Mapoly0095s0037



Description

TRANSCRIPTIONAL REPRESSOR PROTEIN YY

Reference DB

Database ID Description
OrthoMCL OG5_132824
PFAM PF13465 Zinc-finger double domain
PFAM PF13894 C2H2-type zinc finger
PANTHER PTHR14003 TRANSCRIPTIONAL REPRESSOR PROTEIN YY
PANTHER PTHR14003:SF1 YY1-RELATED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-15 transcription factor, C2H2-ZnF Mapoly0095s0037.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0095s0037.1 scaffold_95:469588..473493  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0095s0037.1  

Gene structure:

mRNA scaffold_95:469588..473493  ( + strand )
five_prime_UTR scaffold_95:469588..469865  ( + strand )
five_prime_UTR scaffold_95:470379..470556  ( + strand )
CDS scaffold_95:470557..470651  ( + strand )
CDS scaffold_95:470854..470912  ( + strand )
CDS scaffold_95:471492..471688  ( + strand )
CDS scaffold_95:471855..471944  ( + strand )
CDS scaffold_95:472410..472553  ( + strand )
CDS scaffold_95:472734..473378  ( + strand )
three_prime_UTR scaffold_95:473379..473493  ( + strand )

Sequences:

Gene

>Mapoly0095s0037.1
AGTGATACGCAAGGTTTGTGTTGACGGAGACGAAAGGGAGGAATCCCACAACGGAACTAAGTAAATGTAGTTGAAGGGATGGAATCATGACAATAATTCGGTTTCCATCGATTGACACGGACACGAAAATATACACGAACCCTAATTCGGTCTTAGTCGATCAATCGGGTCGGCAATTTTACCAAATTATCATCGACTGCTTGGGAACTATCATCTGTCACAGGTTCGATAGGCATGTCTGTTGTCGTCTGTACTCGCGGCTCCGATTGTAAATTCGGGTCAGTCTTCTTCTTTACTGCGACTCCCCATGTTGCGATGGAGTTCCCGTTTCTGTTTCGCATTTCTTGAAAATTTATGAGGGATTTGTCTCATCGGAAATTTTTCTCCATGCAGTCCGCAGTAAAGAAACGAAATTTCTAGACTTTTGTGGTTTCTGTTTTCGAGCTAGTTGTCAAACGAGGAGATTTTCTAGTGAGTAGTGCGATTAATCATGTTTCCAGTGTTCAACGAAATTGAATTTGTGTGAGTAGCTTCAGAATTTGTGCTTCGTGGAATTGAGAGTGCTTCTCTAGCTCAAGCGCACAAATGGTCTGTAAGGTCCGCAGTAGAAATGTCATCATCAGTTCACCCAGATTCTTGTCCAATTTGAGTTTTCTTTTTCATTCTGATCTTTTCTTCAATTTCCCCCGATTATTTATATGTATATATGAAAAATAGCTTAGGTCTGCCAACCATGAATATGCAAGAATGTAACCAATCTCACGTTATTTACGTGTTATTGATCGTTGCAGTGGTAGTATCAGGTGCCCAGATATAGCACTTGCTTTGTGTCCAATCAACAATTCTCCATCTTCGCATCTTCCGACATTCGTGCTTTTCGTTTGTTCGGGTGCACCTGGCTTTGCATTGGCACATGGTGACTAAGAAGCTAAGAATATCGCATTCTTTTGGAAGAGTATTCTGACAGTTATGGAGGTAGCAGAGACTGCTGTTTACCCCAGTGATGGGATGCTCGTTTCAACAGAACAGGGCAAGAGCACAGGACGAAGATGGCAGAAACACTGGTACTCTTGACATTCATGTTTCACCGAAAGCATTTCCGTGTGCCTTTTCTGAATGCATGTTTCGAGTTTTATCTGGTAATACCTTGAAGCACTTGGTGTTGACTGCAGATTTTGTAATCTAACGTGACTTACTTCGTTGTGGAAAAATTTTCCTAATTCACATTCTTGAGGCATTCAAATGGCAGTTGTGGCTTTCTTGCAGGGTACCTCAAGATACTGTGCTGGGAAGCGGCAAATGCTCCTTGCTTAAATGGGTTACTGGTCAGTACATGTGAAGCAGCTCATGGACTCCTTTGAACCTCTGCAAGTAAAGTGATTGGATCAAGTTTTGTTGTCATGATCATTGATGTCATATTAGTGTATTGAACATGACCCGAGGAATTCAATACCTCGGATTTGTAGAACGCGCATCTACCTACCAAGTATCTGCAAATACCAGTACTTTATCTTTGAGAGTTAGTGAAGAAGTTTTGAGATTGGACCAGATTTTGAATGCGCTTTCTCCTACAAAAAGGGAAAACTTCTGAGATAATGCTTGTATGAAGGGTTCATGGTGTGGATATCTCTAGTGGTCTCTGTTTCTTTGTATCAGCCTAAAACCTTAGGTTCACACACAGTAGTGTATGAAAGCACTCATTGATAAATTATGAGTAGGGATTTTTCAGAGGTTTTGCTGATTTCCCGTGCTTGGACTCGACCGGTAGCATCCGTTTCTAGAGCCTAGATACAGAATAGCCTAAACTTTTGTCATGTAGTTTTAATTGAGAGGATTATAAGTAAATGCCCTTGTAATCTGAATGTTTCAAATATTCTGAAGGTTTCGGTTATTCTATTGCGCAGAGGATGTCTTGAATCTTTTGAGCACACGTGGGGAGCCTGTGGAAGAAGAACAGGAACCTGCAGACGAGCATGAAACCGTTTATCTTTGCACCTTCGAGGGTTGTGGGAAGATTTTTCCAGAAGCATCTGGATTGAGGAAACATGCACACGTCCATGGAGAAAAACAATTTATCTGCCATTATGAAGGCTGTGGGAAGGTAGTTGCTCTCGTCTGTCACTCTTTCAAAGATGCTGATAATATTCAAGAGATTGACAACCAATACTGATATCTGGTAAAATTTTAAAGATCCTCAACTGTTGACTGGATTGCCGATGATCTCAGCAAAGCTTCCGTTGACTTTTCTAGTTTCCTCCTGTGTGCAGCGCTTTGTGGACAGTTCGAAGCTGAAAAGGCATTTTCTGATTCACACCGGTGAAAAACATTTTATTTGCCCGTTCGAAGGATGTGGCAAGGTTTTTTTTTCTCCCCTTTTCCTTGCAGTAAACTTAAATTCAATCTTCCAATTCTTGTACCCGAAATTTCAGAATAAGGTTCTCACTTTAGTCCTCCAAGCAGCCTTTGATGATGGGGTTGTTGTGGGAGCCAAACTTTGAAATTTCTTTTGAACCAGTATATGATCTAGGAAATGCTGCCCCTTCTTCAGGCTACCAAGACCTCCAAGAGTGACGGTCTCGTGGTATATGTTTACGTCGTTGAGATCCCACCGGGACAGTAGATGTTATTGTGGCGTGCACCCGTTCATCTTTGCTGTCATGTGATTATATTTGGGTACTGCGAGAAGTTCCACGTCGTCCATTCATTTGTAGTTCAACGTAGGCACACGTTGAATTTGACTGGCATTTGTTTCTCAGCGGATCAAGGCGCCCTAATATCAGACGAAGCATTACAGACACGGATTGTCTGGGATGGATGTGCAGGCATTTTCTCTCGACTTTAACTTAAGATCCCATATGCGGACACACACAGGCGAGAATTATCATATTTGTCCATTTGAGGAGTGTGGAAAGCGATATGCACACGAGTACAAGCTGAAAGCTCACTTGAGGACCTATCACGATAAGGTTTGTTGGATTCACGGCAGTCAAGCCGACCGTTGAGAAAGGAATTTTTGTGCAGGCTCTATATTAAGTCTTTCGCGTGTAGACCGCTGAAGTATGAAGGGGCTTCTTGGGCACGTCTTCATCCACATTTTGTGCAGTAAACTGTACATTGGGGCCTGACTTAAACTTGTGGCCTTGCAGAATATACCCGAGACGAACGTAGTGTCTCCGCATACTGATCCAGAGAGGGAGATTTTTGTGCCGACAAAGTTTGTACCCCCTCCTGTTATTACCCCCAGCTCGATTGAGAAACCTTTCGGATGTCCATTTGAAGGGTGTTCCAAAAGATACATTCATGAGTACAAACTGAACCTACACTTGAAAAGTGCGCACATGGTTCACGACATATACGAAGATGGGTCTCGACCAGGAAGAGGGAGTGACGGCGAGGATGATGTAGAGGAAGTAAGTGATCAAGATATGCGGGAATATGAAGAACCCGTTCAAAGATATTACGAACCTACTCCACCAAAGGTAGGCCAGCCTTCATCGAAGAAACGAGGCTCGAGAGCACCTTTAAAGGGGAAGTTGAGGATTATTGAAAAACCACCGGCTAAGAGTGCGAAGAGGAAACGTCCTGCAGTGCCTACAACTATGAAGCTGAATGTAAAACCGCCTAGTGCTGGGAGAAATGTGGTTGCCAGGCAGGAAATAGCTGAAGATAGTGAGGAAACTGAGGATGAAAATGAGAACACCGAAGAAGAAGATAACGGACATCAGATGGGTGGCAGGGGTAGGGGCAGGGGCGAGGATGATGACGAAGAAACTGAGGATGACATGGATTAGTCCGGAAGTTAACCTTTTCACCAATTTGTATCGAACGGATTTGTCACTTATTCCTTGTGTTGCCTTGTATATAATTGCGGCCCTTGTCGTGCTTGTAATTCATATGGTTGGCCAA

