLEDFHKSAGLILKAKKLQNQRPSVTDLLNAELEALCIGDALGPEVKGFIMTVIKIGHGKQPAATNPDMVEQILQLKWRLASLMEESRNHERSTLAQLRDTFTRYSFLFPSSASDSFDKRAIPSKYYQDLENVVCQYFRGCSLFFKRSASSASSSSGQQGHENSSNTGGAPDVHAKVRGPLPVEVLGEANAGTSPVVETSDRSRMASRKELSGARGNLPKVAADYMRQWLFQNFQNPNPTRETKLMIATMFNITEKQVTNHFVNLRARKFRPLVCS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>