Mapoly0100s0033



Description

CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_156343
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR23042 CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH41 transcription factor, bHLH Mapoly0100s0033.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0100s0033.1 scaffold_100:358730..362968  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0100s0033.1  

Gene structure:

mRNA scaffold_100:358730..362968  ( + strand )
five_prime_UTR scaffold_100:358730..359175  ( + strand )
five_prime_UTR scaffold_100:360240..360293  ( + strand )
CDS scaffold_100:360294..360350  ( + strand )
CDS scaffold_100:360466..361320  ( + strand )
CDS scaffold_100:361489..361863  ( + strand )
CDS scaffold_100:361985..362056  ( + strand )
three_prime_UTR scaffold_100:362057..362968  ( + strand )

Sequences:

Gene

>Mapoly0100s0033.1
AAAACAGGACGACGTGGTGGTGCTGCAGCAGGATCCGGCCCCTCCGCACTCCGCTGCGGCCTACCACCATCACTGTGGACGCGCAGCGCAGGGGGCCGGGGCTCGGCCTACATTACGCTTTTGCGCATCCATCCGTCTAGGCATTTGCTCTCTCTCCCCGACTCTCACTCGCGCTCTTCTCCGCGCTCGCTCTCGTCGCCACCACCACCGCCTCTCCTCTGCACCCCCTCAGTTTCTTCTCCTCTGCTCTATCTCCCTCGTGTTCCACCTCCGGTGGACTGCCAATTCGCCACTGGCCTCGTCTGTGTCAATCGAGGAAGAATAGAGCAGAAGGAGAAAGAGAGTGAGACGGTTGATTGGATTTGGTCTGGATGGTCTGTGGACTGCGGGGTTCTCGCCTCTGAGGCGCTACGGACTTGAGATGCGGTCACGCTCGTGGATACTAGGTGTGTGCTCAACTCCCAACTCCCGCACTTCATCGCACTGCACTGCACTGCTCTGCACTTCGCTCCGGTTATTTATGCGTGCACGGGAGGCTCCGTCGTAGGGACAAGGATAGGCTATGGTAGCGCAGCGAGCGAGGACGTGCTGGCTTTGGTTGGGTCGGTCTGGTTTGGCTTGGCTTGTTCAGTTCTCGACCCTCGGGCTCAGCGTTTAGTTCACAGTATCACCTGATTAAGACCTCACGCACGAAAGGGCCCAACTGCTCTGCAGCCGAGCGCTTCGGCATCAGTTCACGATTCGACCCCCGTGTGCAATTCATTTTCAGGCAGCGTTCCATTGCGTCAGCTACGGCTCGAGGGAACAGCGACGGTTTAGTACTGTGACGAGATGAGCGTGCACTGTGGGAGCAATTGCATCCCAGACCACCGGTTCACGAGATGTGGACTTCTTCTCACACACCCAACTGCCACTTAAGACACAAGCTGTAGAACGTACTTTGCGCCTGCCTGGCCTCAGCTTACCTGGTGGTTGTGTCGAGCACCACCTGCATCTTTCAGCCCATGGGGAACTCAACCGATCTGAGAATGTGTGTTATCGTCACGTCACGAAAGATGTCGGTCAGTCTGCCGAAATGCGAGTATGGCCGAGTAGTATTCGTCAGCGCAGAGCTGGAGAATGATGCACTCTTCTTCCGTGCTGCAGTGCTCCCCCCACCCTGTAAATTGCTCTCCATTTCTCCTGACGGGCTCTTGGGAGGCCCGTCGCTGCCCCCTGCTTGCCCACGCCGATTGCAGTCGAGCCGTATCCCTCGTCCGCCCCGAGGCATTGACGCCCCCGGCTCTCCGCCCATGGCTCCGGGTCTCGGAATGCCTTTTGGAAACTCCTACTTTTCCGGGCCGATATCGACGCGTCTGTAATTACTCTCGCTTGACTACCGGAGGGCTGGGGTTCAGAAGCCCTGGGGTCCATTTGTCGTCTTGCATTGCTGCCGAGTACGGCTCGAGTCAGGCCCCGTCGTGGCATGCGGATGCGGATGCGGTTTCTAAACTGTGGCTTGGCACTGCAGGTCCCCCTCTGTAGCACTCAAAGGTCGAGCATTTCGTCAGTCTTACGGTATAATATGGAAGTGGTATCAACCCCGGCAGGAAACGGCGCAAAACAGTGGCTATCTGAACTGGTACGTGCTCCTCCTCATGCTGAATGGGGCTGGAATGTGAGAGAGAGAGAGATGATAGGAGGCTTCGATTGCAGTGCAGCTGGGGCCAGTGACTGACGCTCGTGTTGCGATGCAGGGCTTGGAGGAACCATCGCTAGTTAGGCATTTGGACAGTCTTTTCCTCCCGACATCGAACCAATATCAATCCGTCAAGGGCTACAACAATCTGAATTCTTACGACCTCGGCGGGTCCTTCTTGAACGTGAAGCAGAGAGACGCTTCGCCCGTCACCATGAACAACACCTTCACCTCCACGGGGTACTCGTCCCAGTGGGACGCCCTGCTCAACAACGAACGCCCGGCCAAAATGCCCAAAACGATCTCATGGGATGGCTCTTTCTCGAACCAGGGCATGGGCAATTCCCTCACGCACCAGCCCCTGCTGCCGCTGATCTTCAGTCACAAACAGCAGCAGCAGCACCACGAACCCCAAATCCAGCATCAGCAGCAGCACCACCAGCACCAGCACAACCACATGAACCAGTTCTTCTCCCCCCAGCAGCAGCTCTGCCAAGGCATTGACGGCTTCGTGGCCTCGCTTCCCAAGCTCTCAGATGATTTGCACGACTCCGTAGCCCCGCGAACCCCGACCATGGAAATCGGGGGCTCCCAGGTTCTAGGCGGAGGAGCACAGGACACTTGCAACAGCGACGTGCACTCCGTCGAGGCTATGAGCATGAGCTCCACTTGCAACCGCGACTCGTCACCGATTGCCGACTCGTTCAGGGGCAAGAGGAAGCCGGAGTTTTTCCCCTCTCCCACCGACATGAGGGTTCAGAGGCCTCCTCCCATGGCCACCACCCGAGCTCCCTCTCCCCCGAGCAAGGCTACCGGCCACACCCAGGACCATATTATGGCCGAACGCAAGCGTCGCGAGAAGCTCAGCCAGCGGTTCATCGCCTTGTCCGCCATTGTTCCCGGTCTGAAGAAGGTACTTACTTCATTCCATGGCTTGCAATAGTTCTATGTGGTGGTGCCCATAGGCCGCTTGTTTGCGAGATGGATTCCATCTCGTTGACAGTTTGCGAAGCTCGAATTGTTGTGGGAGTAGGGTTCTACTTTACTCGAGGCTTGACGCTCGAAGCCCTGCTTGCTGCAGATGGACAAGGCATCCGTTCTCGGAGATGCCATCAAGTACGTGAAGTCGCTGCAAGATCGAGTGCAGAAACTCGAGGAGCAGGCCCCGAAGAAGAATGTGAGCTCGATTGCCGTGGTCAAGAACGGCAAGGACAGCAAGGGGTCTGGATCCGACGGCGAGACGGGAGCTGAGTCCGAGGTGGTGGAAAGCGGAGAGACTCCGGACATCGAGGCCAGAGTCAACGACAAGAACGTGCTCATCAAAATGCACTGCGAAATGAAGATTGGCAGCGTTGCCAAGTGCATCTCCGAGCTGGAGAAGCTGCACTTGATCGTCTTGAACGCCAATATCCTGTCTTTCACCAACACATCCGTGGATCTCACTCTGTCTGCTCAGGTTAGGCCTCCTCTACTGTTCTCTCAGTCTTTCGTTGCCTTATCTGATATTATATTGTTCTCGGGAATGTCTATCTCCTAAGCATTGTGCTCTAACTGTGTGTTTCTATCGTGACTTACAGACGGAGGACGGTCACGAAGTCACTGCCGATGAGATTGTGGCTGCCCTGCAGAGTTTTTTCAAGACGTTGTAACAAGGAACCTCGTGCGAGAGTTCATCCGACAGCGACAAAATATCGATGATGATGATACGAAACCAAACGAAACATTTTTGGAGTCGCTCGAGCGTTGACATGCATCGCTCGGGAGGGCGGCACCATTTTCAGTCACTTGTATATGTACAGACATAAGGAGGATATGTGTATCTAGCTAGCTAGTTAGCTGCTGCTGCTGCAGAAGGTTTGTGCACTGCTGCTGCGCGCGCGCGCTCACATCAAAGTCGTGAAAGTTACCCGTTACCGCCATCGCCGGGAGGGGACTCGCCGTCGGCCGGCCATGTCGCCTGCTTGCACCTGTTACCAGGTTTTTGCCAATCTCTATTTGGCGTCCTGCAAGCTCGGGGCATCCGTCCATCGACGCGTCTCGTCTAGTATTACCCTTTCTCTTCCCCACTCGTTTTTTTGAAGAGGGCTGGTGTCTAGCACAGCCTCTTTTCTCAGCCAGTGTGGTGGATTGTGGTTCTTTTTAGCTCTCGTGTCTGTCAGAAGCTTGGTCCTTCCAAATCCTTTAGTGTCGGGACAAATTTCACATCATCTGCTCGTAGTTGAGGTTAGGCTCGAGTCATTGGTGGTCACCAGGCTTTTTTTGCGGAGCCAAAGTTGCTCTGTTCCAGCCCCATGGGGACTTATCCAGCTCCTGCTGCCTGAGCTCTAAGCAGGTTTTTCCGGGTTGCATGACCCTTGTTTTCGCCGATACTTTTATTTTTAAAGGCGTTCTTAGAATTGGAAGCGACCCATATCGAGGTGTCACACAAGAGAGCTAGAACATTGAATCCTTTGTTTAGTAGAAGGATGTTTTACCCTTTGATGGTCTGTAGTACTTCGCATCCTAATTAAACGTATTCACATATGTTTCTGAATAATTTTACACTTTCTCCACTTGTACGA

