Mapoly0098s0046



Description

MYC

Reference DB

Database ID Description
OrthoMCL OG5_212581
PFAM PF14215 BHLH-MYC and R2R3-MYB transcription factors N-terminal
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF28

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH10 transcription factor, bHLH Mapoly0098s0046.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0098s0046.1 scaffold_98:596691..612363  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0098s0046.1  

Gene structure:

mRNA scaffold_98:596691..612363  ( + strand )
five_prime_UTR scaffold_98:596691..597310  ( + strand )
five_prime_UTR scaffold_98:598611..598767  ( + strand )
CDS scaffold_98:598768..598871  ( + strand )
CDS scaffold_98:604764..604988  ( + strand )
CDS scaffold_98:607753..607849  ( + strand )
CDS scaffold_98:608048..608062  ( + strand )
CDS scaffold_98:608322..609716  ( + strand )
CDS scaffold_98:610198..610707  ( + strand )
CDS scaffold_98:610978..611145  ( + strand )
three_prime_UTR scaffold_98:611146..612363  ( + strand )

Sequences:

Gene

>Mapoly0098s0046.1
GCTGGGGCTGGCTGGTGCTGCTGATGTGGGAGAAAGAAAGGGAAGGGAAGGGAAGGAAAGGGGACGAAAGCAAAAAGGAAGGAGGACGGAAGGTAAAGGTCAACAGGCCAAAGCTACCTTCCTCAGCGACAACCTTTTCACCCTTTTCCCCCACAACAGTTGAACATCCTTTCGTACTGTTGTGACATCGCGCTAGCTCTCCCCTCGAGCAGGCGGGTGGGACGGATTGACTTGCTGCATGCGCAGGAGGATGGGATGTGTGGGTGTGGGTGGGGGGAAGAAGAGCAGAGAAGTAGGAAAGAAAAGTAACACAATGGAGGAACGGCAGTGCAGGGCAGGGAACGGGGAGACAAGGGAGGGCAGGTAAACTACTTCTGCTGCTGCTGCTGCTCTTGTTCTTAGTGAAGTGCAGACTTGGAGCATGAGTTTAAGAGGCGAATGTATTCTGACTGACACAAGGTACCGAAGGGGAGAAGAAGATTGGAGAAGTAGAACTGTGTCGACAGATATGGGGAGGGAAAAAATCTTGATGACGGTGGATTGATGGTGGGAAGGAGTGGGCCGCAGTTGTACAGGGCCGGAGACGAGACGTGAGAGAGTGAGTGAGTTCACACCTACTGGTAAGGAAATTATTACTGGAGTCTGGGAGCTAAGTCAATTCAATTCGAGAGCATCAGAAGGGGTAGGAGCTGGGGCGGGGCACCGAGAGATGCTGCTTTTTGTGAATGTGGTTATATGTGGCTGCCTGTGTGAGTTTGTGCTGCGGGATTGAACGCAAGGTCGTGTTTGAACTTTGAGCGATGTCGGTGAATGTTCGCAGCCAGCCAGCCAGCTAGCAATCTGCACTCAGATGCGTTCGCTTTCCTGTCCCGCCTCCTGAGCAGCATTTTCTCCGTCGAATGACCAGGATGAGGATGATGATCATGGTGTTCTCCCTCTGGTCCTCGCTTCTCCTCCTCCGGGCCTCGGAAGCGGAGCCTTGAAACCTCGCGCACCCATCTGCTCTTCCAGTTCCGGTGTTCAGTCCAGTCCAGTCCAGCCCGGTCTCGCTTTATCAGCAGTCTGTCCTTATCGCGACTCCCCACTGCACTCCATGTTCATAAAGCCCACCTCACTTCCACTCGCAGTTCCCTCTCTGCTCGCTTTCCATTCCACTTGAAGCACTACTGGCACTTGCAGTGTTCTCCATCCACACTGGGTGGTGCCAGGTTCTCCCAGGACAAGGTCCGCAAGTATGCAAGACTGATCAGCGTGAACAGCATGAGTCCTGCTGGTGCCGACGACGGTTTGGGTTCGTCCTGCTGCTCGCGCCACGGTCGAGCGCTCATCAGCTGCAGAATCACTTGAGATCTTCCTTCTGTTGAGAGTGAAGCTTTCAGCAGTGTGCCCTCCTGCAGACCGGGCGTCTGTAAATTACGTACTCGGAGAGCACATATGCATGATGGACAAGCCCTCGTGTTACTGTATGTCATCAGTCTTCTGCAGTTCAAATTGCAGCACCTTGGCCCTTTGAAATTGAGAGAGCGAGTCGGCAGAACGAGTGAGCTGACAGTGTAGGCACCGCAGCTCGACGTCGAGTACGTCCAGAGCTTGTGCGGCTCGTCACACGTCGTCTGTGTCCGTCCATAGCACCGTCGTGTTTGAAATCGGGTCGAGAACTCTAGCCACCGAGAGCCCGGAATCCAGACGCGACGTACCTTTGAGTTCGGCGGAATCCAGCCCTTGAATTTTTGACTGCAATGATATAAATTTCAACCATAGCAACTAAGGCACGAATATTTGAGAAAACGAATTTGGGACTGGCTGGCTGGGCTGGCATCTTGCACCGAGCTGCTTCTACTACTGCGTGAGTGCGTGCGTGCGTGCTGGCTGCAGCTTCGTGAAACTTGCAAGTTTTGTGACACTGCAATATACATCCAGATGATTTCGGGGTAAAGCGTGATGGAAAGCGCAAGCTTGGGGAGGAGCGCAGAAAGAGCTAGGAGGGTCAGCCGAGAGACCTCCACGTGAAAGTGGGCGGACCCGAGCCTGCGATCAGCTCCGAAACCTCACGAGGAGAAAGTAAGGAGGGAGGACAATGCAGGGGCGGATGTCCAGAGAACGTGAGATTTTGCAGGAAATTGTGGAGAGAATAGGATGGGTGTACGCAGGCCTATGGCAGCCCTTGCCACCGGATAACAGGTGCGCTTCTCATCCCAAGCACCACATTGTTCAGCTCAAGTTGTCATGATTGAGTAACACGGTCGTGGTGCAAGAGAGATCTCGTCCGTGTGCTTGCTTTTCAGCTCGTCTGTCTGTATTAAATCAGCTAAATTTTAGTTTCTAGGAGCTCCTCGCGAGCGGTGGTAGACTTGTCTGAGTGCCCTCGCTCGAGCGACGAGATCTCGTCGTGAAATTGTTCTCGTCGTCCGACGACCATCCCAAAGTCCGAACTCGGTTGAGATATGTCAATAGCTCGTACTCGGCACGTGGGGGGAAACATTCTCGACCCATGATCAGCTTTCATTGGGGGTTGGTACTTGTCGCGCTAGACTAGAATTTCGGGCGCACGTAGGATGCATCGTGCAGTTTCTGGGCGTGGATGGAATTTCTTCAGACGAAGGGATCAGGTTCTCGAAACCATATAGGGTACATCGCCTTCATCTTGCTCGGGAATGTCGCCGTGGTGACCTTTGCAATGCCCTCTGACGTGCAGCTCAGCTTTGTCCGACCGAACCTCGCCGAAAAGTGAGGACGGACTCCCTATCTTCTTTGAGCATGCTGTCAAGACGCTTTTGCCTTGCCATCGACTTGACTGAGGGGTTTGCTACTTTGAGTGTTGAGAAGGTATTCTCGACGATAATTATTACCGACTATGTCACTGAGACAATCCATCAGCCATCTGATTTTGCGCCAATTGAGCTCTAGGGTTCTTTCCCGTCGTCCGGATTGGTGCCTTTTACTTCCTGCGTGGTTCGAGCAGGTGCTGCTGCCCATGCCGGGCTGCAGAATCAGTAAGCCCTTCGAGTTTAGGTGACGCTCCGAAAATATCTCAGCATGAGTTCTTCGAGCATGTACTTTCCAGCGGTATGGTCGTGATGCCTTCTTAATCAAACATTTCTGGGTGTCAAAAAGCGAACTTCAGACTCCGTGCCGAGTTACAGTCCGGGCGCTGCACTGATTTAAATATCAGGACCTGCTCCCTTGTCTTGGAAACCTCTAGGATCTTACGAGAACGATGCGTTATCTCTCCTGCAACGTAGGTTCTGAATTTATTTATTTTGCGACGTCCTCACTGGCTTGAAATAGAGGACCCAAAATTGGGAAGTGAAACTGATTTCGCTTCATGCCGGAAATGGATCCCATCACCAAGACCTGAGATTGGTGGTGGATCTTTCACTCGATCGAATCGAGTGATCGAGTACTCAATGTGTTCGTTTCGGGATACGCAGGGAATTGCTGCGGCTAGTCAGCTTGGATTTGAGCCCGCATATTCGATCGAATCGAGTGATCGAGTACTCAATGTGTTCGTTTCGGGATACGCAGGGAATTGCTGCGGCTAGTCAGCTTGGATTTGAGCCCGCATATTCTGTCTCTCCTCACGTGCATTCTGGGACGATCGATTATATCATTTCGATCACTGGGAATGATGAGCTCTGAGTGTTCCTGATTGCGAGGCCTGAGCATGTATGCCGAGCTAATCTCGGATTCAACGTTGACGTGGGATCTTGAAGATTTGATCAGTTTTCTGAATCACGGAGCGACTCACTCTCAGTGTACGAGTGGTGAAGTCAAGAAATTCCCTCGTCTGGATGACTTCAACTCTTGGGAACCGAAGCGCCGAAGAGAATTCGGTGTCTCTGATTAATCCTGCGTGGCATCTATACTTGTGCTTGGATTCTGTCCTTCTCGCTCTCGTGCTTTCACGTCCCGTGATTCACACGTCGCGCTCAATTGCTTACAGCAATCCGTGGTACTTGCTGCCGACGTCTCTTCATAAATTCAGACGTGAAGCAGGAATATCTTCTTGTAGAAAGGACATGCCTGCCTCTCGTTTCTCTCTAGGGCTGTCTCGAGATCCAGTCGAGGCGAGGAGGCTGTCCACTGCCAGCTGCTGCCCACCGCAGTCAGGCTGAGCTCGTACGTCTGGAATGTGGTCAGTCTGAGACGAGTCCGTGAGCACCCGTATTTAGCAACCGTCCCACTTGGTTGAGGATATTATTCGGAAGCTGTAGTAATTACAGCAGTCGACTAGATTTCCCGACGTTGGGTGTGAGCGCACTGCGTGTGGCGGTGGATGAAGACGAATTAGTGAAGCTCGAAGCTCGGATCTGATGACACAGGTCGATACGACCGCTGTGTAAAACGTGTGTTTGCTCGAGAATGTTCGCTTTTTCGTTTCGTAGGTTCCGTGAGGTGTCAAGGTGTCCAACCTCGGTTAGGCTGTAGTCAGACGGTAAGACCCATCGAGTAGAAAAGGCGAAAAGGATGTTCGGGGTCCGATAACAGGCGGACACGGGCGACGAGAGGGCGTGGCGAGTGGAGAATAGGTCGCATCGCGTTCACGTGCTTGGGAAATGCATGAAAGTGGGGATGGCTGGGGCAGGGGCTGGGGTTCAGGGGTGGCGAGCCTACGGTTGGGAATGAGTCGGGGGAGGGAATGGAGGGTAGGCGAGACGAGGTGAGACGAGATGACACCATGGATGGGACAGGGCAGCTCTCGTGCAGGCGAAGGAGGACTCGGGGAAGCCGAGCAAAGTCCTATGATTGCTATAGAAAGAAAGGGGAGGGGAGAGAGCAAAAGGGCGGTCCTGTCACAGTCGCCAGCGAGTCAGCCAGACAGGCTCACACGGTCATCGTGCAAGGAAGGCTCAGATATACAGTCACTGGACCTGGACCCGGGCTTGACTTGTCTGATTGGCTGGGCTGGGTTCCGTTGGGTCTGGGTCTGAGGAGGAGGAAAGTTTGCGAATCTCGAGACGAGAAAAAGCAGCAGTTGAAGGGAGGGAGTGTTGATCACTGCACTGCACTGCACTCGCTCCCTCACTCACTCACTCAACTGCCAACGTCATAAAATGGAGGAGGTGGTGCAGTGGTAGCAGCAGCACGGTCTGGGCTAGTTGTTGGTATTTCCTGGTGCCAGGGGGCTCCTGGACTGGGCTGGACTGGCGGCAGCAGCTGCTGCAGCAGCAGACCAGTGCAGTGCAGTCGAGTCAGTGCCCGAATCTTCCACTTGCATAATGCTGCTTTCCTGCCCCTCCATCTATCTGGCTGCCCTTCTGCGCACGTCAAGTAAACGAGGTCATTTCCCCAGCCAGCCTCATCCAAAGCCTTTTAACTTGCATGCTCCATCGCCCTTCCCTCCCTTCCTGCCCCGAAATACCATGCCGACAGGTGAGTCCCACCCCACCTCCCGCGCCGCAGTTGGAGGCGCCGGCGCTCTTCAAGTGGAAGAAGAGGAAGAGGAAGCAGGCGTTCTCTTCGGGTCTGTGTGCTTTCTCTTCCGGTCCTGGCGCTGCTGATCCCGTCTTCGCATCCCATGCCAATGCCATGGAACGCGAGGCGAGGCCAGACAACGGAGCACTTGTCCTCTCGCAGAAAACGCCTGAGACCTTTCCCCCCGCCTCTCGCTTAATCAGAGGTCAACACTGGAGCCCTCTCGGAGACGAGAGAGAGAAAGAGAGACGCCACGGGCCGTTCTCCGCTTCTCAGAGTGGGGGAGTGGGAGATCCAATTCGCAGCAGGACACCTGCGAGCCAGCCTGGGCTAGAAAAGATATTCCTAGTGTCCTACGGTCGGATCCATGGAGTCCTGAATCTCCGGAATCATTTCGCCTCGATAGATAGCCCGCCGGTGGTCCAGACAACCAAAAATTGCTCGAATGCTTTATCGTGGACTTTCTTAAAACTTATCTGCTCCGGCCTCCGGGGAAGATTCATCCCGCCCACTTGCCAGCACTGTTGTTGGGCAAACACACGCTGGTGGGCCTCGCCGGTCCCCTCCGCCCGCTGCGCTTCCCGCTCGCTATAGGACGCCTTTGGGTGGAGATCGATGCTCCTGCCCCGGGCTCTGCCATGATGGGTACACAGATTACCCCCGAGATCTCCTGCCCGAAGCCTTCCTTCGCCGTATCCTCACACCGACTCAAATGTTTGCACTATCTTTTATTAGCAGGATTGACTAATGTCCGCCCTTTCTTTCCACCCATGCTGCTTCCTTCCCTCCCTCCCTCCCGCCGGCCCGCCCGCCCCACTATGTGTTGCGGTTGCTAGGCATAGGCTGCTGCTGCTGCTGCTGCTACTACTGGACTTCGAGCTTTGGGTTTCGCGTGGCTATAGGCTAGCTCGCTCTCATGAGCATCTTCTTCCACTGCAAGGGTTTGTCGCCTGGTGCTTCGTTCACCATCTGAGTGACCCGATTGTCTTAATGTGTCTAGATTGATCGGAGACAGCAATGCAAATAAATCCAGACACATCGTGATTAGTGGAGACTAGGCTGGCGTTCAGATCTAGCGGGTGATTTGTCACGAGCAAATTCGTTGCGGGCTTTGGGTCGATGCTGTTTGGCGACTACACCAGCCTCGGGCGCCCACCGCCGCTGGTCCACTCCCCCACTCTCTCTCTCACTCCCATCAGGCTTGGCGTGATGCCCGGTCGTGACGGTCATTGAGAATCCCGTCCCTCGGACGTAGAATGTTTTCTGCCTGCGTGCCCACGGCAGAGCTGCTTCTGTTCACAGCAGATGATGAGATACCCTCCTGGCAAACGAGGCCCGAGGACCTCTTTCCAACGATCGACAGCCAGGAGTCGGGATCCGTCGGACTGAGATGTATAGTATATTCACTCCGCGTGGGCCCCCATTACCGGCCTGCGTGCGCGCGTGCCTGCTCCATCTCTTCCCCTTTTTAGGCCTGTGTGGGCGAGCGAGTGCGGTCGACGAAGCCGTAGGACTCGAGCCTTGGACGCCCCATTGACTTGCCACTCAGTCCAGTGCGCACGGACGGCCCCTCCGGTGCATAAAAGAGCCGAACTCTTGACGCGGTTCATCAGACCCCACCCCACCCCACCCCACCCCAGCCTCCAGCGCTCGACGGTCAATCCGCTTCGGACTGCGATGCGACGCTACAACCTTGAAAGCTTCCAGGGAGGGCCGGGAGAGATGAATGACCACCAGCCTGACCGACCTGCCGCTACTAGCGTGCGAGACGCGTCTCGCCCTGGTCATGCGTCTGTCGTTCGTCGAGACGGCCGAGATGACGCTGGTTCGCTCTTTTCTCGAGCCCTTTCCAGCGCCTCGAGCAGTTAGCAGTTAGCGCGAGAAACGTATGGGTCCCGTGCCACTTGCGGTCCTGCCTCCTGAGCAGCCCCGCAAATGTGTCGCTGCTGAGCGTTCCGTGTCCCCCACCCTGTCTGATCCACATGCCTCGCTTTGCTGTGCGTTGCCTCACCTCGCCTTTAGCCTGCGATCACGTTCAGCTAGATTTCCGGGGGCCGAAGGAAAATTATATACCGTAATTTATATCGAGGAAACCAATCCTGACGGTAGGTTTCGTTTCGAATATGGAATGAGATCTCTCTGGGAAAGATGTGCGCTGCGTTGGTGAGCAGTCTATCTGAGCTCGTTTGTCAAGACTGTCTTAAACAGGCGTAGCCTCCGAGATTGATGTAAGTTATCGTCTGACATGTTTCAAGTAATCTCGACAGCTGATAATAACGAAGAAATTGATTCCTTCCAGATCTGAGAGAACGGGACTGGAATGAATACGATTTCCTCAAGAAGAGAGCAGAATCCCTTCTTTAGTTCATCTCAAGTGCAATGCTGGCACGCGCAAGTTCTTTGCACCGAATATAGGAAGCCACAACAATGAAATAGTATAGGGGGAACTACATTTTCTTTCCGTCTTTGGTGTCACAAATCTGAAATTGGCCATCTGAATTAATTATATTTGGTGAGGCAGGTAATTACGAAATCAGAAAGCATGATTACATCTTAATAGTTCATATTTTCTTAAATCCTTAAATGTAACTCACGCTGTTCCACTGGAGACGGGACGGTGGCTACGGGGCTCAGATTGGCGTGGTTTTGTCCGTGCAGCTTGGTAGGATGGGCAGATGGATACTACAACGGACCTGTTTCGGAGAACTCGGAGGCACCGCTGCCGTCGAGCGCTCAATGGAATCAAAGAAAAGAGCGGAGGCGGATGGTGGAGGAGTTGCAATCAGTGCCAGACAGTCGTCTTACCGACCGGCCGGACCTCAGCAACATCGAGTGGTTCTACTTGATTTCGTCCAAGTTCGAATTTCCCTTCGGAACGGATGGGTAAGCAATCAGTACAATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTGTGCATGGTATCTCGGTTCGCAATGTTTCGCGAGTTTGTGGTCAAACTCCAGTCGTCGGAAGAAGAAGATATCGGGGAAAGTCCCTCTTACCGTGTGCACCAGCTTCACTGCAATGGAATGGAATGGAAGGCGCTGTTCCGGGATGGGCCGATCTGAGGTGCTCTGCAGAAGCAGCCAGCAGCTTTCCGAAAAAGTTTGCGTGGTGGCGTCAAGCTAACATATCCGGAAACGTTTATTCGAGGCCAGAAGCCGACACGGCTCCTGGCATTTGGGTCGCGAATTCCTAGGAGCAAGCAACTATCTTCTCGCTCGAGCTCGAGCTCGGGTCCACACCTCGATCTGCTCGGGTGGCTGCCCGAGCTCGCCAGCTCGGCAGCAATCTGAGAGCCCACTGCCCAACCTCTGCTCGTTGCTCCGTACGTACCCCCCGGGGCGATGGGCGATGGTCAAGCTGAAAAGCCGAGCCACCCCCATGACCGACCGTGGACCCCATCTTCCTCCGGTAGCCGGTCACCTGCATGACAGGTGTGGAGTCACCTCCGAAACCCAGGTTCGTGGGGCCTGCTGCGTCGTCTGCCGGCGATCCTCCCTCAGGCACCCAACCCAACCCATCGAGTTGGGGCGATTAGTTCGTTACAGTGGTTACTTAGAAGACGGCGAAGGTCGATCTCGCGGCGAGGTCCCAGGACGCTGCTGCACCGGCACGTGCCTGTCCTGTTGGTAGAATGCGGCGAGCCGCGAGAGTAGGTACTGATGAAAGCGATCGAAAGCTCGCCGGCCGGAGAGAAGACATGCCCCCCGCAACGGTCGTGGGCACTGCGTCGGCGAGGGCCATCATGACCAACGTGGCTGGAACGGACCGGTTCAGGTGGCCACGGCCCCCGAGGCCGATGATGGGGCCAGTGGGTCACACACTTCCACCAGTGAGGGGCGCAGGGGACAACCGCGCCACTCATAACCCGGCGGATGGACGGGATGTTCCCGACGACGGCAGCCTGGTGGATGGACGGACGGATGCATCTGATCCGGTGTTTGTCCGCTGACGAAGAGCAAGCAGTACGGCGCCCGTAGGCCCCTCGGACCCTTCTCTCCTCTCTCTCTCTCTCTCTCCCTCCCTCGGGGGGGACGGATTTGGCCGTCAATGCCGTTGCAATATTGCACCGAAACGAACTTCATGCGTCTCAGTTCGTGAGCATGCGATGCAAGCCAGAAGATATTTGGGTACAAATCTCGAGAGGGCGGAGTGTTGCGTAGGGCAGACAGCGCCGTTCGGACGACACGGATGTTTTGCTCCTCTCACCTCTCTCTATGTACTATGTCGCCCAATTATTTGCTCCCTTGCTCGCATCACTGGCTGGCTGGCCTGCTGTCAAGTCAGTCGACATACGGGTCACCGGCTTCCACCGGATACAATGTGCACAAGGATATGTGTACGTTATTACGCCATTCCTCAGGAAACTCGACTCGGGCTCGATTTTATCGAGCTTCGCAATTTCCTACTGGCCTTCTCTTTGTCGAGGTCCATAATCACGATCTGACCTCGCGTTCCCGACTGACATGACGTGCACTCGAGGACCGGAAAGAGAGGTAGAGAGGCCGAGGGGGGCGAGAGCGAGAGCGACCGACCATTTGTACAGTACGAACAGGTTTCGGGAAACGGTTGGATGGGTTCAGAAGTTCAGATAATGACAAGGTCTACTAGACATGCTCATTACCACCTTTTACTGGCGCTCGATGCGAGTGAGATCTGCACACCGAACTCAGAAATCGTGTCAGAAGTGTGTCGTATTGACGATCCTCAGCTCTTTCTCTCTCGGTTGGAGAGAGTCAGACTGTTGAATATTATCAGTCCCACGTGCCCGGCCATCGGAGCTGACGTCATGATACGAATTTTAGCTTGCTGTAAGTCATCGCACCTGTCAGTCACCTTTGTCAAAGAAGAAGGGAGACTCCGACAGTGGAGAAAAAGGCCCGTCGTCGCCGAACGAAGTGCAAGGGTGAGAGTAACGCAGTGCTTTGATGAGGCTTACACTGAGGTGCCGTCTCACCTTGACAAGGTCAGGTGAACTCAAAGACTATCTGGTACCAAACGATCCTCCTCGGCAGCGCTAATTGACGGCATTTTGTCCTCGAATTGTATGTCGCAGCATTGAAGTCCTTCAATTGAAAAATACTCTTGAAACCTAAACCGTTGGAGAAACCAGCCGAAATCCACGCACACTGAATTGCCAAAAGCCAAACATAGTAACAAATCAATAAATCTAAGAGCCGTAGTATCCTCTTAAGGGCCTCGGAGAATCAGCTACTGATTGCCTTCAATATGTTCTCGTACTTTTGGAATCTCAAATGACATATATCTAGTACGAATTGAAACTCTTCACTAATTACCTGAAAGCAATTCTCATTTGGTTGAAAAGCACCAGCATTGAGAAGTATTCATGACCTGCACGAGCGACCATGTCTTGCTGGAAATATGTGCTCCAATTGATCTTTGGGGATAATTCTATCGAGTAACTCTTCACTATTCTTAGCTTGCGGAAAGTCAAAAAGCCTCCTCATTCCTAGAATTAACTGGAGTTTGGGGGGAGAAAGCATGATGACTGATTTCTCTCTAAGCGACCGCTCAATACTGTGGAATCTTGAGCTGCCATTTGAAATGAGCAATGCTTATTCAGGTCGTATGCATATTTATGTGCAGGACACCCGGAAAAATGCTTATGACGGGTGGCTATGAATGGATCTGTGACGGCGAGGAAGTAAATGGGGCATTGTTTAGTCGCACAGCCTTATGCAAGGTCAGTTTCTTGAGCTCTTTACCGTCTGGTGTTGATGTATGGTGCTTTCCTTCTTCCCGTCGAAAAGTGCGCTTCTACTCTTTTGGAATTCATAAATGAAAAACTCAGATGGAAACTGCGACGTATCTTTCTCGGCGAAACTAACTGAACTTTCACTTCCTCGTCATGCTTCGGGATTTCATCGTCCTTGATCATCAGGCAACAGGAATGAAGGTACGTGTTCCACTATTTCTGTCTCCGTTATCACAAGACTAGACCAGATGAAAACAACCAAGGTTAATGTCTCAAGGGCTTCAGCTAAGTGCATGACTGTCTACGCATTATAAAGTATATGTTTAGACATAAAACTTCAATGCAGTTGCAGATGCTCAGATCAACAAAGCTCGAGTTATCAATGAGCATGACTGCGTAGTGTCCGTGGATTGATCGATTCTATAATCTCATTTCAATTGCATTTGTTATTGGGTGGCAGACGGTACTGTGCCTAGCAGTTTCCGGAGGAGTTGTGGAAATCGGCACTACTGCCTTGATCGATCAAAACCTGCAGCTGGTGCAGTTCGTGCGCAACATGTTCCAAAGAAGTTCGGGTACCCCAAAAGTACCGATCTCTCTTCTGAGCCACGAGCAGAATGACGACAACCGAGACAACGGGCTCTTGTTCAACGCGTCGTCGGCAACTGCAAAATTCTCATCTCCGGCGTCGACGAATCTGGGAATGTCGAACCCAGGCCTGCCAAACTCATCGGCTGGAAGAGGTCTGGGTTTGGCCCCGCCGTACCAACCGAACTTCTCCAACCCCGGTCCTCTTCAGCAGATCAATTCATTTGGATTGGACACGATATCGTTCGCTCCAAGTCTTTTGAATGGATTGATGCGAGAGCAGGGCCCGGAGCTGAATCTGCAACAAGCAGCTGCAGCAGCAGGGTCATGGGATCTGAGTCTAGAACAACAGCTGATGCAAGATCAGAACATGATACCGGCCAATCTCAAACACAAATTGACAGGGCCCACTTCTGCCCTCACAAAGTCAGGCTCGTGTGTGGCCTCCTTTGAGCAAGCTCTATTCCACCCGCATGCTCAACACATTCCACAGCGACGAGCACTGCCCGTGGAATCGACCGGGAAGCTGTTATCAGATTTCCAAGCTCAACTTTTTAACCAGTCTCAGCTACAGCAGCAGAGCAGTCTCATGCAGAACTCTGCGGAGACAGTGGTGAGCGATTCTCCTCATCATTCGCCTGTACCCGGCCAACCTTTGCCCGACTCCTTGAAACACGCCCATTCTCCAGATATCCACTGGCGAAGCGTCACACATTCCAAGGGAATTGGCTCTCCCCGAAGACTTCTGACGGTCGAGTCCGGCAAAGGTCTGGCCGAAGTGTCCAACATCGATGACCCCAGCTTGAAATGTCATCAGCTCGCCAGCCCCTCCGAGGAATCTCACCAGCACAACTTCACCGACTTGATTCCCCCCTCCAACCACGGCCACGGACAGCAGACTCAGTACTTGGCCGAGCTGACGGGCGAAGCGCACACCGGACAGTCGGCTGATCACTCGTGGTCCAGCGAGGCCATATCACCCACCATATCTGAGCAGGAGCAAGACCCGGAGGATGGCTACTCCCTCTGGGAAGATACGAGCGAGACATTGGAGAACGGAAGATTTTTAGGCGATTCATTCAAACATGACAGAAGCAAGAAAGCAAGACTGTGTGGCTTGAACATGAACGGCCACCATCAGAGCAATGGGACAGCAAACGGCATGGGCAGCTTCCTGGACCACCCTCACATGGATGAGAGAACGCGCCAAGAGAACGAGAAGTTTCAAGTTCTCAGAGCCATGCTTCAGCCACATGCCACTTGCAAGGTGAGTCAGTCCATTGCGTTCTGTCCCTCTGGACCGATCCATCAGAAGCTCAGTGCAATATATGCTTGCTCTGAATTCTAGCCGTCGGCATTTTGCTTCATGTGGCATGTAAATAAACTCCTGTGCCTAGTCTGCATACTGTCAGGCCCATCGCAAGATCAGCTGACAGCAATATCCCTGCGATATTTGCTTCTGCTTTCGTGTGGCAAGTAGTTCAAATCTGCATACTGACAGTATCAATACCCGAGTTACATCTCAGCAGACCAGGAATGGACTGCACATTTTCTGTCGGTTTTAATCCGAACCGGCGGTGTTCCGATTTCGTGTGGCATGCCGATGAAGTCCACTTCGCTGAGTTCAGCCAGACACACTAGTTTATGCCAGCTCATAAGTGGCAATCTCAAAGACTTTTTGGAGTTCCATCGACTATCTTGATCGTTACTCGTATTAACTTCAGGCTTGGATGCTATTTCAAATGCAGGGTGACAAGGCTACAGTTCTAGGCGATGCAATTGAGCACATGAGGGATTTGCAGAGGAGAGTGAAGGAGAGTGAATCCACAACCACCTCGTCGGCATCGGACGACGGGCAAAATCCCAGAAGTTTGGAAAGGAGTTCCAGTCTGACGACGAGTTTGGTGCAAGGGGTGAATCACGTCAACCTCAGGAGAGACTACGGCCACCGAGGCATCCGTCAACAGCAGTATGGTAGAAGCGGTGGAGGCGATAATGCTCCTCTCTTGAAGCTATCGGACGTATGCCTCGATACCAATGAGGAGCTCGATGGTGTGGTGCTGGCAGTTCTAGATGATATACCACAAATTGAAGTGCGAATGATGGAAAACGAGCGCGTGATGATCAAACTCAGCTCCAAAGACCGACCCAACCTCTTCACGGACATCATGTTTGCTCTGCAGGATTTGCATTTGCAAGTGCAGCACGCCAATATCCGTACGGTAGCCGGAATGGTGCATGACGTCTTTGCAGCCAAGGTGCGTGGTTGAGGCCCATAATCAATCTCTATATCGACTCCGTTAGTCCTAATCCTATACGATTTCTTATTAAGAAGGTGGTGACTTCATAAGCGCAGCATTTGATTGAAGTTGATTTGGTGCTTCTGATTGCCCTTCAACTGCCCTACCCTTTGCCACCAGAATAAGAACTTGTTCAAGTCTAGAAGATCTGAGGCAAAAAAGGTCGGAGTCGAAGGGTGTCTGATGGTTAATCATGCTGTGGGCACTTCGGTTTTGGGGCTGGTTCAGGTGGATGTGGCGCTATTAGAGAAGCAGTCGACGCACACCATAGCAGAGGCAATAAGGCGAGCCATCGAAAGAGGCAATTCTCCGAATTCGTGCTCACCGAATCCTGCGACTCCGGATGCCAACCCGAACGTCAACTCTCCTCGAAAGCGGTCTCTACAACTGACTTGACGGCCGGACCTTGCGTGTCTGTCTCACCGGAACATGCCTGTATCCACTGTGTAGTCAAATCCACTAACATAACAATTCACATGTGCAGAAGACCAGTCGGCGGTTCATTCTTGAAGAAAACCGCAACATTCTGGCTGGAGTTGGAAAGCTTGGCATCGGATCAGCAGCTCACGTCACCTCCATCTTCAACGCATGGTTTCTGTGTGTATAGAGAGGAGTGAGCTAGCAGCTGAGGAGCCGAGGAGTCATGAGATCAATTCGAAAGGTCGAATGTCTGATTCGATTCTCCACTTAAGACCTAGTAGCTGTTTGGAGCAAGGGTCTTTTGCGAGCACCCGTCTCCAGTGAGAAGCTGCCATGGCTTCCTTGAGCAACATTACTTTCTCACGAGAAGACCATGTGTATGAAATTGGAAGTCCAGCATCATAATCCTGTATCTTCATCATCAAAGTTACGTTAGTTGATCTTCTGGAAAACAACAATAGAAAGTTCTACTTTAAGTACACTCTGTTTGTGACTAGACTATGCTCAGGATGTGCCAGACCTAGTTTTCCACTTGCTTGTTCATCTCCCCCCCTACCCCACCCCACCCCAACCTCGGCTTCTTCTTCAGGCAGGAGAAGCTCGGAGCTTCTTCGGAACAAGCTTCTCTTTCTTCCCTGAGTTCTAGTTTATCTAAGATTAGATGGAGAGACCTCCGAGTTTCGTCTATTGCAGATGATGGCTGTCGCAGCAAGCATCCACCCGATGCGTGATTAGATTGCGAAGCCTTGCGAACTGGCCCGACTTGTGTACGAGATAACTTTGAGATTATTTGTAGAACTTCATCATCATCATCATCACCATGTAACTATCGTCCGGGATGAGAGCAAAGTATGTGACGTGTTGTAATGCTTTGCTTTGCCACTAGATGTTACAGTAGTGTCACATTGTAGCATTTGCGGAGGCCTCTTGTACATAACTGGAGCCGCTCATGACTACACCCAAGGGCTTTCATGCCAGAAGCCGAAGCTGATGTTGAGACTCCTGGTGCGGATTGCCACATCCATCAGTGCCTAGGAATGACGTAAAACATATACTCATGTGTAGCTGATTAGACGTAGGAGAGAGACTAGAGGCGGACCCTTCTGCGCGAGGGACAAAGGAGACGAACCGCATTGCTTAGACAGAAACATGAAATGTCACCGACTTGGCAAACTTAACAACTTTCCAAATTTC