mRNA

>Mapoly0095s0037.1
AGTGATACGCAAGGTTTGTGTTGACGGAGACGAAAGGGAGGAATCCCACAACGGAACTAAGTAAATGTAGTTGAAGGGATGGAATCATGACAATAATTCGGTTTCCATCGATTGACACGGACACGAAAATATACACGAACCCTAATTCGGTCTTAGTCGATCAATCGGGTCGGCAATTTTACCAAATTATCATCGACTGCTTGGGAACTATCATCTGTCACAGGTTCGATAGGCATGTCTGTTGTCGTCTGTACTCGCGGCTCCGATTGTAAATTCGGTGGTAGTATCAGGTGCCCAGATATAGCACTTGCTTTGTGTCCAATCAACAATTCTCCATCTTCGCATCTTCCGACATTCGTGCTTTTCGTTTGTTCGGGTGCACCTGGCTTTGCATTGGCACATGGTGACTAAGAAGCTAAGAATATCGCATTCTTTTGGAAGAGTATTCTGACAGTTATGGAGGTAGCAGAGACTGCTGTTTACCCCAGTGATGGGATGCTCGTTTCAACAGAACAGGGCAAGAGCACAGGACGAAGATGGCAGAAACACTGGGTACCTCAAGATACTGTGCTGGGAAGCGGCAAATGCTCCTTGCTTAAATGGGTTACTGAGGATGTCTTGAATCTTTTGAGCACACGTGGGGAGCCTGTGGAAGAAGAACAGGAACCTGCAGACGAGCATGAAACCGTTTATCTTTGCACCTTCGAGGGTTGTGGGAAGATTTTTCCAGAAGCATCTGGATTGAGGAAACATGCACACGTCCATGGAGAAAAACAATTTATCTGCCATTATGAAGGCTGTGGGAAGCGCTTTGTGGACAGTTCGAAGCTGAAAAGGCATTTTCTGATTCACACCGGTGAAAAACATTTTATTTGCCCGTTCGAAGGATGTGGCAAGGCATTTTCTCTCGACTTTAACTTAAGATCCCATATGCGGACACACACAGGCGAGAATTATCATATTTGTCCATTTGAGGAGTGTGGAAAGCGATATGCACACGAGTACAAGCTGAAAGCTCACTTGAGGACCTATCACGATAAGAATATACCCGAGACGAACGTAGTGTCTCCGCATACTGATCCAGAGAGGGAGATTTTTGTGCCGACAAAGTTTGTACCCCCTCCTGTTATTACCCCCAGCTCGATTGAGAAACCTTTCGGATGTCCATTTGAAGGGTGTTCCAAAAGATACATTCATGAGTACAAACTGAACCTACACTTGAAAAGTGCGCACATGGTTCACGACATATACGAAGATGGGTCTCGACCAGGAAGAGGGAGTGACGGCGAGGATGATGTAGAGGAAGTAAGTGATCAAGATATGCGGGAATATGAAGAACCCGTTCAAAGATATTACGAACCTACTCCACCAAAGGTAGGCCAGCCTTCATCGAAGAAACGAGGCTCGAGAGCACCTTTAAAGGGGAAGTTGAGGATTATTGAAAAACCACCGGCTAAGAGTGCGAAGAGGAAACGTCCTGCAGTGCCTACAACTATGAAGCTGAATGTAAAACCGCCTAGTGCTGGGAGAAATGTGGTTGCCAGGCAGGAAATAGCTGAAGATAGTGAGGAAACTGAGGATGAAAATGAGAACACCGAAGAAGAAGATAACGGACATCAGATGGGTGGCAGGGGTAGGGGCAGGGGCGAGGATGATGACGAAGAAACTGAGGATGACATGGATTAGTCCGGAAGTTAACCTTTTCACCAATTTGTATCGAACGGATTTGTCACTTATTCCTTGTGTTGCCTTGTATATAATTGCGGCCCTTGTCGTGCTTGTAATTCATATGGTTGGCCAA

CDS

>Mapoly0095s0037.1
ATGGAGGTAGCAGAGACTGCTGTTTACCCCAGTGATGGGATGCTCGTTTCAACAGAACAGGGCAAGAGCACAGGACGAAGATGGCAGAAACACTGGGTACCTCAAGATACTGTGCTGGGAAGCGGCAAATGCTCCTTGCTTAAATGGGTTACTGAGGATGTCTTGAATCTTTTGAGCACACGTGGGGAGCCTGTGGAAGAAGAACAGGAACCTGCAGACGAGCATGAAACCGTTTATCTTTGCACCTTCGAGGGTTGTGGGAAGATTTTTCCAGAAGCATCTGGATTGAGGAAACATGCACACGTCCATGGAGAAAAACAATTTATCTGCCATTATGAAGGCTGTGGGAAGCGCTTTGTGGACAGTTCGAAGCTGAAAAGGCATTTTCTGATTCACACCGGTGAAAAACATTTTATTTGCCCGTTCGAAGGATGTGGCAAGGCATTTTCTCTCGACTTTAACTTAAGATCCCATATGCGGACACACACAGGCGAGAATTATCATATTTGTCCATTTGAGGAGTGTGGAAAGCGATATGCACACGAGTACAAGCTGAAAGCTCACTTGAGGACCTATCACGATAAGAATATACCCGAGACGAACGTAGTGTCTCCGCATACTGATCCAGAGAGGGAGATTTTTGTGCCGACAAAGTTTGTACCCCCTCCTGTTATTACCCCCAGCTCGATTGAGAAACCTTTCGGATGTCCATTTGAAGGGTGTTCCAAAAGATACATTCATGAGTACAAACTGAACCTACACTTGAAAAGTGCGCACATGGTTCACGACATATACGAAGATGGGTCTCGACCAGGAAGAGGGAGTGACGGCGAGGATGATGTAGAGGAAGTAAGTGATCAAGATATGCGGGAATATGAAGAACCCGTTCAAAGATATTACGAACCTACTCCACCAAAGGTAGGCCAGCCTTCATCGAAGAAACGAGGCTCGAGAGCACCTTTAAAGGGGAAGTTGAGGATTATTGAAAAACCACCGGCTAAGAGTGCGAAGAGGAAACGTCCTGCAGTGCCTACAACTATGAAGCTGAATGTAAAACCGCCTAGTGCTGGGAGAAATGTGGTTGCCAGGCAGGAAATAGCTGAAGATAGTGAGGAAACTGAGGATGAAAATGAGAACACCGAAGAAGAAGATAACGGACATCAGATGGGTGGCAGGGGTAGGGGCAGGGGCGAGGATGATGACGAAGAAACTGAGGATGACATGGATTAG

Protein

>Mapoly0095s0037.1
MEVAETAVYPSDGMLVSTEQGKSTGRRWQKHWVPQDTVLGSGKCSLLKWVTEDVLNLLSTRGEPVEEEQEPADEHETVYLCTFEGCGKIFPEASGLRKHAHVHGEKQFICHYEGCGKRFVDSSKLKRHFLIHTGEKHFICPFEGCGKAFSLDFNLRSHMRTHTGENYHICPFEECGKRYAHEYKLKAHLRTYHDKNIPETNVVSPHTDPEREIFVPTKFVPPPVITPSSIEKPFGCPFEGCSKRYIHEYKLNLHLKSAHMVHDIYEDGSRPGRGSDGEDDVEEVSDQDMREYEEPVQRYYEPTPPKVGQPSSKKRGSRAPLKGKLRIIEKPPAKSAKRKRPAVPTTMKLNVKPPSAGRNVVARQEIAEDSEETEDENENTEEEDNGHQMGGRGRGRGEDDDEETEDDMD

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>