Mapoly0094s0004



Description

ARID/BRIGHT DNA binding domain

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005622 Intracellular
OrthoMCL OG5_150315
PFAM PF01388 ARID/BRIGHT DNA binding domain
PANTHER PTHR22970 FAMILY NOT NAMED
PANTHER PTHR22970:SF1 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpARID4 transcription factor, ARID Mapoly0094s0004.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0094s0004.1 scaffold_94:78556..87096  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0094s0004.1  

Gene structure:

mRNA scaffold_94:78556..87096  ( - strand )
three_prime_UTR scaffold_94:78556..79461  ( - strand )
CDS scaffold_94:79462..79623  ( - strand )
CDS scaffold_94:79834..79924  ( - strand )
CDS scaffold_94:80094..80194  ( - strand )
CDS scaffold_94:80421..80519  ( - strand )
CDS scaffold_94:80877..81014  ( - strand )
CDS scaffold_94:81236..81964  ( - strand )
CDS scaffold_94:82245..82424  ( - strand )
CDS scaffold_94:82677..82812  ( - strand )
CDS scaffold_94:82963..82994  ( - strand )
CDS scaffold_94:83188..83244  ( - strand )
CDS scaffold_94:83444..83714  ( - strand )
CDS scaffold_94:83876..83967  ( - strand )
CDS scaffold_94:84243..84296  ( - strand )
CDS scaffold_94:85593..85784  ( - strand )
CDS scaffold_94:86366..86626  ( - strand )
five_prime_UTR scaffold_94:86627..87096  ( - strand )

Sequences:

Gene

>Mapoly0094s0004.1
TTCAATCTCGACTCGTTTCCTACTCTTATTTCTGCGGTGCTGTTCGATGCAACGAGCGGGTTCGCAGGTCGCCTATTTCCATCGTAAACGAAGCTGCTGGCTCGCTGTTTCTTGGGACGCTGCCAGTGATTTGTCGCCTGTCGATTCTCAACAATCGGAAGCGGATTCTGCAGCGCGCGTAGGTTTTCGGTTCGACCCCCCAGGATGGGATCTGCGCAACTGGAGTTCTTCGGATCCTTATTATTGGTGGAATTTTTTGACTATTGATGCATAAGACCGACGGGCTGAGGGCAGACGCGCATGGCGCTTATTGTAGGGGGATCTTTCTCAGTTTCACTTTAGGGGCGGGCGATAGGGAAGGGCTTGAGAAAAGCCAGCAGAAACGTAGTCGCATGGTTCTTATGCTGGAAGTGGCAAGTTCATGGTGTAGGCACAGAGCGCCTAGACTTTCATAAGATTATGTGGAAGAGATGGCTCGTTCTGCAGCCGCTTCTAGACGCGGAAAGCCCGTTTACACCTTACTTGCTGTAATTTTCGGGAAGAAGGTTGTAGTCAATGGTTCGTCTGCCACTGCCGAGAGTGCCGTGAAAGGTTCATTTTATCTTCTACCAAATGTTAGCGGATTTGAAAATGATGCATTCTTGCTGCCCGGGAAGGATAAATCAGTTCCAACGAAAGGAGCGTTTTCTTATCAAGGCTTCCCTGATCTCGTAACAGGCGGCCAACTAGAGGTAATTGATTATGCCCTTTTCAGAAGTCTTCTGCTTCTTTGTTGATTGTTTTAGAACTCCTGTACGGACTAAAGTAGCCAAGTTTCGGTACAACCTTGCATGGGGGTCAAATCGGCAAATCGAGGAGTAGTCTGAGGACAATTCTGCTGTTTAGAGATGTTACAGACTTGAGAGTCTGTACTTTTGTGTCGTCTGATCAACCTTGCGATAAAACTCCCAACCCAGGCTAGGACTTCACTGGTAGAGGTTGCAGTTTATAGGGGGAATTAAGGAGTTGAATCTCGACTGAAGAGCATGATATATAAAGGATGGGATGTTACTCTGCATAAGGCCGATGGAAGTGGCAAAGACAATGTTTTTTTTTCTTTTCTTTGGTTGTTTCGGAACATTTTGTGAAGCTGAATACCACTCTCTGACACATAAGCAAGTGTTTTGGTCCTCCAATTGGTAAGAGGTAATGCAACTTGTTGTGAAGTTCGGTGATACCTATGTGCAGTTTTTAAAGCCCAGATTAACCATCTGTTGGCAAATACTTGTGCTTCCTTTTCTCTATATTAATTGTGGTAGAAATTTTCTTACAGGTCATTGTCCTTGAGTATCCTTCGAAAGAGGAACTCAAGCAAAAATTGGACATTTTGCATCCTGAATTTGTATCCTTTCACGGTGAACATATTCCTGGGAAGGATGACGTTGGAGGATTCGTATTGGGAGATTCCAAAATCTCCTCACCTGATGATATCTTGGGTCTCTTTGGATCAAAGCTGCCTGATCTGGTGAGTATTTGATATTCTTTCTATTTGTCCATTATGTTACTAGCATAATTACGGAAACTTGTGCGCATTGAGCTTTGATAAAGATGCAACTGCCCTGATGTCGTCCCCGCCGCCTGACGACCGGACATTTGTTTTTTCCTTCACAATCGCGGTCTTGGTATGTTGAGACTAGCAGCTACTGGAATCTACGGAATTCTCGTAGTTAGAGGCATATTTAGTACCAGCACGTTCGAATTAACCGATACATAGATGAACTGTGGTGCTATTGCTGAGAAGCCCCCGCGGAAAATTCAGTAGACCCAAGTATATGACAGGTAGGGCGTCTGGACCCTGTTGTGAAGACTCCGAAGGCTCATGCCGGTCATATCTAGCGATAGTTTCGAGATGATCTTTGACAATCCTAATAGTACAACGACTTATCACGTCATTACGGTGTAATTATCGTGTACCTTTACCACCTCACTCCATGGACAGCTAAAGCAGTCTTTCGCTGAATCTTCAGGATGTTAAGCACTGTTTAAAGCCTGAAACAATCTTCTCCACATTTCTGAAATATAGATTACGCGTCCGACGTGTTATCACCCTTCTAATGCTAGTCACAGGCCCTAGAGCCCATTCTGAGTACTTGTCTTCGTTTTCGCAACATACGTACATAAATATCCTGTTTGTTTGAATTAAAACTCTCCACAGTTATCATCAATCAGTACATTACGGACTATCTTGAAGTAGCTCCTAGGACAGCATCTGACTGTAAGTACGTCGATTTCTGATGTTTACTGCCCTTGCACTCTTAAATCTCTGTAAATGTTTCCTCATCCCTTCCATTTTTGCTTTCCACTTTATAGATGTAAGTAGCCTCCCTCAGTTACGAACTGACCCCCGACATAGCGTCTGGGTAAAGTCCAGGGTTTGATCGTCGATATATCTCAAATTTTTGCAGTTCTGTCATTTCCGGGAATCTTTCATGACTTTGGGAGGACGAAAGAGAAAATATCAAGAATAAACTCCACACGGAGGGCTTTACAAAATCATTGCTACTGAACCATTGTAGAGTTCATAATGTGTTCTTAAGTTTTGAATTCTCATAAGATTAATTTGTGCTGCCGTCGTGTGATGACGAGTAGGAGGGGATATGAAACTTCATATCATACGTGTCGAACATCTGACTTTCAATGCTCTTCTGAACTCTATTTGCATTCTTGATCCAGTATATGCTCTGCCTGCAAATCAAATCTTACGTCATGGGTGGGTAATGTACTATAAAGGAAGTTCATAACCTTTGCTTGGAACTTGTAGGTATATCTAGAAGTTCCTTCAGGAGAGAAACTCGGGCACGCCGTTCACTCTCTGGTATATTTTCTCTCGAACTCAGATTTTGTTTGTGTCCATTATGTTCTAACTTGCTTTGGCCGTTCACTCTCTGGTATATTTTCTCTCGAACTCAGATTTTGTTTGTGTCCATTATGTTCTAACTTGCTTTGGCCTACCTGAGAACCAGTAGGCTCTGTGTTTCAACGCAATACTAGCTGTTACATGCGTTTTTGCACTGTCGAATTTTCATATCTTCAACGTTGTGATGTATTCGCTTCATTGAGCTCACAGATACGAATGTACCTCTATGGCAGGGTTGCAAACATGTTATATATTGGAAGATTTCTTCTTTGACTTGCACTTTGGCCTTTCATTTCCGACAAGGATTGGTTGCTTCGCTGCAAAGGTAGATATAATGTCATTTTTTGTTAGATGTATATGTACATTAGTGCTGCAAAGGTAGATATAAAGTCATTTTTTGTTAGATGAATATGCACATTAGTGCTAGCTCTGCTCCGCATCGATTGCTTCAATTATTTAGAGGATTGTTGGGTGGGATGTGAACAGTTCTGCAGCTGGAGGTTATGATGCGTATCATCTAGCGAAGGCGTGCTTCCAAGTGTTTTGTTGCCAGTCTAAACTGGATGGACAGCAAGTCGTGAAAAACGGTTGGCCCCAACTCCTTGGAGATGCTCCTCCGAAAGTTGAGCTTCCCCCTCCTGAGGTGTCAAGTGACGGGGGCGGCTCAAAAGCAACAGAGGCTGCAATGTCAGCCATCCAAATTTTCGACGATGAGATAGAAGTTCGACTTCTCATTTGTACAGAAATAAGTAAGCCGGTAAGTGCTAGACGGTCGAATCCTTATGTCCATTTGATTGTGAGATGAAGACTGCTGTTGCTAATTTGGAGAGAGAAAGGAGTGAGTTTCATCGTAAAGGCTAAATGCGGAACTATCACATTGAATGCAATTGTGAAGACCGCACTTCTAGGCCGGTGTAGAGATGCACCTCCTTACCGTCGTCAGTTCATATCTACAGGACGTGGCTTGGTTGGAGGCTATGGAAGTTGGACTGAGCAGTTTGCTGACAATTGAGGTCATTATATCAGCATCCAACCTTTTTCGTTGCTGTCATGACGTCGCATCTGTTAGGGTGTAGCTAGCACTCCGTTCGGATGCTGGATGAGTTGTATATTGTTGACAGTCTTAACAAACAGGTGTGTTCCTTTTCTGTCCGGTCATTTGGAAGCTGATTGGTTCGAAATATGTGTTCTTGTTTCGGTTTGCAGGCCAGAGGTGTTCGGCTTCTCAACCGGATCAGGTAAATCGAAACTTAGTGGAATGCTATAGTTCATCTAATTAACTGGAAGTTGCACAGAGTCCGGAGTTCAAATTACTCTCCAAAATTAAAATTGGCTCGCGTTTAGATATGCGGAACTTTATTTGCTAAGAAATTGGTCTGTCCTTGCAGTGCTCCACCCCCTCCGATGGCAGCAGCTCTATTTGCCCGAGGAATCGTAACTATGCGCTGTGACATTTGCACTGCCAGCTATGCCCGTGTGCCACTTTTGGTTTCGGGTAGCGCACAGCTTTGTTTCGATGACTTGGTGCGTTGAACTTCCTCCTTTATTTGCATAGCTGACTCTTTGTCTGGCCTTATTTCCACCGTGAGTGTTAATTTCATATAGTTTGCTATTTTCGAATTCTGGTGCGGAGGTTTTGCAAGTGGTCCATGATCTGAGATATGATACGAGCATTAATTTGGTGGAACATTTGAGCGTAATTTTTTTTGCCCTCAGGAAGTTATATCACCCCTGTGAGAGATATCCCTGAACTTAAGTTGGTGTTTCGTGTCTTAGCAATTGGAGACTAGCATCAAGAAGGAGCTCGTTGAGAGGACTCGCCTTGTACGTATTATGAAGAGCGCAGAGGATAGAAAGGCATCAAGTTTGAATGCTGAACTGAGAAGATCAGTTTCTGTGGCATGTGGGGCCACAGTATTCGAATTACGAATCATTACACCTGCTTGGGCAGGCCAGGTAACTACTTCTAGACGCTTGCTAGGCTAGTCATGAGAAATTTTATTTTTTTGTGTTTGAATGTTGAAGGGTTTATTCTCCGGCTATGAAACGTAGGTAGCTCTTTTTTTCCATCTAAAGTACAAATGAACCCGGAGGTTTGTATTTTTAGCCGACTCATTGTTGTGAACTCACTGGTATCAATATTGAGGATCGAATAGGAAGTCAAAGTATGCAATGTGCATTCGGCTTACTCCATACAGTGATAATCTCAGATTTCTAATTACGGGTGATCGATCAGGTTCTAAGGCAGCTCTCAGCTGAATCAAGCTATCGTAGTTTGGTTGCTCTCGGAGTTGCTGGAGTGGAAGGAGCAGCCGTTGCCGCATTCAAACGGGAAGATACCATGCGGCTGGCTTCCACAAAAGTTGACAGGTCGAAGGAGACGGACGTTTCAAACAGCCTGACACATCGGTCCATGCCGTCGTGGTTAACGCCGCCTGTCCCAAGTCGGAAACGAATCAAACTGTTCCATTTTAGTAGTCACTGCTCCAATGATAGTTTGAGTGACGAAGATGGTGCCTCCTCCTTCAAAGTTACAAATGGAGAGGAGAGCAGTAGTAGCGGTGGTAACAGGTCTGAGACTCGGAATTCCACAGGAGGAACTCCAGCGACAAGATCCGACTCAAGATATACACTAGGGAGGACTAGCAAACAAAACTTGGCCCTATTGGAGGCTATGAAACCAGTTCCCCATAGAGGGGGTCCAAGGGCCAATCCTTACGCAGTTGTTGTTGCCACTGCTCATGCTGGTTGGTCCATGAAAGTGAATATGCCGAATGGGGCATCTGGCAAAGTTGGACGTCCTCATTCTAGCTCGTTAGCAGGTCCGCTCAGTGCGTTACCCTCTTTGCCTGCTATGACCGGTCAGACAGCAGCAATTACTCCCTCTTCTCTGTTGTTAGCTGTAAATGCTCCCCTCGTTAAGCCACATGGATGCAGTCGGCAGCCTATCGACGATTGCGCCGAGGTACTACTTTTTACTCCTAGTTGCTTTGTCTTCCAATCTAACTTTCTTTACCTTCTGCCTACTGTTCTACAAATTTAAGTTTCTGGTTTTCTATGGACAAGTGACAAGTAACTTAGGGATCACTTGATATTTCCTTGACAGATGCATTGGTCTCATTTTTAGTGATTTGACTCTTTGGTGCAAGGTTAGCTGATACTCATATCTCTTCTGCATCTGATCAGGAAGACTTTCTCGCCGACTTGATAAAATTTTTGGTCTCAAGAGGACATGGGCGACTTATTCCTCCTGCTGGCGCGGAGGCTTTTCCTGAAGTTATTTTGAACGGAAAAAGACTAGATTTGTACAACCTTTATAGAGAAGTATGGTGGCTGAGTATATTTTCCTCGGTCTATTCTCCCTTATGTCTTCGTGTGAAGTATGAATGCCTCGTATGTAGGGGAACAATGTTCTAGACATTTAAAATTCGGCCAAGCCTCTTTTATGTCAAGATTTTTTTTAAGGCTTGGCGAAATCATCAGTGGCCAAACATAGTATAAGTCTTGGATATTGGTTTATTGAGTTCTTGAAAAGTCGTGTTTGTTTTAATTTGTCTTTATACCGAATAATTTTCCTAATCAATCACACAACGTATAGAGCAAGTAAACAGAACACTTCGCCTAATGTTTCCAGATTCACGCTGTCACTCTTAACATAAATTTACCTTTCATTCTGTTCAGGTGGTATCAAGAGGAGGCTTCCATGTGGGCAATGGAATAAACTGGAAAGGCCAAGTGTTTTCCAAAATGAGGAATCATACTTTAACGAACAAAATGACCGTAAGCTTTTCGCTGAACCTGAAAGCCTGTAGTGATGAGAAATGAGAATGGATTCAGTCCCGATGAAAAAACGAACTTCTTTTCTAGGATGAGAGATTCCATACCTCCCTGTGACCGTGATATTTGGTAGAGTGATTAGCTTCAGGTTGTGTAAGTGTCCCCCTGAATGTGGCGGCAAAGAGCAGGTGAACTTGAAAACTTACAGGTTGCTTGTCTAAATGGGCAGGGTGTGGGCAATACTTTAAAGAAGCACTACGAAACATATCTTCTGGAATACGAACTTGCACACAATGATGTCGACGGGGAGTGCTGTATATTATGTCACAGGTAAGTGCGTCAGCAGTCTGTTTGAAATCTGGACTAGCTCACGTTGCTTTTCCGTAAGTCCTTCTTGCCCTTCGCTGGACTGTCATGACAGGGGCTCTAGTAAAAAAAATTCAGTTTCGCTCGTCAACTGAGGATATTGATGAACACCCTGGGCCTTTGTCCTGCGCAGTGGTGCCGCTGGTGACTGGGTCAACTGTGGAATTTGTGGAGAATGGGCGCATTTTGGGTGCGACAAACGTACAGGCCTTGGAACATTCAAGGTAAGACTTTGACTTTGAGGCTTGTAACTCTCAGTCTTCGTTAGACTCGTAGTCCATCTTCTTGGGGCCTCTCCGTCTACGCTTATGCTTCTAGTCAGGTGTAGCTATCGATGAGGAACCCTGTTTATTCTATGTGATTACATCCGTTTTTTAAGGTTTCTGAGAACGTTTATGTGCATCCCTGACCAAGGTGGCCACATCTTCTTTCAGGAGTACTCCAAAACCGATGGCTTGGAATACATTTGCCCGAGTTGTAGTACTGCAAATGGAAGAGTAACGAAGCGGAATAAGATCCGGAGTTCGAGTGATGGTTCTCCACCACAGACTGAAGTCGCCGTCTCTAAGGGTGTACCGAGAAGAACTTCAAGATGAGACCGTCCATCCCTGCAGTGCTTGTACTGGCACATCGAGTTGATTTTCTCGTCATCTGGGGAATAAGATATACGCTTGTGCTTTTAGCTGAAATGCGGAGAAAGGTCTCAGTGGAGCAGATATTGTTTTCTGTCACCATGGGAATGATGACAACTCACCTCTGCCACGCACTCAGACGCTTGAGCATGAGTCTCCGATATGTCGCTTGTTCTTTTCCAAGCTCACGAAACCAGGAGGCCCCGCGAGTGTAATTTTGTACATCTGAAGTTATACGAGTAGTTTTCTGAGGCTTTCTGGTATCCACAGACCACTGTTAAATTTGGGATACGGGTGTGGAGATGAGAGTTGCGGACCGACGGGATCTAGATGATACTGGATCAAAATGTAAGAGATTGAAGCGCCTTTTCGGGGTCTATCTGTGGTCTACATTTAGGAGGAATCGAAATGCGAGCCTAGAGTAGTTTCAGCTGTACTACTGAACCACTGTGGCATTGTCGAGCTCCTTCATTACCACACACTTGGGCCACGTGCTTGGCTTCATCTGAAGTGTGTGCCCAGCCGCTGCTTTGTTGAACATCGACGAGCGTAGAGCGCTTGGGCGCAGCTAAGCCTACCCCCAATTCCTCCCCACGCCATCCCCACCCGACCCAAACCCAGTCCCTCCTTCCTTCTGTTCTATGACTACCAACATATGTGTTCTGTAACGGAACATAAATTTTGTAGGGATCCGACTTAGATCATACTGCAAGCTTGGTTCAATGCCTGGGCCGGTTGCTCACGTGTTTTCACACAACTGGAGCTCAGGGCCGTGGAAGCCTTTGTACGCACCTGAATTATGGTTGATCACATTGAGCAACCTTCTATTATGTAAACGTTCGTCCATTGTATCAAAATCAATTTCAACTT

mRNA

>Mapoly0094s0004.1
TTCAATCTCGACTCGTTTCCTACTCTTATTTCTGCGGTGCTGTTCGATGCAACGAGCGGGTTCGCAGGTCGCCTATTTCCATCGTAAACGAAGCTGCTGGCTCGCTGTTTCTTGGGACGCTGCCAGTGATTTGTCGCCTGTCGATTCTCAACAATCGGAAGCGGATTCTGCAGCGCGCGTAGGTTTTCGGTTCGACCCCCCAGGATGGGATCTGCGCAACTGGAGTTCTTCGGATCCTTATTATTGGTGGAATTTTTTGACTATTGATGCATAAGACCGACGGGCTGAGGGCAGACGCGCATGGCGCTTATTGTAGGGGGATCTTTCTCAGTTTCACTTTAGGGGCGGGCGATAGGGAAGGGCTTGAGAAAAGCCAGCAGAAACGTAGTCGCATGGTTCTTATGCTGGAAGTGGCAAGTTCATGGTGTAGGCACAGAGCGCCTAGACTTTCATAAGATTATGTGGAAGAGATGGCTCGTTCTGCAGCCGCTTCTAGACGCGGAAAGCCCGTTTACACCTTACTTGCTGTAATTTTCGGGAAGAAGGTTGTAGTCAATGGTTCGTCTGCCACTGCCGAGAGTGCCGTGAAAGGTTCATTTTATCTTCTACCAAATGTTAGCGGATTTGAAAATGATGCATTCTTGCTGCCCGGGAAGGATAAATCAGTTCCAACGAAAGGAGCGTTTTCTTATCAAGGCTTCCCTGATCTCGTAACAGGCGGCCAACTAGAGGTCATTGTCCTTGAGTATCCTTCGAAAGAGGAACTCAAGCAAAAATTGGACATTTTGCATCCTGAATTTGTATCCTTTCACGGTGAACATATTCCTGGGAAGGATGACGTTGGAGGATTCGTATTGGGAGATTCCAAAATCTCCTCACCTGATGATATCTTGGGTCTCTTTGGATCAAAGCTGCCTGATCTGGTATATCTAGAAGTTCCTTCAGGAGAGAAACTCGGGCACGCCGTTCACTCTCTGGGTTGCAAACATGTTATATATTGGAAGATTTCTTCTTTGACTTGCACTTTGGCCTTTCATTTCCGACAAGGATTGGTTGCTTCGCTGCAAAGTTCTGCAGCTGGAGGTTATGATGCGTATCATCTAGCGAAGGCGTGCTTCCAAGTGTTTTGTTGCCAGTCTAAACTGGATGGACAGCAAGTCGTGAAAAACGGTTGGCCCCAACTCCTTGGAGATGCTCCTCCGAAAGTTGAGCTTCCCCCTCCTGAGGTGTCAAGTGACGGGGGCGGCTCAAAAGCAACAGAGGCTGCAATGTCAGCCATCCAAATTTTCGACGATGAGATAGAAGTTCGACTTCTCATTTGTACAGAAATAAGTAAGCCGGACGTGGCTTGGTTGGAGGCTATGGAAGTTGGACTGAGCAGTTTGCTGACAATTGAGGCCAGAGGTGTTCGGCTTCTCAACCGGATCAGTGCTCCACCCCCTCCGATGGCAGCAGCTCTATTTGCCCGAGGAATCGTAACTATGCGCTGTGACATTTGCACTGCCAGCTATGCCCGTGTGCCACTTTTGGTTTCGGGTAGCGCACAGCTTTGTTTCGATGACTTGCAATTGGAGACTAGCATCAAGAAGGAGCTCGTTGAGAGGACTCGCCTTGTACGTATTATGAAGAGCGCAGAGGATAGAAAGGCATCAAGTTTGAATGCTGAACTGAGAAGATCAGTTTCTGTGGCATGTGGGGCCACAGTATTCGAATTACGAATCATTACACCTGCTTGGGCAGGCCAGGTTCTAAGGCAGCTCTCAGCTGAATCAAGCTATCGTAGTTTGGTTGCTCTCGGAGTTGCTGGAGTGGAAGGAGCAGCCGTTGCCGCATTCAAACGGGAAGATACCATGCGGCTGGCTTCCACAAAAGTTGACAGGTCGAAGGAGACGGACGTTTCAAACAGCCTGACACATCGGTCCATGCCGTCGTGGTTAACGCCGCCTGTCCCAAGTCGGAAACGAATCAAACTGTTCCATTTTAGTAGTCACTGCTCCAATGATAGTTTGAGTGACGAAGATGGTGCCTCCTCCTTCAAAGTTACAAATGGAGAGGAGAGCAGTAGTAGCGGTGGTAACAGGTCTGAGACTCGGAATTCCACAGGAGGAACTCCAGCGACAAGATCCGACTCAAGATATACACTAGGGAGGACTAGCAAACAAAACTTGGCCCTATTGGAGGCTATGAAACCAGTTCCCCATAGAGGGGGTCCAAGGGCCAATCCTTACGCAGTTGTTGTTGCCACTGCTCATGCTGGTTGGTCCATGAAAGTGAATATGCCGAATGGGGCATCTGGCAAAGTTGGACGTCCTCATTCTAGCTCGTTAGCAGGTCCGCTCAGTGCGTTACCCTCTTTGCCTGCTATGACCGGTCAGACAGCAGCAATTACTCCCTCTTCTCTGTTGTTAGCTGTAAATGCTCCCCTCGTTAAGCCACATGGATGCAGTCGGCAGCCTATCGACGATTGCGCCGAGGAAGACTTTCTCGCCGACTTGATAAAATTTTTGGTCTCAAGAGGACATGGGCGACTTATTCCTCCTGCTGGCGCGGAGGCTTTTCCTGAAGTTATTTTGAACGGAAAAAGACTAGATTTGTACAACCTTTATAGAGAAGTGGTATCAAGAGGAGGCTTCCATGTGGGCAATGGAATAAACTGGAAAGGCCAAGTGTTTTCCAAAATGAGGAATCATACTTTAACGAACAAAATGACCGGTGTGGGCAATACTTTAAAGAAGCACTACGAAACATATCTTCTGGAATACGAACTTGCACACAATGATGTCGACGGGGAGTGCTGTATATTATGTCACAGTGGTGCCGCTGGTGACTGGGTCAACTGTGGAATTTGTGGAGAATGGGCGCATTTTGGGTGCGACAAACGTACAGGCCTTGGAACATTCAAGGAGTACTCCAAAACCGATGGCTTGGAATACATTTGCCCGAGTTGTAGTACTGCAAATGGAAGAGTAACGAAGCGGAATAAGATCCGGAGTTCGAGTGATGGTTCTCCACCACAGACTGAAGTCGCCGTCTCTAAGGGTGTACCGAGAAGAACTTCAAGATGAGACCGTCCATCCCTGCAGTGCTTGTACTGGCACATCGAGTTGATTTTCTCGTCATCTGGGGAATAAGATATACGCTTGTGCTTTTAGCTGAAATGCGGAGAAAGGTCTCAGTGGAGCAGATATTGTTTTCTGTCACCATGGGAATGATGACAACTCACCTCTGCCACGCACTCAGACGCTTGAGCATGAGTCTCCGATATGTCGCTTGTTCTTTTCCAAGCTCACGAAACCAGGAGGCCCCGCGAGTGTAATTTTGTACATCTGAAGTTATACGAGTAGTTTTCTGAGGCTTTCTGGTATCCACAGACCACTGTTAAATTTGGGATACGGGTGTGGAGATGAGAGTTGCGGACCGACGGGATCTAGATGATACTGGATCAAAATGTAAGAGATTGAAGCGCCTTTTCGGGGTCTATCTGTGGTCTACATTTAGGAGGAATCGAAATGCGAGCCTAGAGTAGTTTCAGCTGTACTACTGAACCACTGTGGCATTGTCGAGCTCCTTCATTACCACACACTTGGGCCACGTGCTTGGCTTCATCTGAAGTGTGTGCCCAGCCGCTGCTTTGTTGAACATCGACGAGCGTAGAGCGCTTGGGCGCAGCTAAGCCTACCCCCAATTCCTCCCCACGCCATCCCCACCCGACCCAAACCCAGTCCCTCCTTCCTTCTGTTCTATGACTACCAACATATGTGTTCTGTAACGGAACATAAATTTTGTAGGGATCCGACTTAGATCATACTGCAAGCTTGGTTCAATGCCTGGGCCGGTTGCTCACGTGTTTTCACACAACTGGAGCTCAGGGCCGTGGAAGCCTTTGTACGCACCTGAATTATGGTTGATCACATTGAGCAACCTTCTATTATGTAAACGTTCGTCCATTGTATCAAAATCAATTTCAACTT

CDS

>Mapoly0094s0004.1
ATGGCTCGTTCTGCAGCCGCTTCTAGACGCGGAAAGCCCGTTTACACCTTACTTGCTGTAATTTTCGGGAAGAAGGTTGTAGTCAATGGTTCGTCTGCCACTGCCGAGAGTGCCGTGAAAGGTTCATTTTATCTTCTACCAAATGTTAGCGGATTTGAAAATGATGCATTCTTGCTGCCCGGGAAGGATAAATCAGTTCCAACGAAAGGAGCGTTTTCTTATCAAGGCTTCCCTGATCTCGTAACAGGCGGCCAACTAGAGGTCATTGTCCTTGAGTATCCTTCGAAAGAGGAACTCAAGCAAAAATTGGACATTTTGCATCCTGAATTTGTATCCTTTCACGGTGAACATATTCCTGGGAAGGATGACGTTGGAGGATTCGTATTGGGAGATTCCAAAATCTCCTCACCTGATGATATCTTGGGTCTCTTTGGATCAAAGCTGCCTGATCTGGTATATCTAGAAGTTCCTTCAGGAGAGAAACTCGGGCACGCCGTTCACTCTCTGGGTTGCAAACATGTTATATATTGGAAGATTTCTTCTTTGACTTGCACTTTGGCCTTTCATTTCCGACAAGGATTGGTTGCTTCGCTGCAAAGTTCTGCAGCTGGAGGTTATGATGCGTATCATCTAGCGAAGGCGTGCTTCCAAGTGTTTTGTTGCCAGTCTAAACTGGATGGACAGCAAGTCGTGAAAAACGGTTGGCCCCAACTCCTTGGAGATGCTCCTCCGAAAGTTGAGCTTCCCCCTCCTGAGGTGTCAAGTGACGGGGGCGGCTCAAAAGCAACAGAGGCTGCAATGTCAGCCATCCAAATTTTCGACGATGAGATAGAAGTTCGACTTCTCATTTGTACAGAAATAAGTAAGCCGGACGTGGCTTGGTTGGAGGCTATGGAAGTTGGACTGAGCAGTTTGCTGACAATTGAGGCCAGAGGTGTTCGGCTTCTCAACCGGATCAGTGCTCCACCCCCTCCGATGGCAGCAGCTCTATTTGCCCGAGGAATCGTAACTATGCGCTGTGACATTTGCACTGCCAGCTATGCCCGTGTGCCACTTTTGGTTTCGGGTAGCGCACAGCTTTGTTTCGATGACTTGCAATTGGAGACTAGCATCAAGAAGGAGCTCGTTGAGAGGACTCGCCTTGTACGTATTATGAAGAGCGCAGAGGATAGAAAGGCATCAAGTTTGAATGCTGAACTGAGAAGATCAGTTTCTGTGGCATGTGGGGCCACAGTATTCGAATTACGAATCATTACACCTGCTTGGGCAGGCCAGGTTCTAAGGCAGCTCTCAGCTGAATCAAGCTATCGTAGTTTGGTTGCTCTCGGAGTTGCTGGAGTGGAAGGAGCAGCCGTTGCCGCATTCAAACGGGAAGATACCATGCGGCTGGCTTCCACAAAAGTTGACAGGTCGAAGGAGACGGACGTTTCAAACAGCCTGACACATCGGTCCATGCCGTCGTGGTTAACGCCGCCTGTCCCAAGTCGGAAACGAATCAAACTGTTCCATTTTAGTAGTCACTGCTCCAATGATAGTTTGAGTGACGAAGATGGTGCCTCCTCCTTCAAAGTTACAAATGGAGAGGAGAGCAGTAGTAGCGGTGGTAACAGGTCTGAGACTCGGAATTCCACAGGAGGAACTCCAGCGACAAGATCCGACTCAAGATATACACTAGGGAGGACTAGCAAACAAAACTTGGCCCTATTGGAGGCTATGAAACCAGTTCCCCATAGAGGGGGTCCAAGGGCCAATCCTTACGCAGTTGTTGTTGCCACTGCTCATGCTGGTTGGTCCATGAAAGTGAATATGCCGAATGGGGCATCTGGCAAAGTTGGACGTCCTCATTCTAGCTCGTTAGCAGGTCCGCTCAGTGCGTTACCCTCTTTGCCTGCTATGACCGGTCAGACAGCAGCAATTACTCCCTCTTCTCTGTTGTTAGCTGTAAATGCTCCCCTCGTTAAGCCACATGGATGCAGTCGGCAGCCTATCGACGATTGCGCCGAGGAAGACTTTCTCGCCGACTTGATAAAATTTTTGGTCTCAAGAGGACATGGGCGACTTATTCCTCCTGCTGGCGCGGAGGCTTTTCCTGAAGTTATTTTGAACGGAAAAAGACTAGATTTGTACAACCTTTATAGAGAAGTGGTATCAAGAGGAGGCTTCCATGTGGGCAATGGAATAAACTGGAAAGGCCAAGTGTTTTCCAAAATGAGGAATCATACTTTAACGAACAAAATGACCGGTGTGGGCAATACTTTAAAGAAGCACTACGAAACATATCTTCTGGAATACGAACTTGCACACAATGATGTCGACGGGGAGTGCTGTATATTATGTCACAGTGGTGCCGCTGGTGACTGGGTCAACTGTGGAATTTGTGGAGAATGGGCGCATTTTGGGTGCGACAAACGTACAGGCCTTGGAACATTCAAGGAGTACTCCAAAACCGATGGCTTGGAATACATTTGCCCGAGTTGTAGTACTGCAAATGGAAGAGTAACGAAGCGGAATAAGATCCGGAGTTCGAGTGATGGTTCTCCACCACAGACTGAAGTCGCCGTCTCTAAGGGTGTACCGAGAAGAACTTCAAGATGA

Protein

>Mapoly0094s0004.1
MARSAAASRRGKPVYTLLAVIFGKKVVVNGSSATAESAVKGSFYLLPNVSGFENDAFLLPGKDKSVPTKGAFSYQGFPDLVTGGQLEVIVLEYPSKEELKQKLDILHPEFVSFHGEHIPGKDDVGGFVLGDSKISSPDDILGLFGSKLPDLVYLEVPSGEKLGHAVHSLGCKHVIYWKISSLTCTLAFHFRQGLVASLQSSAAGGYDAYHLAKACFQVFCCQSKLDGQQVVKNGWPQLLGDAPPKVELPPPEVSSDGGGSKATEAAMSAIQIFDDEIEVRLLICTEISKPDVAWLEAMEVGLSSLLTIEARGVRLLNRISAPPPPMAAALFARGIVTMRCDICTASYARVPLLVSGSAQLCFDDLQLETSIKKELVERTRLVRIMKSAEDRKASSLNAELRRSVSVACGATVFELRIITPAWAGQVLRQLSAESSYRSLVALGVAGVEGAAVAAFKREDTMRLASTKVDRSKETDVSNSLTHRSMPSWLTPPVPSRKRIKLFHFSSHCSNDSLSDEDGASSFKVTNGEESSSSGGNRSETRNSTGGTPATRSDSRYTLGRTSKQNLALLEAMKPVPHRGGPRANPYAVVVATAHAGWSMKVNMPNGASGKVGRPHSSSLAGPLSALPSLPAMTGQTAAITPSSLLLAVNAPLVKPHGCSRQPIDDCAEEDFLADLIKFLVSRGHGRLIPPAGAEAFPEVILNGKRLDLYNLYREVVSRGGFHVGNGINWKGQVFSKMRNHTLTNKMTGVGNTLKKHYETYLLEYELAHNDVDGECCILCHSGAAGDWVNCGICGEWAHFGCDKRTGLGTFKEYSKTDGLEYICPSCSTANGRVTKRNKIRSSSDGSPPQTEVAVSKGVPRRTSR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>