Mapoly0093s0032



Description

AP2 domain // B3 DNA binding domain // Potential DNA-binding domain

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
OrthoMCL OG5_184540
PFAM PF00847 AP2 domain
PFAM PF02362 B3 DNA binding domain
PFAM PF13891 Potential DNA-binding domain
PANTHER PTHR31677 FAMILY NOT NAMED
PANTHER PTHR31677:SF1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2B3-2 transcription factor, AP2-B3 Mapoly0093s0032.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0093s0032.1 scaffold_93:403709..413481  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0093s0032.1  

Gene structure:

mRNA scaffold_93:403709..413481  ( + strand )
five_prime_UTR scaffold_93:403709..403865  ( + strand )
five_prime_UTR scaffold_93:403980..404175  ( + strand )
CDS scaffold_93:404176..404295  ( + strand )
CDS scaffold_93:404414..404483  ( + strand )
CDS scaffold_93:404585..404820  ( + strand )
CDS scaffold_93:404948..405055  ( + strand )
CDS scaffold_93:405276..405446  ( + strand )
CDS scaffold_93:405562..405843  ( + strand )
CDS scaffold_93:406017..406750  ( + strand )
CDS scaffold_93:407113..409168  ( + strand )
CDS scaffold_93:409502..411024  ( + strand )
CDS scaffold_93:411346..412547  ( + strand )
CDS scaffold_93:412757..412770  ( + strand )
three_prime_UTR scaffold_93:412771..413481  ( + strand )

Sequences:

Gene

>Mapoly0093s0032.1
GGTCGGATGTGAGGGAACAGCATTTGGGGCTCCTATTGTTGTGCAGCGTAGCTAGAACTGTGCTGATATCTCTCAGAAATGACGATGCCTTAAACGTGGCCTCATTTCCAGTACTGAAACAGCATGTTCTTCAACAAGTTCCGTTTGACTAAGCATGGTATGTGCTAAAATTTTACTTGTTTTCCATTCGCTTGAACTAGGAAGGTGGCACATAGTTCATACATGTATTGCAGCTTTGATTGACACTGTTGCTTACCTTCTACAAAATCAGGAATACCGTAGGCGGGTGGACTGTGACGTTTGTGAGTAAGAGGGTTCTCAAGTGATCACTGAAGGCGATATACTTGCACCAACAGAAGCGGCGTTGACAGTGTTCATCGCAGAAATAACATGACGCTCACTCGAGAACAGGGCTCAGCTGACTTCAACCATCAGGGACCCTCATTCTGAAGACATATAGAGATATTATGGCAGATACTGTCATAGATTCTACATCACCTTCTAGAGGTCGTGATTTCGGCCCTGGTGATTTTGTTGAGGTTAATGGTGGCCTTGAGGTCTTCCGCCATGCCTGGGTTGCAGCACAGGTGTGCATTCCTACTATTGATGTCATTGTCAATCTTTTCTTTCCTTGAAAGTACCATGGTGAATTATCTACCTTTTTTCCAAGTTTTGTCTCTCATTTTACTTTTTTGATAATCGCAGATCATCAGGGTTGAGGAGATGCAAGGATTCTCACGTTACCTCATATCATATGACTCTTACAAAGACACTCGTGAGTATACTAATCTCATGCAAAATATGAAAGGGTTGATTTCATTGAAGACTGTATTTGCTAGTCGCATGGTTGAAATAACATAAGGCTCTGTTCTGCAGTTGAACACTGGCTGGCATGCGAAGAACCTGATGCTAACATATCAGAAGCTTTTGACTATCCTCATGGTGGTACCATTCGTCCAAGACCACCAAAACAACTTGAACTTGCGTTGCATGAGGGGGATACGAGTCTGATTCCCTTCAAGGAAGTATGTGTGAATGATACGGTGGACGCTGCCATTGAGAATGCTTGGTGGCCTGGGAGAATCGTCAAAGTCATGGCTAAACAGACACTGGTAAACTCATATCCGCCACAGTTTTTAAACTGAATTTTTTGGTCGCAATTTATTTTAGTACCCTTTAAATATGATGAATTGCCTGGAATTTTAGTAAAGACAGTATTTAATATACTCGTCTCTGCAGATCGCATTGAATGACGGCAGGGAGGTGACTATGAACATGTCCAAACTAAGGAGACATGTAGATTGGACGGGGGATGACTGGTCTTTGCCAGGGCATGAGATAACATTCGTATGTGAAACATTTTATTTTCAAAACCTTTTTTTTTTTTTGGTGTCTTTGTGGTAGATAGGATGTTACAATATAACACAACTAACAAAATCTGTATAGTTCTAGTATTATTTCGAGTCAATCAAAATATTTCTTATTTGAAATTTTGACTTGGAACTCTGCTGTCTTTAGCTCGGTGTGTACATGAACAATAATATGATGTACATCACGTTGAGTGCAGACACTTATTGTGGAAGAAGATTCGAAGGTGACATTCCGACCTTACGTTGGTGAAGGCTTGTTAAGTCCTAACAGACACATGGTTACTCGCTTGACGAAGAATATGACAACGCATGTGCCTTCATTTGCTAGAGCCCTCGTGAAACGGTGTTTGGGCCCAGCTGGCAAATTGGTGAGCTGACAAGAACATTTCCTTGGATTGCAGTTTGATTCTCATACAATTCTTGTCGTCTCATCTTGGATCTAATTGATCTCTTATGTTTGCCCACATGATGGATGGTATGCAGTCTTTTCCAGTGATGTTTATGAAGCAGTTCATCAAAGGAAGAGAAGGAGTAGCAACTCTGGAAGATGCCAAAGGGGCCAAGTGGGAAGTTGAATGGGCTGCGTGGGAGCAATCTGGCAGAAGGCTTGCCCTTACCCGTGGGTGGCCTGAATTCGCTGAATCACATCGAGCACAAATAGGTGATGTTTTGCTCATTGAAATCCTGTCTCGGGATCACTTCAAGGTCCGATTTATCAACTCCAAACTCAGGCGGGCAATCAGATCTCGTTCCCATTCTAAACAGGTACTTCTTGCAGCTCTTCAAATATCTGTAGTGACTAGCTGGAAACGAAAGTTTTATATATATAATCTGTTTGATATCGATTTTGAAGGTGGTGTTTTAGATCTGACATGACTCTCTCACATGACTTTTGAGCAAACTCTTCACTTAAAGCCTTTCGGTTTTTATGGTTACAGGCCAAGTGCAAAAATAGGGCTCGACCTGAGAAAAGCAGGAGTGATGATGATAGGAAGGTGAAGAAAACCTATGGAGATACGTATTCGAGCAAGAAACTGAATGGTGCCAGCCAGCCACTAAGGTTTGAGGGTGGAGGAGAGAAGACTCCAAGCCAGAGTACGCAAACAGCAAGTACAACGCTTGAGGAGTCTTCTGCCTCCGACAAGACTCTGTATGAACAAGGAGGCAAATCGGGGAAGGAAGATGACTTTGAGGAATGGGACCTACAAAGATCATCTGGATATCCTTCCTGGAGATCTCTTTCACAGGGCCATGGTTCTGCTTCAGAGATGACCTCTCTGTCCTCCATATCACGAGCAAGAACTAATTTTCGAAAACATAGTATCCGCGGGGGGCAATGTCCACTTCCTTGGGCTTCTGTAACTAATGGTGCACAGCAAACGTTGAGTTCACCAGTGAGGCCCCCGAAGTCCGGATCAGCGCTCCCGTCTAAGAGCCCTATCTCTGGCAGGACAAGATTTCATCAAGTGGTTAGCAGGCCGAATTCTTCCACAGTTGTGTATTGCCAATCAACGAAGAGCAAATGTTCGCAGTATTGCGTTCAAGGTCACCAGTTCTGCTTGTGGCATATTCTTGAGGACCCTCATGCTCCTTACAAGCAGTGTGATTACGTTGAAGCTTCATCAAAAGATAGATGTCGCTTCCCTGTGAACCTCCAGATTGAAGATAACAGGTGAAACCTTCGTTATGTTATCCTTTGGTCGAGAAACTCATGTAACGGTTACACAACTTAAGTGAAAGAAATGCAACTAATGCGTATGACTGCTAGTGGATCCCGTGGAGAGGTTGTCTACAAAGCCTTGTCGTAGGGGTTTATTCTTCAACCAAATGTTTAATATCAACATCACTTGCATGTCTACTGCATGATGCTCACAAAGCCCAAATTTTGTTTACATTGTGGACCTACCTCAAGAATAGAATCATCTGTTGAGAGCAAAGTCATGTTGTTCAAGATGTATGATTTCCAACATACTTATAATTGCCTTCACGTTACCATATATGTTAGTACTAACCTATTATTTGTCCTCATTTCAGGTACTGCCAAATGCACAACAACAATCATGGATTTACTCTAAGTCCTCAAACACTGAAGAAACAACAAGGTGTGGAACGTCCTCCAATAGGAGAGTTCACGCTTCTGGTTCTAGCTGCAACGGTGGCGAACGATGTGGAGGTGAAGGAGCCTCCTAAGATTGTGCGCACTGTAGAAGCAAACAATTACATCCAAGTCAGGAGTATTTCCAACGATCCAAAGCAAGTAGCTATGGACATTAGAAAGAATTCTTCAACTGCAGTTATTACAGTTTCGAGCAAATGTGCCAAAGCCAATGGGCCAGGATTCGTCAATTCATCAGGAGACAAATGCCGCGTCGTGGAAGAGCAGTTTCTGGGCAGATCTTGCAGTACAGATGAAATCATTGGTGAACTTGGTGCATTGTCTACCTTTGGTCAGATCAGGAAAGAGGACCTGAATGGGACTTTGAACATTTCGAAGAGACTCAAATCTGATCACACAGGGTTGCCAGGTAGCACCCTAGACAAGAATGGACTCGTATGCCAACGTACTGCAGCCAATGCGGAACAAATCTCCGCATCTAAAGGAAGAAGTCCATCAACTGGAGCTGGACTGTCAGAAGTGTTGACACTGATCCCTGGAGGGGCTACTTCAAGTAGCAAGTCCGCGATAGATGGTGCTCTGCCCTTAAGTAAGAAACCAATTATGGGCATAGAGAAAGTCTGCAGAAGTAATCCCTTATTTGCCCAAAGTAGTGCTGTAAAAAAGAAGTCCACCCTGAACAACATACTCTGTCCTATAGATATTGGACAGATGGATTTTTCTCGGGTTGGGCTAAATTGTGTTCCTTCCAGGCTGTCAGCCTCCTCAGCAATCACTGGTCCAAAGGAAACTGTTGTGAAAAGTCCTTTGTGGTTCTTCCGAAGTGTCGATCTAGGTGAGATGGATCCTACAAGGATGGGGCTAAAGTGTTCATTTGGTGAGACGAAGGCAGCCTCAAAACTGACCATGCCAAAGCGGAAACAGAAGGAAGATACAGTGGGACCGGAGGCATCCAGCGACAAACTACCAGGAAAGAGGCGATTCTTTTCTCAGTATGTCGGTGTTCGAAAGCGACCTTGGGGTGCTTATGGAGCTGAAATTCGGACTCCTGAGGGTAGGCGTTTGTGGCTAGGGACTTTCACCACAGAGGAGGCAGCTGCACGAGCATATGATCATGCCGCTAGATTGTATCGTGGGGAGGGTGCAATGACCAACTTCAATTCTGTGGGATATCCGGTTGAACCAGTTGATGAGAAATCTGGCCTGAAGGAGGCTCCCAAGAAACGGAGGTCTTCAAACAATAAACGCAAAGATGATGAATCGGCTTCTAGCCCAGTCGGTGAAGGCAAGAGACCTAAGGTTCAGAAAGCAGAGGCACAGAGTGCTGGTTCTGGCACTCCACCGACTGAAAATTTTGTACACACAGAAGCAAGTGAGGCAGGAAAATTTGGAAATTTCCTGGTTGATCAAGGGAATCAAAATAGTGAAGGTGGCACCTCTGACACATCTTTGGCAGCTCAACAAGAGAAGGAGGGGATTACGTCTCTGCAAACTCCAGAAGGTCTGTCCTCTGCGGGATGCGCCCATGTTCCTTCTACTGGAGAAGATTTTGAAGCAAGTAGGTCAGCTGCGGGAGATCGAGGAGTTCAAACAGTTGATAGTGAGCAGATGAAAGAAACGAAGGCTAAGATTGGAGAAGAGGCAGACTTAATTGTGGAGCACACTGACACAAGCAAGATTGCCGAGTTACCCGAAGACGGTTATCAAGCCACTGAGCACGATATGCAGGTTGACTCCATACACGCTGGGTCCTGCGGTGGGAATACGGTTTCGCGGCCCAGTCGTCAGAAGAAGTTCAAGAGAATCTCCACAACAGTGGTTCATGACTCGGACAGTTCATCTGGTAACTCTTCAGATGAACGGAAGGAATGCGAAGAAACGTCTGTGAAAGAGGAGGACGCAACTTTGTCAGGTGAAGAAAGTCCACAGAGCGGATCATCAAGATTGGAGTTGACGGAGGAGGAAGGTGTGCAGGTGTGCACAAATATTTCTGAGCCTCCTGTTAGAAACTTTGCAATTAGAGAATTGGTATCTCCGGAGAAAGTTAGAAGGGAATTCAATTTCAGGGGTTTAAGGAGAGTGTCATCACCTAGATTTGAACCCATTGAGAAGGAGACTAACTTTACGGGTGTAAGAAAATCTGCATCAGGGAAATATGAAGCCAGTGTATATGACAGGAATAAGAGAAAGAAGGTTTACGTGGGTATGTTCAATTCTGATATAGAAGCAGCTCGTGCACGGGATCAAAAAGCAATTGATATGGGAGCAGCTTCTACTTTGAACTTCCCTGACATGAAGAAATTGCAGGCAAAGATGCAAGGAGACATACACGAGGAGATAACAAGGAAAGGGAAGGCTAAGGATCTCGCACAGTGGTTCACCAAGCAGCGCCTAGGGCCAGGTAAGGGCTCAAAAGAAAACAGTCAGTGCAAAACCATCAAAGATGATTTTTCTGAAGTCCCTGAGAAGGAAACGAGTCTAGGTAAGAGCAACAAGGCACCTTCATCGCAGATGGAGAAGATGCAGCCTCGCAAAGAAGAAGGACGAGGGCCAGAGAAGAACAAGGTATCCACGGAAGGGAAGAGAGCGGTGTCTGCAGACCAGCCTCCAGTTCAAAAGTCAAGTAAGGAGTCGAAGTCCTCAATCAAGGTTGCAGGGAGTAAAAGTGTGCCACCAGAGTCATCTCTTCCAAGCTCCAAAATTGTTACAAAGAAGGCTGTACCGAGTGTCTTGGAATCAGAGAAAGAACTGACAACAACGAAAATTGCCACAAAGAAAGGCAGTTCTAGTGCCAACAGGTCTAGCAAGAAGCCTTCTCCAGCATCCGGGGAAGCAACTAAAGCACAGCAAGACGGGGGTGAAACACATCAACCTGTGAAGAGAGCTCCTAGAGGAGATTTTCTCTCAAGAATTGGGGCAGATTGCTACATAGAATCCGAGTATGCACGTGTGTACAAGACAACATCGAAACGAAGGGCAATGCTGGACAAGAGTGGAACAAATCAAGCGGCTGCTGCTGCTGCCGCCGCAGCAGCAGCCTCTGACAAAGATTCAACAGAGCAATCGAAAGGTTCTTCTCAGAGGAGTGCACCTCATCAGGCCAAGGGAAATCCTTCAGCTACAGATGTTTCTACGCCTAGTAAACACAAGAAGGATGAGATAGCAGACGGTGATTCTATTCATAACGAAGATGATGATACCACGAGGTCATCAGGAGGAAACAGTTCTGGTGCGAAGTCGAAACGAAAGGAGGCTGACAATTCTGGTGTTACCAACCACTCCAAATCTGGCAAAAAGAAGTTGCTAGAAAGAACCTCATACTTGGGTGTGCAGTCCACACCGAGCGGTCGGTATAAAGCCAAAATTTACCTGCCGAAGGTAAAGAAACACTTGTATGTTGGTATGTACGATTCGGCTGAAGTTGCAGCTCGGGCATACGATGAAGTGGCATTTACGAAGCGAGGAGAATGTGTTCGCCTAAACTTTCCAGAAGAAGTACCTCTTCTCAGAGCACGTCTGAAAGAGGCTACTAATGAAGACGCCGTGAAATCCAAGAAGAACGAGGTACCATTGAAGAAGAGTTTGATACAAAGAACCAATTTTGGGAGCTATCACGCGATGTTGTATGACCCTGGAGTGAAGAAGTACAGGTTTCTTGGGGACTTCACTTCTGTCAAGGAAGCAACAAAGGCTTGTGATGCTGCGTTTAGTTCTCAGTGGGACGATGCTTCAGCTGATCCTCCTGATGAAGAGGAAGACTCCGACAACGAAAAGCTCAACACCTTTTCGGAAAAACGGCCGAGAACCAGTTATGGTGGAGGTTCTCCAAGGTTTCAAGTCCTTGCACTTTTTCTTCCCTCGCCTGTGTACATGTTCATTCTTATCCTGTTACTTTGGTAGATAATGTTCCAACTCACAAAAGATATGCCGTTATACTTCACTATCTAAATTATCACCGCTTATTGTTGTGATAGTAAGATTATGCGTAGTTAAGGGTATGTGTTTCCTAGTACATATTATTTAAGTGTATAGTCATTATTGATCTTCGCTTCATTGTTGAGTGTCAATGTATTGACTCCCTGTCAGATCTATTGAAATTACCAACTTTTGACCGAAATTAGCTGACTTATTTCTCGTCATTATTGGTTTAGGTCAACAACTCGATCTTTACGATCAAATGAAACTTCTTCACCACATGACGCTAGCGAGTCAGCAAAGCAACATGATTCGAAGAAGCCAAAGCAATCTGAGTTTAAAGGTGTATATTGCAGTGGAAGCAAGTTTCAAGCCATATACTACAATCCTGAGAACAAGAAACCCACTTACATTGGAACCTACCTCACTGCACCTGAGGCAGCATATGCCTACGACCAAATCGCCTATGAAAGGTTCGGAGAATCTGCTGTGCTTAATTTCTCCATGGACGAGTTTCCAGATCAGGTTGATAATGGTGATGTGTACAGTAGGCAGGGTTCAGATACCAATAGAATTGGAGAATTAAACACTTTGGCAAGCTCAGCTTTGAAGAGAGAAGGCACAGATTCTGTAGAAGTTGATGCTATTGCAACAGATTTCCTCAAAGATCTGGGCATGAGGAAAAGTCTACGACGGGGGAAAGATCTTAAAAGCAATCTTGCATCGGGATCCATTCAAGGTAGTCATGATGGGGGAAGCAAAGGTTCAGGCGAGAAGAGGCGTATGAGCGTCAGAGAAGATGCTGAGAGCGCCCGAGACAGCACAGGTGGTGACGATGAGGAGGCAGATCAGAGAGAGAGCTCTGATACAGATAATTTGCCTTGTACGAAAACTCACTGGTGTTTAGAGACAGAAGAATCGGGAAAGAAGATCCATGCCTCATATCATAACCCTGTGCAGAAAAAATCCTATAGTCTCGGAGCATTTGATAGTTTTGAAAAAGCAGCTCTAGCTTTTGAAGAGAAGGTAAACGAAGAACTTCAGTTATCTAGAGCTATCGTATCTGCTGCGGAGGTTAGAAAAGCTTCTGGAAAGCAGACTATTGAGTCCAAGGTTACTGAGCCTGCCCTTTTAGATAGCCACTTTTCCACATATGAGCACGATGGGACTTCATCCCTTACTCTCCAAAACACGGGCGCAAGCTCAGGTGGTGAAGGCCCAGGGGCTGCTTTAGATTTAGACACAGGTGATGATGCCCCAGAGGTAGCATTGACCATGCTTTCATGGGCGAGTAGCAAGGTCGCCCCATTAGCTGCAATTGATGGCAAGAAAGTCCGCAAGCTGAATCGTCCTCTTGATCAAGGGGCCCCAGATGATCTAGCACTAGCTCTGGACAGGCGACCCGCTGTCTTGGGAGTGAAGGCTCCCGAAAAGACTTGTAAGTTTTCGCTGATTGTGTTCTTGAAGTTTTCATGCCAGAATATGCTGATTCATTTCTATATAGATGTGCTTGTTAGAAGTGCCACAGTTGGAATGATTGTTTGACATATTTGGCTCAAAGGTCACATAGTGCAGTTTTAAGCTTTGTTCACAGAAATTCCCTCGCAAGCTGAAGTTCGTGTTGTTTGTTTGATGTTGTTTTTGCAGGGTTGAGTCTGTAATAGAATGTACATGAAACAGCCCTAACCCATTTTTCGGTGACTCGTCCCCAGCTTAATTATACAGTCAAGCTGATTACTCATTTATTAACTCTGAAGAACAGATGTTTGTCATTTGCAAATATCTGTTCTGCCACAACTAGGATGCAGTGGAGAGCAGTTGAGTTCGGCTATGGTGCTGGAAGTGTACAAATCTGCAGTACCAAAGTCTGTCAATGAGCTCTTGTACTTTTGTATAGGAATTAATTTACAGCAGGCATGGATCCAGGACAGTGACCTTTGTGGAGACGGTGCCATAGTTGTAGTCTCAGGTTTTGTAATGAACTGGAAAAAGTTTTCCTCCTCTGAGTCTTACTCGCACCTACCGACCATCCACTGTCCGTCGCAGGTTCTCATGCACCTGGGAGTTAGATGCTGTCTGAATTTTTCTTTAGATAGGGAATCAGTAACAGCATTGCCCATGATCAGAAAGTATGAGTCTTGCCCCACACATCAATGGGCGAGTTTGATGATCACAACCTTACGGTAGGCAATTTACCAGTTACTGCTTTCAATCCAAGTTGATGCATGTTATGTCTTCAGTTCCTTGCAGTCTCTATTAAGCAGCTCTGGTCCTGAACCATTTGAGCACTATATCATCATTTGGTTTGGAATACATATCATCTGGACTGTTCTTTTTAAATCAACTGTGCAAAGCTGAAATGTAGGTTTTCC

mRNA

>Mapoly0093s0032.1
GGTCGGATGTGAGGGAACAGCATTTGGGGCTCCTATTGTTGTGCAGCGTAGCTAGAACTGTGCTGATATCTCTCAGAAATGACGATGCCTTAAACGTGGCCTCATTTCCAGTACTGAAACAGCATGTTCTTCAACAAGTTCCGTTTGACTAAGCATGGAATACCGTAGGCGGGTGGACTGTGACGTTTGTGAGTAAGAGGGTTCTCAAGTGATCACTGAAGGCGATATACTTGCACCAACAGAAGCGGCGTTGACAGTGTTCATCGCAGAAATAACATGACGCTCACTCGAGAACAGGGCTCAGCTGACTTCAACCATCAGGGACCCTCATTCTGAAGACATATAGAGATATTATGGCAGATACTGTCATAGATTCTACATCACCTTCTAGAGGTCGTGATTTCGGCCCTGGTGATTTTGTTGAGGTTAATGGTGGCCTTGAGGTCTTCCGCCATGCCTGGGTTGCAGCACAGATCATCAGGGTTGAGGAGATGCAAGGATTCTCACGTTACCTCATATCATATGACTCTTACAAAGACACTCTTGAACACTGGCTGGCATGCGAAGAACCTGATGCTAACATATCAGAAGCTTTTGACTATCCTCATGGTGGTACCATTCGTCCAAGACCACCAAAACAACTTGAACTTGCGTTGCATGAGGGGGATACGAGTCTGATTCCCTTCAAGGAAGTATGTGTGAATGATACGGTGGACGCTGCCATTGAGAATGCTTGGTGGCCTGGGAGAATCGTCAAAGTCATGGCTAAACAGACACTGATCGCATTGAATGACGGCAGGGAGGTGACTATGAACATGTCCAAACTAAGGAGACATGTAGATTGGACGGGGGATGACTGGTCTTTGCCAGGGCATGAGATAACATTCACACTTATTGTGGAAGAAGATTCGAAGGTGACATTCCGACCTTACGTTGGTGAAGGCTTGTTAAGTCCTAACAGACACATGGTTACTCGCTTGACGAAGAATATGACAACGCATGTGCCTTCATTTGCTAGAGCCCTCGTGAAACGGTGTTTGGGCCCAGCTGGCAAATTGTCTTTTCCAGTGATGTTTATGAAGCAGTTCATCAAAGGAAGAGAAGGAGTAGCAACTCTGGAAGATGCCAAAGGGGCCAAGTGGGAAGTTGAATGGGCTGCGTGGGAGCAATCTGGCAGAAGGCTTGCCCTTACCCGTGGGTGGCCTGAATTCGCTGAATCACATCGAGCACAAATAGGTGATGTTTTGCTCATTGAAATCCTGTCTCGGGATCACTTCAAGGTCCGATTTATCAACTCCAAACTCAGGCGGGCAATCAGATCTCGTTCCCATTCTAAACAGGCCAAGTGCAAAAATAGGGCTCGACCTGAGAAAAGCAGGAGTGATGATGATAGGAAGGTGAAGAAAACCTATGGAGATACGTATTCGAGCAAGAAACTGAATGGTGCCAGCCAGCCACTAAGGTTTGAGGGTGGAGGAGAGAAGACTCCAAGCCAGAGTACGCAAACAGCAAGTACAACGCTTGAGGAGTCTTCTGCCTCCGACAAGACTCTGTATGAACAAGGAGGCAAATCGGGGAAGGAAGATGACTTTGAGGAATGGGACCTACAAAGATCATCTGGATATCCTTCCTGGAGATCTCTTTCACAGGGCCATGGTTCTGCTTCAGAGATGACCTCTCTGTCCTCCATATCACGAGCAAGAACTAATTTTCGAAAACATAGTATCCGCGGGGGGCAATGTCCACTTCCTTGGGCTTCTGTAACTAATGGTGCACAGCAAACGTTGAGTTCACCAGTGAGGCCCCCGAAGTCCGGATCAGCGCTCCCGTCTAAGAGCCCTATCTCTGGCAGGACAAGATTTCATCAAGTGGTTAGCAGGCCGAATTCTTCCACAGTTGTGTATTGCCAATCAACGAAGAGCAAATGTTCGCAGTATTGCGTTCAAGGTCACCAGTTCTGCTTGTGGCATATTCTTGAGGACCCTCATGCTCCTTACAAGCAGTGTGATTACGTTGAAGCTTCATCAAAAGATAGATGTCGCTTCCCTGTGAACCTCCAGATTGAAGATAACAGGTACTGCCAAATGCACAACAACAATCATGGATTTACTCTAAGTCCTCAAACACTGAAGAAACAACAAGGTGTGGAACGTCCTCCAATAGGAGAGTTCACGCTTCTGGTTCTAGCTGCAACGGTGGCGAACGATGTGGAGGTGAAGGAGCCTCCTAAGATTGTGCGCACTGTAGAAGCAAACAATTACATCCAAGTCAGGAGTATTTCCAACGATCCAAAGCAAGTAGCTATGGACATTAGAAAGAATTCTTCAACTGCAGTTATTACAGTTTCGAGCAAATGTGCCAAAGCCAATGGGCCAGGATTCGTCAATTCATCAGGAGACAAATGCCGCGTCGTGGAAGAGCAGTTTCTGGGCAGATCTTGCAGTACAGATGAAATCATTGGTGAACTTGGTGCATTGTCTACCTTTGGTCAGATCAGGAAAGAGGACCTGAATGGGACTTTGAACATTTCGAAGAGACTCAAATCTGATCACACAGGGTTGCCAGGTAGCACCCTAGACAAGAATGGACTCGTATGCCAACGTACTGCAGCCAATGCGGAACAAATCTCCGCATCTAAAGGAAGAAGTCCATCAACTGGAGCTGGACTGTCAGAAGTGTTGACACTGATCCCTGGAGGGGCTACTTCAAGTAGCAAGTCCGCGATAGATGGTGCTCTGCCCTTAAGTAAGAAACCAATTATGGGCATAGAGAAAGTCTGCAGAAGTAATCCCTTATTTGCCCAAAGTAGTGCTGTAAAAAAGAAGTCCACCCTGAACAACATACTCTGTCCTATAGATATTGGACAGATGGATTTTTCTCGGGTTGGGCTAAATTGTGTTCCTTCCAGGCTGTCAGCCTCCTCAGCAATCACTGGTCCAAAGGAAACTGTTGTGAAAAGTCCTTTGTGGTTCTTCCGAAGTGTCGATCTAGGTGAGATGGATCCTACAAGGATGGGGCTAAAGTGTTCATTTGGTGAGACGAAGGCAGCCTCAAAACTGACCATGCCAAAGCGGAAACAGAAGGAAGATACAGTGGGACCGGAGGCATCCAGCGACAAACTACCAGGAAAGAGGCGATTCTTTTCTCAGTATGTCGGTGTTCGAAAGCGACCTTGGGGTGCTTATGGAGCTGAAATTCGGACTCCTGAGGGTAGGCGTTTGTGGCTAGGGACTTTCACCACAGAGGAGGCAGCTGCACGAGCATATGATCATGCCGCTAGATTGTATCGTGGGGAGGGTGCAATGACCAACTTCAATTCTGTGGGATATCCGGTTGAACCAGTTGATGAGAAATCTGGCCTGAAGGAGGCTCCCAAGAAACGGAGGTCTTCAAACAATAAACGCAAAGATGATGAATCGGCTTCTAGCCCAGTCGGTGAAGGCAAGAGACCTAAGGTTCAGAAAGCAGAGGCACAGAGTGCTGGTTCTGGCACTCCACCGACTGAAAATTTTGTACACACAGAAGCAAGTGAGGCAGGAAAATTTGGAAATTTCCTGGTTGATCAAGGGAATCAAAATAGTGAAGGTGGCACCTCTGACACATCTTTGGCAGCTCAACAAGAGAAGGAGGGGATTACGTCTCTGCAAACTCCAGAAGGTCTGTCCTCTGCGGGATGCGCCCATGTTCCTTCTACTGGAGAAGATTTTGAAGCAAGTAGGTCAGCTGCGGGAGATCGAGGAGTTCAAACAGTTGATAGTGAGCAGATGAAAGAAACGAAGGCTAAGATTGGAGAAGAGGCAGACTTAATTGTGGAGCACACTGACACAAGCAAGATTGCCGAGTTACCCGAAGACGGTTATCAAGCCACTGAGCACGATATGCAGGTTGACTCCATACACGCTGGGTCCTGCGGTGGGAATACGGTTTCGCGGCCCAGTCGTCAGAAGAAGTTCAAGAGAATCTCCACAACAGTGGTTCATGACTCGGACAGTTCATCTGGTAACTCTTCAGATGAACGGAAGGAATGCGAAGAAACGTCTGTGAAAGAGGAGGACGCAACTTTGTCAGGTGAAGAAAGTCCACAGAGCGGATCATCAAGATTGGAGTTGACGGAGGAGGAAGGTGTGCAGGCAAAGATGCAAGGAGACATACACGAGGAGATAACAAGGAAAGGGAAGGCTAAGGATCTCGCACAGTGGTTCACCAAGCAGCGCCTAGGGCCAGGTAAGGGCTCAAAAGAAAACAGTCAGTGCAAAACCATCAAAGATGATTTTTCTGAAGTCCCTGAGAAGGAAACGAGTCTAGGTAAGAGCAACAAGGCACCTTCATCGCAGATGGAGAAGATGCAGCCTCGCAAAGAAGAAGGACGAGGGCCAGAGAAGAACAAGGTATCCACGGAAGGGAAGAGAGCGGTGTCTGCAGACCAGCCTCCAGTTCAAAAGTCAAGTAAGGAGTCGAAGTCCTCAATCAAGGTTGCAGGGAGTAAAAGTGTGCCACCAGAGTCATCTCTTCCAAGCTCCAAAATTGTTACAAAGAAGGCTGTACCGAGTGTCTTGGAATCAGAGAAAGAACTGACAACAACGAAAATTGCCACAAAGAAAGGCAGTTCTAGTGCCAACAGGTCTAGCAAGAAGCCTTCTCCAGCATCCGGGGAAGCAACTAAAGCACAGCAAGACGGGGGTGAAACACATCAACCTGTGAAGAGAGCTCCTAGAGGAGATTTTCTCTCAAGAATTGGGGCAGATTGCTACATAGAATCCGAGTATGCACGTGTGTACAAGACAACATCGAAACGAAGGGCAATGCTGGACAAGAGTGGAACAAATCAAGCGGCTGCTGCTGCTGCCGCCGCAGCAGCAGCCTCTGACAAAGATTCAACAGAGCAATCGAAAGGTTCTTCTCAGAGGAGTGCACCTCATCAGGCCAAGGGAAATCCTTCAGCTACAGATGTTTCTACGCCTAGTAAACACAAGAAGGATGAGATAGCAGACGGTGATTCTATTCATAACGAAGATGATGATACCACGAGGTCATCAGGAGGAAACAGTTCTGGTGCGAAGTCGAAACGAAAGGAGGCTGACAATTCTGGTGTTACCAACCACTCCAAATCTGGCAAAAAGAAGTTGCTAGAAAGAACCTCATACTTGGGTGTGCAGTCCACACCGAGCGGTCGGTATAAAGCCAAAATTTACCTGCCGAAGGTAAAGAAACACTTGTATGTTGGTATGTACGATTCGGCTGAAGTTGCAGCTCGGGCATACGATGAAGTGGCATTTACGAAGCGAGGAGAATGTGTTCGCCTAAACTTTCCAGAAGAAGTACCTCTTCTCAGAGCACGTCTGAAAGAGGCTACTAATGAAGACGCCGTGAAATCCAAGAAGAACGAGGTACCATTGAAGAAGAGTTTGATACAAAGAACCAATTTTGGGAGCTATCACGCGATGTTGTATGACCCTGGAGTGAAGAAGTACAGGTTTCTTGGGGACTTCACTTCTGTCAAGGAAGCAACAAAGGCTTGTGATGCTGCGTTTAGTTCTCAGTGGGACGATGCTTCAGCTGATCCTCCTGATGAAGAGGAAGACTCCGACAACGAAAAGCTCAACACCTTTTCGGAAAAACGGCCGAGAACCAGTTATGGTGGAGGTTCTCCAAGGTCAACAACTCGATCTTTACGATCAAATGAAACTTCTTCACCACATGACGCTAGCGAGTCAGCAAAGCAACATGATTCGAAGAAGCCAAAGCAATCTGAGTTTAAAGGTGTATATTGCAGTGGAAGCAAGTTTCAAGCCATATACTACAATCCTGAGAACAAGAAACCCACTTACATTGGAACCTACCTCACTGCACCTGAGGCAGCATATGCCTACGACCAAATCGCCTATGAAAGGTTCGGAGAATCTGCTGTGCTTAATTTCTCCATGGACGAGTTTCCAGATCAGGTTGATAATGGTGATGTGTACAGTAGGCAGGGTTCAGATACCAATAGAATTGGAGAATTAAACACTTTGGCAAGCTCAGCTTTGAAGAGAGAAGGCACAGATTCTGTAGAAGTTGATGCTATTGCAACAGATTTCCTCAAAGATCTGGGCATGAGGAAAAGTCTACGACGGGGGAAAGATCTTAAAAGCAATCTTGCATCGGGATCCATTCAAGGTAGTCATGATGGGGGAAGCAAAGGTTCAGGCGAGAAGAGGCGTATGAGCGTCAGAGAAGATGCTGAGAGCGCCCGAGACAGCACAGGTGGTGACGATGAGGAGGCAGATCAGAGAGAGAGCTCTGATACAGATAATTTGCCTTGTACGAAAACTCACTGGTGTTTAGAGACAGAAGAATCGGGAAAGAAGATCCATGCCTCATATCATAACCCTGTGCAGAAAAAATCCTATAGTCTCGGAGCATTTGATAGTTTTGAAAAAGCAGCTCTAGCTTTTGAAGAGAAGGTAAACGAAGAACTTCAGTTATCTAGAGCTATCGTATCTGCTGCGGAGGTTAGAAAAGCTTCTGGAAAGCAGACTATTGAGTCCAAGGTTACTGAGCCTGCCCTTTTAGATAGCCACTTTTCCACATATGAGCACGATGGGACTTCATCCCTTACTCTCCAAAACACGGGCGCAAGCTCAGGTGGTGAAGGCCCAGGGGCTGCTTTAGATTTAGACACAGGTGATGATGCCCCAGAGGTAGCATTGACCATGCTTTCATGGGCGAGTAGCAAGGTCGCCCCATTAGCTGCAATTGATGGCAAGAAAGTCCGCAAGCTGAATCGTCCTCTTGATCAAGGGGCCCCAGATGATCTAGCACTAGCTCTGGACAGGCGACCCGCTGTCTTGGGAGTGAAGGCTCCCGAAAAGACTTGGTTGAGTCTGTAATAGAATGTACATGAAACAGCCCTAACCCATTTTTCGGTGACTCGTCCCCAGCTTAATTATACAGTCAAGCTGATTACTCATTTATTAACTCTGAAGAACAGATGTTTGTCATTTGCAAATATCTGTTCTGCCACAACTAGGATGCAGTGGAGAGCAGTTGAGTTCGGCTATGGTGCTGGAAGTGTACAAATCTGCAGTACCAAAGTCTGTCAATGAGCTCTTGTACTTTTGTATAGGAATTAATTTACAGCAGGCATGGATCCAGGACAGTGACCTTTGTGGAGACGGTGCCATAGTTGTAGTCTCAGGTTTTGTAATGAACTGGAAAAAGTTTTCCTCCTCTGAGTCTTACTCGCACCTACCGACCATCCACTGTCCGTCGCAGGTTCTCATGCACCTGGGAGTTAGATGCTGTCTGAATTTTTCTTTAGATAGGGAATCAGTAACAGCATTGCCCATGATCAGAAAGTATGAGTCTTGCCCCACACATCAATGGGCGAGTTTGATGATCACAACCTTACGGTAGGCAATTTACCAGTTACTGCTTTCAATCCAAGTTGATGCATGTTATGTCTTCAGTTCCTTGCAGTCTCTATTAAGCAGCTCTGGTCCTGAACCATTTGAGCACTATATCATCATTTGGTTTGGAATACATATCATCTGGACTGTTCTTTTTAAATCAACTGTGCAAAGCTGAAATGTAGGTTTTCC

CDS

>Mapoly0093s0032.1
ATGGCAGATACTGTCATAGATTCTACATCACCTTCTAGAGGTCGTGATTTCGGCCCTGGTGATTTTGTTGAGGTTAATGGTGGCCTTGAGGTCTTCCGCCATGCCTGGGTTGCAGCACAGATCATCAGGGTTGAGGAGATGCAAGGATTCTCACGTTACCTCATATCATATGACTCTTACAAAGACACTCTTGAACACTGGCTGGCATGCGAAGAACCTGATGCTAACATATCAGAAGCTTTTGACTATCCTCATGGTGGTACCATTCGTCCAAGACCACCAAAACAACTTGAACTTGCGTTGCATGAGGGGGATACGAGTCTGATTCCCTTCAAGGAAGTATGTGTGAATGATACGGTGGACGCTGCCATTGAGAATGCTTGGTGGCCTGGGAGAATCGTCAAAGTCATGGCTAAACAGACACTGATCGCATTGAATGACGGCAGGGAGGTGACTATGAACATGTCCAAACTAAGGAGACATGTAGATTGGACGGGGGATGACTGGTCTTTGCCAGGGCATGAGATAACATTCACACTTATTGTGGAAGAAGATTCGAAGGTGACATTCCGACCTTACGTTGGTGAAGGCTTGTTAAGTCCTAACAGACACATGGTTACTCGCTTGACGAAGAATATGACAACGCATGTGCCTTCATTTGCTAGAGCCCTCGTGAAACGGTGTTTGGGCCCAGCTGGCAAATTGTCTTTTCCAGTGATGTTTATGAAGCAGTTCATCAAAGGAAGAGAAGGAGTAGCAACTCTGGAAGATGCCAAAGGGGCCAAGTGGGAAGTTGAATGGGCTGCGTGGGAGCAATCTGGCAGAAGGCTTGCCCTTACCCGTGGGTGGCCTGAATTCGCTGAATCACATCGAGCACAAATAGGTGATGTTTTGCTCATTGAAATCCTGTCTCGGGATCACTTCAAGGTCCGATTTATCAACTCCAAACTCAGGCGGGCAATCAGATCTCGTTCCCATTCTAAACAGGCCAAGTGCAAAAATAGGGCTCGACCTGAGAAAAGCAGGAGTGATGATGATAGGAAGGTGAAGAAAACCTATGGAGATACGTATTCGAGCAAGAAACTGAATGGTGCCAGCCAGCCACTAAGGTTTGAGGGTGGAGGAGAGAAGACTCCAAGCCAGAGTACGCAAACAGCAAGTACAACGCTTGAGGAGTCTTCTGCCTCCGACAAGACTCTGTATGAACAAGGAGGCAAATCGGGGAAGGAAGATGACTTTGAGGAATGGGACCTACAAAGATCATCTGGATATCCTTCCTGGAGATCTCTTTCACAGGGCCATGGTTCTGCTTCAGAGATGACCTCTCTGTCCTCCATATCACGAGCAAGAACTAATTTTCGAAAACATAGTATCCGCGGGGGGCAATGTCCACTTCCTTGGGCTTCTGTAACTAATGGTGCACAGCAAACGTTGAGTTCACCAGTGAGGCCCCCGAAGTCCGGATCAGCGCTCCCGTCTAAGAGCCCTATCTCTGGCAGGACAAGATTTCATCAAGTGGTTAGCAGGCCGAATTCTTCCACAGTTGTGTATTGCCAATCAACGAAGAGCAAATGTTCGCAGTATTGCGTTCAAGGTCACCAGTTCTGCTTGTGGCATATTCTTGAGGACCCTCATGCTCCTTACAAGCAGTGTGATTACGTTGAAGCTTCATCAAAAGATAGATGTCGCTTCCCTGTGAACCTCCAGATTGAAGATAACAGGTACTGCCAAATGCACAACAACAATCATGGATTTACTCTAAGTCCTCAAACACTGAAGAAACAACAAGGTGTGGAACGTCCTCCAATAGGAGAGTTCACGCTTCTGGTTCTAGCTGCAACGGTGGCGAACGATGTGGAGGTGAAGGAGCCTCCTAAGATTGTGCGCACTGTAGAAGCAAACAATTACATCCAAGTCAGGAGTATTTCCAACGATCCAAAGCAAGTAGCTATGGACATTAGAAAGAATTCTTCAACTGCAGTTATTACAGTTTCGAGCAAATGTGCCAAAGCCAATGGGCCAGGATTCGTCAATTCATCAGGAGACAAATGCCGCGTCGTGGAAGAGCAGTTTCTGGGCAGATCTTGCAGTACAGATGAAATCATTGGTGAACTTGGTGCATTGTCTACCTTTGGTCAGATCAGGAAAGAGGACCTGAATGGGACTTTGAACATTTCGAAGAGACTCAAATCTGATCACACAGGGTTGCCAGGTAGCACCCTAGACAAGAATGGACTCGTATGCCAACGTACTGCAGCCAATGCGGAACAAATCTCCGCATCTAAAGGAAGAAGTCCATCAACTGGAGCTGGACTGTCAGAAGTGTTGACACTGATCCCTGGAGGGGCTACTTCAAGTAGCAAGTCCGCGATAGATGGTGCTCTGCCCTTAAGTAAGAAACCAATTATGGGCATAGAGAAAGTCTGCAGAAGTAATCCCTTATTTGCCCAAAGTAGTGCTGTAAAAAAGAAGTCCACCCTGAACAACATACTCTGTCCTATAGATATTGGACAGATGGATTTTTCTCGGGTTGGGCTAAATTGTGTTCCTTCCAGGCTGTCAGCCTCCTCAGCAATCACTGGTCCAAAGGAAACTGTTGTGAAAAGTCCTTTGTGGTTCTTCCGAAGTGTCGATCTAGGTGAGATGGATCCTACAAGGATGGGGCTAAAGTGTTCATTTGGTGAGACGAAGGCAGCCTCAAAACTGACCATGCCAAAGCGGAAACAGAAGGAAGATACAGTGGGACCGGAGGCATCCAGCGACAAACTACCAGGAAAGAGGCGATTCTTTTCTCAGTATGTCGGTGTTCGAAAGCGACCTTGGGGTGCTTATGGAGCTGAAATTCGGACTCCTGAGGGTAGGCGTTTGTGGCTAGGGACTTTCACCACAGAGGAGGCAGCTGCACGAGCATATGATCATGCCGCTAGATTGTATCGTGGGGAGGGTGCAATGACCAACTTCAATTCTGTGGGATATCCGGTTGAACCAGTTGATGAGAAATCTGGCCTGAAGGAGGCTCCCAAGAAACGGAGGTCTTCAAACAATAAACGCAAAGATGATGAATCGGCTTCTAGCCCAGTCGGTGAAGGCAAGAGACCTAAGGTTCAGAAAGCAGAGGCACAGAGTGCTGGTTCTGGCACTCCACCGACTGAAAATTTTGTACACACAGAAGCAAGTGAGGCAGGAAAATTTGGAAATTTCCTGGTTGATCAAGGGAATCAAAATAGTGAAGGTGGCACCTCTGACACATCTTTGGCAGCTCAACAAGAGAAGGAGGGGATTACGTCTCTGCAAACTCCAGAAGGTCTGTCCTCTGCGGGATGCGCCCATGTTCCTTCTACTGGAGAAGATTTTGAAGCAAGTAGGTCAGCTGCGGGAGATCGAGGAGTTCAAACAGTTGATAGTGAGCAGATGAAAGAAACGAAGGCTAAGATTGGAGAAGAGGCAGACTTAATTGTGGAGCACACTGACACAAGCAAGATTGCCGAGTTACCCGAAGACGGTTATCAAGCCACTGAGCACGATATGCAGGTTGACTCCATACACGCTGGGTCCTGCGGTGGGAATACGGTTTCGCGGCCCAGTCGTCAGAAGAAGTTCAAGAGAATCTCCACAACAGTGGTTCATGACTCGGACAGTTCATCTGGTAACTCTTCAGATGAACGGAAGGAATGCGAAGAAACGTCTGTGAAAGAGGAGGACGCAACTTTGTCAGGTGAAGAAAGTCCACAGAGCGGATCATCAAGATTGGAGTTGACGGAGGAGGAAGGTGTGCAGGCAAAGATGCAAGGAGACATACACGAGGAGATAACAAGGAAAGGGAAGGCTAAGGATCTCGCACAGTGGTTCACCAAGCAGCGCCTAGGGCCAGGTAAGGGCTCAAAAGAAAACAGTCAGTGCAAAACCATCAAAGATGATTTTTCTGAAGTCCCTGAGAAGGAAACGAGTCTAGGTAAGAGCAACAAGGCACCTTCATCGCAGATGGAGAAGATGCAGCCTCGCAAAGAAGAAGGACGAGGGCCAGAGAAGAACAAGGTATCCACGGAAGGGAAGAGAGCGGTGTCTGCAGACCAGCCTCCAGTTCAAAAGTCAAGTAAGGAGTCGAAGTCCTCAATCAAGGTTGCAGGGAGTAAAAGTGTGCCACCAGAGTCATCTCTTCCAAGCTCCAAAATTGTTACAAAGAAGGCTGTACCGAGTGTCTTGGAATCAGAGAAAGAACTGACAACAACGAAAATTGCCACAAAGAAAGGCAGTTCTAGTGCCAACAGGTCTAGCAAGAAGCCTTCTCCAGCATCCGGGGAAGCAACTAAAGCACAGCAAGACGGGGGTGAAACACATCAACCTGTGAAGAGAGCTCCTAGAGGAGATTTTCTCTCAAGAATTGGGGCAGATTGCTACATAGAATCCGAGTATGCACGTGTGTACAAGACAACATCGAAACGAAGGGCAATGCTGGACAAGAGTGGAACAAATCAAGCGGCTGCTGCTGCTGCCGCCGCAGCAGCAGCCTCTGACAAAGATTCAACAGAGCAATCGAAAGGTTCTTCTCAGAGGAGTGCACCTCATCAGGCCAAGGGAAATCCTTCAGCTACAGATGTTTCTACGCCTAGTAAACACAAGAAGGATGAGATAGCAGACGGTGATTCTATTCATAACGAAGATGATGATACCACGAGGTCATCAGGAGGAAACAGTTCTGGTGCGAAGTCGAAACGAAAGGAGGCTGACAATTCTGGTGTTACCAACCACTCCAAATCTGGCAAAAAGAAGTTGCTAGAAAGAACCTCATACTTGGGTGTGCAGTCCACACCGAGCGGTCGGTATAAAGCCAAAATTTACCTGCCGAAGGTAAAGAAACACTTGTATGTTGGTATGTACGATTCGGCTGAAGTTGCAGCTCGGGCATACGATGAAGTGGCATTTACGAAGCGAGGAGAATGTGTTCGCCTAAACTTTCCAGAAGAAGTACCTCTTCTCAGAGCACGTCTGAAAGAGGCTACTAATGAAGACGCCGTGAAATCCAAGAAGAACGAGGTACCATTGAAGAAGAGTTTGATACAAAGAACCAATTTTGGGAGCTATCACGCGATGTTGTATGACCCTGGAGTGAAGAAGTACAGGTTTCTTGGGGACTTCACTTCTGTCAAGGAAGCAACAAAGGCTTGTGATGCTGCGTTTAGTTCTCAGTGGGACGATGCTTCAGCTGATCCTCCTGATGAAGAGGAAGACTCCGACAACGAAAAGCTCAACACCTTTTCGGAAAAACGGCCGAGAACCAGTTATGGTGGAGGTTCTCCAAGGTCAACAACTCGATCTTTACGATCAAATGAAACTTCTTCACCACATGACGCTAGCGAGTCAGCAAAGCAACATGATTCGAAGAAGCCAAAGCAATCTGAGTTTAAAGGTGTATATTGCAGTGGAAGCAAGTTTCAAGCCATATACTACAATCCTGAGAACAAGAAACCCACTTACATTGGAACCTACCTCACTGCACCTGAGGCAGCATATGCCTACGACCAAATCGCCTATGAAAGGTTCGGAGAATCTGCTGTGCTTAATTTCTCCATGGACGAGTTTCCAGATCAGGTTGATAATGGTGATGTGTACAGTAGGCAGGGTTCAGATACCAATAGAATTGGAGAATTAAACACTTTGGCAAGCTCAGCTTTGAAGAGAGAAGGCACAGATTCTGTAGAAGTTGATGCTATTGCAACAGATTTCCTCAAAGATCTGGGCATGAGGAAAAGTCTACGACGGGGGAAAGATCTTAAAAGCAATCTTGCATCGGGATCCATTCAAGGTAGTCATGATGGGGGAAGCAAAGGTTCAGGCGAGAAGAGGCGTATGAGCGTCAGAGAAGATGCTGAGAGCGCCCGAGACAGCACAGGTGGTGACGATGAGGAGGCAGATCAGAGAGAGAGCTCTGATACAGATAATTTGCCTTGTACGAAAACTCACTGGTGTTTAGAGACAGAAGAATCGGGAAAGAAGATCCATGCCTCATATCATAACCCTGTGCAGAAAAAATCCTATAGTCTCGGAGCATTTGATAGTTTTGAAAAAGCAGCTCTAGCTTTTGAAGAGAAGGTAAACGAAGAACTTCAGTTATCTAGAGCTATCGTATCTGCTGCGGAGGTTAGAAAAGCTTCTGGAAAGCAGACTATTGAGTCCAAGGTTACTGAGCCTGCCCTTTTAGATAGCCACTTTTCCACATATGAGCACGATGGGACTTCATCCCTTACTCTCCAAAACACGGGCGCAAGCTCAGGTGGTGAAGGCCCAGGGGCTGCTTTAGATTTAGACACAGGTGATGATGCCCCAGAGGTAGCATTGACCATGCTTTCATGGGCGAGTAGCAAGGTCGCCCCATTAGCTGCAATTGATGGCAAGAAAGTCCGCAAGCTGAATCGTCCTCTTGATCAAGGGGCCCCAGATGATCTAGCACTAGCTCTGGACAGGCGACCCGCTGTCTTGGGAGTGAAGGCTCCCGAAAAGACTTGGTTGAGTCTGTAA

Protein

>Mapoly0093s0032.1
MADTVIDSTSPSRGRDFGPGDFVEVNGGLEVFRHAWVAAQIIRVEEMQGFSRYLISYDSYKDTLEHWLACEEPDANISEAFDYPHGGTIRPRPPKQLELALHEGDTSLIPFKEVCVNDTVDAAIENAWWPGRIVKVMAKQTLIALNDGREVTMNMSKLRRHVDWTGDDWSLPGHEITFTLIVEEDSKVTFRPYVGEGLLSPNRHMVTRLTKNMTTHVPSFARALVKRCLGPAGKLSFPVMFMKQFIKGREGVATLEDAKGAKWEVEWAAWEQSGRRLALTRGWPEFAESHRAQIGDVLLIEILSRDHFKVRFINSKLRRAIRSRSHSKQAKCKNRARPEKSRSDDDRKVKKTYGDTYSSKKLNGASQPLRFEGGGEKTPSQSTQTASTTLEESSASDKTLYEQGGKSGKEDDFEEWDLQRSSGYPSWRSLSQGHGSASEMTSLSSISRARTNFRKHSIRGGQCPLPWASVTNGAQQTLSSPVRPPKSGSALPSKSPISGRTRFHQVVSRPNSSTVVYCQSTKSKCSQYCVQGHQFCLWHILEDPHAPYKQCDYVEASSKDRCRFPVNLQIEDNRYCQMHNNNHGFTLSPQTLKKQQGVERPPIGEFTLLVLAATVANDVEVKEPPKIVRTVEANNYIQVRSISNDPKQVAMDIRKNSSTAVITVSSKCAKANGPGFVNSSGDKCRVVEEQFLGRSCSTDEIIGELGALSTFGQIRKEDLNGTLNISKRLKSDHTGLPGSTLDKNGLVCQRTAANAEQISASKGRSPSTGAGLSEVLTLIPGGATSSSKSAIDGALPLSKKPIMGIEKVCRSNPLFAQSSAVKKKSTLNNILCPIDIGQMDFSRVGLNCVPSRLSASSAITGPKETVVKSPLWFFRSVDLGEMDPTRMGLKCSFGETKAASKLTMPKRKQKEDTVGPEASSDKLPGKRRFFSQYVGVRKRPWGAYGAEIRTPEGRRLWLGTFTTEEAAARAYDHAARLYRGEGAMTNFNSVGYPVEPVDEKSGLKEAPKKRRSSNNKRKDDESASSPVGEGKRPKVQKAEAQSAGSGTPPTENFVHTEASEAGKFGNFLVDQGNQNSEGGTSDTSLAAQQEKEGITSLQTPEGLSSAGCAHVPSTGEDFEASRSAAGDRGVQTVDSEQMKETKAKIGEEADLIVEHTDTSKIAELPEDGYQATEHDMQVDSIHAGSCGGNTVSRPSRQKKFKRISTTVVHDSDSSSGNSSDERKECEETSVKEEDATLSGEESPQSGSSRLELTEEEGVQAKMQGDIHEEITRKGKAKDLAQWFTKQRLGPGKGSKENSQCKTIKDDFSEVPEKETSLGKSNKAPSSQMEKMQPRKEEGRGPEKNKVSTEGKRAVSADQPPVQKSSKESKSSIKVAGSKSVPPESSLPSSKIVTKKAVPSVLESEKELTTTKIATKKGSSSANRSSKKPSPASGEATKAQQDGGETHQPVKRAPRGDFLSRIGADCYIESEYARVYKTTSKRRAMLDKSGTNQAAAAAAAAAAASDKDSTEQSKGSSQRSAPHQAKGNPSATDVSTPSKHKKDEIADGDSIHNEDDDTTRSSGGNSSGAKSKRKEADNSGVTNHSKSGKKKLLERTSYLGVQSTPSGRYKAKIYLPKVKKHLYVGMYDSAEVAARAYDEVAFTKRGECVRLNFPEEVPLLRARLKEATNEDAVKSKKNEVPLKKSLIQRTNFGSYHAMLYDPGVKKYRFLGDFTSVKEATKACDAAFSSQWDDASADPPDEEEDSDNEKLNTFSEKRPRTSYGGGSPRSTTRSLRSNETSSPHDASESAKQHDSKKPKQSEFKGVYCSGSKFQAIYYNPENKKPTYIGTYLTAPEAAYAYDQIAYERFGESAVLNFSMDEFPDQVDNGDVYSRQGSDTNRIGELNTLASSALKREGTDSVEVDAIATDFLKDLGMRKSLRRGKDLKSNLASGSIQGSHDGGSKGSGEKRRMSVREDAESARDSTGGDDEEADQRESSDTDNLPCTKTHWCLETEESGKKIHASYHNPVQKKSYSLGAFDSFEKAALAFEEKVNEELQLSRAIVSAAEVRKASGKQTIESKVTEPALLDSHFSTYEHDGTSSLTLQNTGASSGGEGPGAALDLDTGDDAPEVALTMLSWASSKVAPLAAIDGKKVRKLNRPLDQGAPDDLALALDRRPAVLGVKAPEKTWLSL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>