mRNA

>Mapoly0100s0033.1
AAAACAGGACGACGTGGTGGTGCTGCAGCAGGATCCGGCCCCTCCGCACTCCGCTGCGGCCTACCACCATCACTGTGGACGCGCAGCGCAGGGGGCCGGGGCTCGGCCTACATTACGCTTTTGCGCATCCATCCGTCTAGGCATTTGCTCTCTCTCCCCGACTCTCACTCGCGCTCTTCTCCGCGCTCGCTCTCGTCGCCACCACCACCGCCTCTCCTCTGCACCCCCTCAGTTTCTTCTCCTCTGCTCTATCTCCCTCGTGTTCCACCTCCGGTGGACTGCCAATTCGCCACTGGCCTCGTCTGTGTCAATCGAGGAAGAATAGAGCAGAAGGAGAAAGAGAGTGAGACGGTTGATTGGATTTGGTCTGGATGGTCTGTGGACTGCGGGGTTCTCGCCTCTGAGGCGCTACGGACTTGAGATGCGGTCACGCTCGTGGATACTAGGTCCCCCTCTGTAGCACTCAAAGGTCGAGCATTTCGTCAGTCTTACGGTATAATATGGAAGTGGTATCAACCCCGGCAGGAAACGGCGCAAAACAGTGGCTATCTGAACTGGGCTTGGAGGAACCATCGCTAGTTAGGCATTTGGACAGTCTTTTCCTCCCGACATCGAACCAATATCAATCCGTCAAGGGCTACAACAATCTGAATTCTTACGACCTCGGCGGGTCCTTCTTGAACGTGAAGCAGAGAGACGCTTCGCCCGTCACCATGAACAACACCTTCACCTCCACGGGGTACTCGTCCCAGTGGGACGCCCTGCTCAACAACGAACGCCCGGCCAAAATGCCCAAAACGATCTCATGGGATGGCTCTTTCTCGAACCAGGGCATGGGCAATTCCCTCACGCACCAGCCCCTGCTGCCGCTGATCTTCAGTCACAAACAGCAGCAGCAGCACCACGAACCCCAAATCCAGCATCAGCAGCAGCACCACCAGCACCAGCACAACCACATGAACCAGTTCTTCTCCCCCCAGCAGCAGCTCTGCCAAGGCATTGACGGCTTCGTGGCCTCGCTTCCCAAGCTCTCAGATGATTTGCACGACTCCGTAGCCCCGCGAACCCCGACCATGGAAATCGGGGGCTCCCAGGTTCTAGGCGGAGGAGCACAGGACACTTGCAACAGCGACGTGCACTCCGTCGAGGCTATGAGCATGAGCTCCACTTGCAACCGCGACTCGTCACCGATTGCCGACTCGTTCAGGGGCAAGAGGAAGCCGGAGTTTTTCCCCTCTCCCACCGACATGAGGGTTCAGAGGCCTCCTCCCATGGCCACCACCCGAGCTCCCTCTCCCCCGAGCAAGGCTACCGGCCACACCCAGGACCATATTATGGCCGAACGCAAGCGTCGCGAGAAGCTCAGCCAGCGGTTCATCGCCTTGTCCGCCATTGTTCCCGGTCTGAAGAAGATGGACAAGGCATCCGTTCTCGGAGATGCCATCAAGTACGTGAAGTCGCTGCAAGATCGAGTGCAGAAACTCGAGGAGCAGGCCCCGAAGAAGAATGTGAGCTCGATTGCCGTGGTCAAGAACGGCAAGGACAGCAAGGGGTCTGGATCCGACGGCGAGACGGGAGCTGAGTCCGAGGTGGTGGAAAGCGGAGAGACTCCGGACATCGAGGCCAGAGTCAACGACAAGAACGTGCTCATCAAAATGCACTGCGAAATGAAGATTGGCAGCGTTGCCAAGTGCATCTCCGAGCTGGAGAAGCTGCACTTGATCGTCTTGAACGCCAATATCCTGTCTTTCACCAACACATCCGTGGATCTCACTCTGTCTGCTCAGACGGAGGACGGTCACGAAGTCACTGCCGATGAGATTGTGGCTGCCCTGCAGAGTTTTTTCAAGACGTTGTAACAAGGAACCTCGTGCGAGAGTTCATCCGACAGCGACAAAATATCGATGATGATGATACGAAACCAAACGAAACATTTTTGGAGTCGCTCGAGCGTTGACATGCATCGCTCGGGAGGGCGGCACCATTTTCAGTCACTTGTATATGTACAGACATAAGGAGGATATGTGTATCTAGCTAGCTAGTTAGCTGCTGCTGCTGCAGAAGGTTTGTGCACTGCTGCTGCGCGCGCGCGCTCACATCAAAGTCGTGAAAGTTACCCGTTACCGCCATCGCCGGGAGGGGACTCGCCGTCGGCCGGCCATGTCGCCTGCTTGCACCTGTTACCAGGTTTTTGCCAATCTCTATTTGGCGTCCTGCAAGCTCGGGGCATCCGTCCATCGACGCGTCTCGTCTAGTATTACCCTTTCTCTTCCCCACTCGTTTTTTTGAAGAGGGCTGGTGTCTAGCACAGCCTCTTTTCTCAGCCAGTGTGGTGGATTGTGGTTCTTTTTAGCTCTCGTGTCTGTCAGAAGCTTGGTCCTTCCAAATCCTTTAGTGTCGGGACAAATTTCACATCATCTGCTCGTAGTTGAGGTTAGGCTCGAGTCATTGGTGGTCACCAGGCTTTTTTTGCGGAGCCAAAGTTGCTCTGTTCCAGCCCCATGGGGACTTATCCAGCTCCTGCTGCCTGAGCTCTAAGCAGGTTTTTCCGGGTTGCATGACCCTTGTTTTCGCCGATACTTTTATTTTTAAAGGCGTTCTTAGAATTGGAAGCGACCCATATCGAGGTGTCACACAAGAGAGCTAGAACATTGAATCCTTTGTTTAGTAGAAGGATGTTTTACCCTTTGATGGTCTGTAGTACTTCGCATCCTAATTAAACGTATTCACATATGTTTCTGAATAATTTTACACTTTCTCCACTTGTACGA