mRNA

>Mapoly0098s0046.1
GCTGGGGCTGGCTGGTGCTGCTGATGTGGGAGAAAGAAAGGGAAGGGAAGGGAAGGAAAGGGGACGAAAGCAAAAAGGAAGGAGGACGGAAGGTAAAGGTCAACAGGCCAAAGCTACCTTCCTCAGCGACAACCTTTTCACCCTTTTCCCCCACAACAGTTGAACATCCTTTCGTACTGTTGTGACATCGCGCTAGCTCTCCCCTCGAGCAGGCGGGTGGGACGGATTGACTTGCTGCATGCGCAGGAGGATGGGATGTGTGGGTGTGGGTGGGGGGAAGAAGAGCAGAGAAGTAGGAAAGAAAAGTAACACAATGGAGGAACGGCAGTGCAGGGCAGGGAACGGGGAGACAAGGGAGGGCAGGTAAACTACTTCTGCTGCTGCTGCTGCTCTTGTTCTTAGTGAAGTGCAGACTTGGAGCATGAGTTTAAGAGGCGAATGTATTCTGACTGACACAAGGTACCGAAGGGGAGAAGAAGATTGGAGAAGTAGAACTGTGTCGACAGATATGGGGAGGGAAAAAATCTTGATGACGGTGGATTGATGGTGGGAAGGAGTGGGCCGCAGTTGTACAGGGCCGGAGACGAGACGTGAGAGAGTGAGTGAGTTCACACCTACTGATGATTTCGGGGTAAAGCGTGATGGAAAGCGCAAGCTTGGGGAGGAGCGCAGAAAGAGCTAGGAGGGTCAGCCGAGAGACCTCCACGTGAAAGTGGGCGGACCCGAGCCTGCGATCAGCTCCGAAACCTCACGAGGAGAAAGTAAGGAGGGAGGACAATGCAGGGGCGGATGTCCAGAGAACGTGAGATTTTGCAGGAAATTGTGGAGAGAATAGGATGGGTGTACGCAGGCCTATGGCAGCCCTTGCCACCGGATAACAGCTTGGTAGGATGGGCAGATGGATACTACAACGGACCTGTTTCGGAGAACTCGGAGGCACCGCTGCCGTCGAGCGCTCAATGGAATCAAAGAAAAGAGCGGAGGCGGATGGTGGAGGAGTTGCAATCAGTGCCAGACAGTCGTCTTACCGACCGGCCGGACCTCAGCAACATCGAGTGGTTCTACTTGATTTCGTCCAAGTTCGAATTTCCCTTCGGAACGGATGGGACACCCGGAAAAATGCTTATGACGGGTGGCTATGAATGGATCTGTGACGGCGAGGAAGTAAATGGGGCATTGTTTAGTCGCACAGCCTTATGCAAGGCAACAGGAATGAAGACGGTACTGTGCCTAGCAGTTTCCGGAGGAGTTGTGGAAATCGGCACTACTGCCTTGATCGATCAAAACCTGCAGCTGGTGCAGTTCGTGCGCAACATGTTCCAAAGAAGTTCGGGTACCCCAAAAGTACCGATCTCTCTTCTGAGCCACGAGCAGAATGACGACAACCGAGACAACGGGCTCTTGTTCAACGCGTCGTCGGCAACTGCAAAATTCTCATCTCCGGCGTCGACGAATCTGGGAATGTCGAACCCAGGCCTGCCAAACTCATCGGCTGGAAGAGGTCTGGGTTTGGCCCCGCCGTACCAACCGAACTTCTCCAACCCCGGTCCTCTTCAGCAGATCAATTCATTTGGATTGGACACGATATCGTTCGCTCCAAGTCTTTTGAATGGATTGATGCGAGAGCAGGGCCCGGAGCTGAATCTGCAACAAGCAGCTGCAGCAGCAGGGTCATGGGATCTGAGTCTAGAACAACAGCTGATGCAAGATCAGAACATGATACCGGCCAATCTCAAACACAAATTGACAGGGCCCACTTCTGCCCTCACAAAGTCAGGCTCGTGTGTGGCCTCCTTTGAGCAAGCTCTATTCCACCCGCATGCTCAACACATTCCACAGCGACGAGCACTGCCCGTGGAATCGACCGGGAAGCTGTTATCAGATTTCCAAGCTCAACTTTTTAACCAGTCTCAGCTACAGCAGCAGAGCAGTCTCATGCAGAACTCTGCGGAGACAGTGGTGAGCGATTCTCCTCATCATTCGCCTGTACCCGGCCAACCTTTGCCCGACTCCTTGAAACACGCCCATTCTCCAGATATCCACTGGCGAAGCGTCACACATTCCAAGGGAATTGGCTCTCCCCGAAGACTTCTGACGGTCGAGTCCGGCAAAGGTCTGGCCGAAGTGTCCAACATCGATGACCCCAGCTTGAAATGTCATCAGCTCGCCAGCCCCTCCGAGGAATCTCACCAGCACAACTTCACCGACTTGATTCCCCCCTCCAACCACGGCCACGGACAGCAGACTCAGTACTTGGCCGAGCTGACGGGCGAAGCGCACACCGGACAGTCGGCTGATCACTCGTGGTCCAGCGAGGCCATATCACCCACCATATCTGAGCAGGAGCAAGACCCGGAGGATGGCTACTCCCTCTGGGAAGATACGAGCGAGACATTGGAGAACGGAAGATTTTTAGGCGATTCATTCAAACATGACAGAAGCAAGAAAGCAAGACTGTGTGGCTTGAACATGAACGGCCACCATCAGAGCAATGGGACAGCAAACGGCATGGGCAGCTTCCTGGACCACCCTCACATGGATGAGAGAACGCGCCAAGAGAACGAGAAGTTTCAAGTTCTCAGAGCCATGCTTCAGCCACATGCCACTTGCAAGGGTGACAAGGCTACAGTTCTAGGCGATGCAATTGAGCACATGAGGGATTTGCAGAGGAGAGTGAAGGAGAGTGAATCCACAACCACCTCGTCGGCATCGGACGACGGGCAAAATCCCAGAAGTTTGGAAAGGAGTTCCAGTCTGACGACGAGTTTGGTGCAAGGGGTGAATCACGTCAACCTCAGGAGAGACTACGGCCACCGAGGCATCCGTCAACAGCAGTATGGTAGAAGCGGTGGAGGCGATAATGCTCCTCTCTTGAAGCTATCGGACGTATGCCTCGATACCAATGAGGAGCTCGATGGTGTGGTGCTGGCAGTTCTAGATGATATACCACAAATTGAAGTGCGAATGATGGAAAACGAGCGCGTGATGATCAAACTCAGCTCCAAAGACCGACCCAACCTCTTCACGGACATCATGTTTGCTCTGCAGGATTTGCATTTGCAAGTGCAGCACGCCAATATCCGTACGGTAGCCGGAATGGTGCATGACGTCTTTGCAGCCAAGGTGGATGTGGCGCTATTAGAGAAGCAGTCGACGCACACCATAGCAGAGGCAATAAGGCGAGCCATCGAAAGAGGCAATTCTCCGAATTCGTGCTCACCGAATCCTGCGACTCCGGATGCCAACCCGAACGTCAACTCTCCTCGAAAGCGGTCTCTACAACTGACTTGACGGCCGGACCTTGCGTGTCTGTCTCACCGGAACATGCCTGTATCCACTGTGTAGTCAAATCCACTAACATAACAATTCACATGTGCAGAAGACCAGTCGGCGGTTCATTCTTGAAGAAAACCGCAACATTCTGGCTGGAGTTGGAAAGCTTGGCATCGGATCAGCAGCTCACGTCACCTCCATCTTCAACGCATGGTTTCTGTGTGTATAGAGAGGAGTGAGCTAGCAGCTGAGGAGCCGAGGAGTCATGAGATCAATTCGAAAGGTCGAATGTCTGATTCGATTCTCCACTTAAGACCTAGTAGCTGTTTGGAGCAAGGGTCTTTTGCGAGCACCCGTCTCCAGTGAGAAGCTGCCATGGCTTCCTTGAGCAACATTACTTTCTCACGAGAAGACCATGTGTATGAAATTGGAAGTCCAGCATCATAATCCTGTATCTTCATCATCAAAGTTACGTTAGTTGATCTTCTGGAAAACAACAATAGAAAGTTCTACTTTAAGTACACTCTGTTTGTGACTAGACTATGCTCAGGATGTGCCAGACCTAGTTTTCCACTTGCTTGTTCATCTCCCCCCCTACCCCACCCCACCCCAACCTCGGCTTCTTCTTCAGGCAGGAGAAGCTCGGAGCTTCTTCGGAACAAGCTTCTCTTTCTTCCCTGAGTTCTAGTTTATCTAAGATTAGATGGAGAGACCTCCGAGTTTCGTCTATTGCAGATGATGGCTGTCGCAGCAAGCATCCACCCGATGCGTGATTAGATTGCGAAGCCTTGCGAACTGGCCCGACTTGTGTACGAGATAACTTTGAGATTATTTGTAGAACTTCATCATCATCATCATCACCATGTAACTATCGTCCGGGATGAGAGCAAAGTATGTGACGTGTTGTAATGCTTTGCTTTGCCACTAGATGTTACAGTAGTGTCACATTGTAGCATTTGCGGAGGCCTCTTGTACATAACTGGAGCCGCTCATGACTACACCCAAGGGCTTTCATGCCAGAAGCCGAAGCTGATGTTGAGACTCCTGGTGCGGATTGCCACATCCATCAGTGCCTAGGAATGACGTAAAACATATACTCATGTGTAGCTGATTAGACGTAGGAGAGAGACTAGAGGCGGACCCTTCTGCGCGAGGGACAAAGGAGACGAACCGCATTGCTTAGACAGAAACATGAAATGTCACCGACTTGGCAAACTTAACAACTTTCCAAATTTC

CDS

>Mapoly0098s0046.1
ATGCAGGGGCGGATGTCCAGAGAACGTGAGATTTTGCAGGAAATTGTGGAGAGAATAGGATGGGTGTACGCAGGCCTATGGCAGCCCTTGCCACCGGATAACAGCTTGGTAGGATGGGCAGATGGATACTACAACGGACCTGTTTCGGAGAACTCGGAGGCACCGCTGCCGTCGAGCGCTCAATGGAATCAAAGAAAAGAGCGGAGGCGGATGGTGGAGGAGTTGCAATCAGTGCCAGACAGTCGTCTTACCGACCGGCCGGACCTCAGCAACATCGAGTGGTTCTACTTGATTTCGTCCAAGTTCGAATTTCCCTTCGGAACGGATGGGACACCCGGAAAAATGCTTATGACGGGTGGCTATGAATGGATCTGTGACGGCGAGGAAGTAAATGGGGCATTGTTTAGTCGCACAGCCTTATGCAAGGCAACAGGAATGAAGACGGTACTGTGCCTAGCAGTTTCCGGAGGAGTTGTGGAAATCGGCACTACTGCCTTGATCGATCAAAACCTGCAGCTGGTGCAGTTCGTGCGCAACATGTTCCAAAGAAGTTCGGGTACCCCAAAAGTACCGATCTCTCTTCTGAGCCACGAGCAGAATGACGACAACCGAGACAACGGGCTCTTGTTCAACGCGTCGTCGGCAACTGCAAAATTCTCATCTCCGGCGTCGACGAATCTGGGAATGTCGAACCCAGGCCTGCCAAACTCATCGGCTGGAAGAGGTCTGGGTTTGGCCCCGCCGTACCAACCGAACTTCTCCAACCCCGGTCCTCTTCAGCAGATCAATTCATTTGGATTGGACACGATATCGTTCGCTCCAAGTCTTTTGAATGGATTGATGCGAGAGCAGGGCCCGGAGCTGAATCTGCAACAAGCAGCTGCAGCAGCAGGGTCATGGGATCTGAGTCTAGAACAACAGCTGATGCAAGATCAGAACATGATACCGGCCAATCTCAAACACAAATTGACAGGGCCCACTTCTGCCCTCACAAAGTCAGGCTCGTGTGTGGCCTCCTTTGAGCAAGCTCTATTCCACCCGCATGCTCAACACATTCCACAGCGACGAGCACTGCCCGTGGAATCGACCGGGAAGCTGTTATCAGATTTCCAAGCTCAACTTTTTAACCAGTCTCAGCTACAGCAGCAGAGCAGTCTCATGCAGAACTCTGCGGAGACAGTGGTGAGCGATTCTCCTCATCATTCGCCTGTACCCGGCCAACCTTTGCCCGACTCCTTGAAACACGCCCATTCTCCAGATATCCACTGGCGAAGCGTCACACATTCCAAGGGAATTGGCTCTCCCCGAAGACTTCTGACGGTCGAGTCCGGCAAAGGTCTGGCCGAAGTGTCCAACATCGATGACCCCAGCTTGAAATGTCATCAGCTCGCCAGCCCCTCCGAGGAATCTCACCAGCACAACTTCACCGACTTGATTCCCCCCTCCAACCACGGCCACGGACAGCAGACTCAGTACTTGGCCGAGCTGACGGGCGAAGCGCACACCGGACAGTCGGCTGATCACTCGTGGTCCAGCGAGGCCATATCACCCACCATATCTGAGCAGGAGCAAGACCCGGAGGATGGCTACTCCCTCTGGGAAGATACGAGCGAGACATTGGAGAACGGAAGATTTTTAGGCGATTCATTCAAACATGACAGAAGCAAGAAAGCAAGACTGTGTGGCTTGAACATGAACGGCCACCATCAGAGCAATGGGACAGCAAACGGCATGGGCAGCTTCCTGGACCACCCTCACATGGATGAGAGAACGCGCCAAGAGAACGAGAAGTTTCAAGTTCTCAGAGCCATGCTTCAGCCACATGCCACTTGCAAGGGTGACAAGGCTACAGTTCTAGGCGATGCAATTGAGCACATGAGGGATTTGCAGAGGAGAGTGAAGGAGAGTGAATCCACAACCACCTCGTCGGCATCGGACGACGGGCAAAATCCCAGAAGTTTGGAAAGGAGTTCCAGTCTGACGACGAGTTTGGTGCAAGGGGTGAATCACGTCAACCTCAGGAGAGACTACGGCCACCGAGGCATCCGTCAACAGCAGTATGGTAGAAGCGGTGGAGGCGATAATGCTCCTCTCTTGAAGCTATCGGACGTATGCCTCGATACCAATGAGGAGCTCGATGGTGTGGTGCTGGCAGTTCTAGATGATATACCACAAATTGAAGTGCGAATGATGGAAAACGAGCGCGTGATGATCAAACTCAGCTCCAAAGACCGACCCAACCTCTTCACGGACATCATGTTTGCTCTGCAGGATTTGCATTTGCAAGTGCAGCACGCCAATATCCGTACGGTAGCCGGAATGGTGCATGACGTCTTTGCAGCCAAGGTGGATGTGGCGCTATTAGAGAAGCAGTCGACGCACACCATAGCAGAGGCAATAAGGCGAGCCATCGAAAGAGGCAATTCTCCGAATTCGTGCTCACCGAATCCTGCGACTCCGGATGCCAACCCGAACGTCAACTCTCCTCGAAAGCGGTCTCTACAACTGACTTGA

Protein

>Mapoly0098s0046.1
MQGRMSREREILQEIVERIGWVYAGLWQPLPPDNSLVGWADGYYNGPVSENSEAPLPSSAQWNQRKERRRMVEELQSVPDSRLTDRPDLSNIEWFYLISSKFEFPFGTDGTPGKMLMTGGYEWICDGEEVNGALFSRTALCKATGMKTVLCLAVSGGVVEIGTTALIDQNLQLVQFVRNMFQRSSGTPKVPISLLSHEQNDDNRDNGLLFNASSATAKFSSPASTNLGMSNPGLPNSSAGRGLGLAPPYQPNFSNPGPLQQINSFGLDTISFAPSLLNGLMREQGPELNLQQAAAAAGSWDLSLEQQLMQDQNMIPANLKHKLTGPTSALTKSGSCVASFEQALFHPHAQHIPQRRALPVESTGKLLSDFQAQLFNQSQLQQQSSLMQNSAETVVSDSPHHSPVPGQPLPDSLKHAHSPDIHWRSVTHSKGIGSPRRLLTVESGKGLAEVSNIDDPSLKCHQLASPSEESHQHNFTDLIPPSNHGHGQQTQYLAELTGEAHTGQSADHSWSSEAISPTISEQEQDPEDGYSLWEDTSETLENGRFLGDSFKHDRSKKARLCGLNMNGHHQSNGTANGMGSFLDHPHMDERTRQENEKFQVLRAMLQPHATCKGDKATVLGDAIEHMRDLQRRVKESESTTTSSASDDGQNPRSLERSSSLTTSLVQGVNHVNLRRDYGHRGIRQQQYGRSGGGDNAPLLKLSDVCLDTNEELDGVVLAVLDDIPQIEVRMMENERVMIKLSSKDRPNLFTDIMFALQDLHLQVQHANIRTVAGMVHDVFAAKVDVALLEKQSTHTIAEAIRRAIERGNSPNSCSPNPATPDANPNVNSPRKRSLQLT

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>