CDS

>Mapoly0100s0033.1
ATGGAAGTGGTATCAACCCCGGCAGGAAACGGCGCAAAACAGTGGCTATCTGAACTGGGCTTGGAGGAACCATCGCTAGTTAGGCATTTGGACAGTCTTTTCCTCCCGACATCGAACCAATATCAATCCGTCAAGGGCTACAACAATCTGAATTCTTACGACCTCGGCGGGTCCTTCTTGAACGTGAAGCAGAGAGACGCTTCGCCCGTCACCATGAACAACACCTTCACCTCCACGGGGTACTCGTCCCAGTGGGACGCCCTGCTCAACAACGAACGCCCGGCCAAAATGCCCAAAACGATCTCATGGGATGGCTCTTTCTCGAACCAGGGCATGGGCAATTCCCTCACGCACCAGCCCCTGCTGCCGCTGATCTTCAGTCACAAACAGCAGCAGCAGCACCACGAACCCCAAATCCAGCATCAGCAGCAGCACCACCAGCACCAGCACAACCACATGAACCAGTTCTTCTCCCCCCAGCAGCAGCTCTGCCAAGGCATTGACGGCTTCGTGGCCTCGCTTCCCAAGCTCTCAGATGATTTGCACGACTCCGTAGCCCCGCGAACCCCGACCATGGAAATCGGGGGCTCCCAGGTTCTAGGCGGAGGAGCACAGGACACTTGCAACAGCGACGTGCACTCCGTCGAGGCTATGAGCATGAGCTCCACTTGCAACCGCGACTCGTCACCGATTGCCGACTCGTTCAGGGGCAAGAGGAAGCCGGAGTTTTTCCCCTCTCCCACCGACATGAGGGTTCAGAGGCCTCCTCCCATGGCCACCACCCGAGCTCCCTCTCCCCCGAGCAAGGCTACCGGCCACACCCAGGACCATATTATGGCCGAACGCAAGCGTCGCGAGAAGCTCAGCCAGCGGTTCATCGCCTTGTCCGCCATTGTTCCCGGTCTGAAGAAGATGGACAAGGCATCCGTTCTCGGAGATGCCATCAAGTACGTGAAGTCGCTGCAAGATCGAGTGCAGAAACTCGAGGAGCAGGCCCCGAAGAAGAATGTGAGCTCGATTGCCGTGGTCAAGAACGGCAAGGACAGCAAGGGGTCTGGATCCGACGGCGAGACGGGAGCTGAGTCCGAGGTGGTGGAAAGCGGAGAGACTCCGGACATCGAGGCCAGAGTCAACGACAAGAACGTGCTCATCAAAATGCACTGCGAAATGAAGATTGGCAGCGTTGCCAAGTGCATCTCCGAGCTGGAGAAGCTGCACTTGATCGTCTTGAACGCCAATATCCTGTCTTTCACCAACACATCCGTGGATCTCACTCTGTCTGCTCAGACGGAGGACGGTCACGAAGTCACTGCCGATGAGATTGTGGCTGCCCTGCAGAGTTTTTTCAAGACGTTGTAA

Protein

>Mapoly0100s0033.1
MEVVSTPAGNGAKQWLSELGLEEPSLVRHLDSLFLPTSNQYQSVKGYNNLNSYDLGGSFLNVKQRDASPVTMNNTFTSTGYSSQWDALLNNERPAKMPKTISWDGSFSNQGMGNSLTHQPLLPLIFSHKQQQQHHEPQIQHQQQHHQHQHNHMNQFFSPQQQLCQGIDGFVASLPKLSDDLHDSVAPRTPTMEIGGSQVLGGGAQDTCNSDVHSVEAMSMSSTCNRDSSPIADSFRGKRKPEFFPSPTDMRVQRPPPMATTRAPSPPSKATGHTQDHIMAERKRREKLSQRFIALSAIVPGLKKMDKASVLGDAIKYVKSLQDRVQKLEEQAPKKNVSSIAVVKNGKDSKGSGSDGETGAESEVVESGETPDIEARVNDKNVLIKMHCEMKIGSVAKCISELEKLHLIVLNANILSFTNTSVDLTLSAQTEDGHEVTADEIVAALQSFFKTL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>