Mapoly0107s0048



Description

auxin influx carrier (AUX1 LAX family)

Reference DB

Database ID Description
KEGGORTH K13946 Auxin influx carrier (AUX1 LAX family)
KOG KOG1303 Amino acid transporters
OrthoMCL OG5_137951
PFAM PF01490 Transmembrane amino acid transporter protein
PANTHER PTHR22950 AMINO ACID TRANSPORTER
PANTHER PTHR22950:SF3 AUX1-LIKE AMINO ACID PERMEASE

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAUX1 Encodes auxin influx transporter Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0107s0048.1 scaffold_107:556965..561764  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0107s0048.1  

Gene structure:

mRNA scaffold_107:556965..561764  ( + strand )
five_prime_UTR scaffold_107:556965..557655  ( + strand )
five_prime_UTR scaffold_107:558142..558236  ( + strand )
CDS scaffold_107:558237..558437  ( + strand )
CDS scaffold_107:559426..559611  ( + strand )
CDS scaffold_107:559779..559891  ( + strand )
CDS scaffold_107:560045..560228  ( + strand )
CDS scaffold_107:560361..560458  ( + strand )
CDS scaffold_107:560635..560842  ( + strand )
CDS scaffold_107:560954..561211  ( + strand )
CDS scaffold_107:561493..561717  ( + strand )
three_prime_UTR scaffold_107:561718..561764  ( + strand )

Sequences:

Gene

>Mapoly0107s0048.1
GGGTCGGGGACACTGAGGGTGAGTTAAAGTGAGTGAGTGCGCGAGCTAGCTCGCAGGCCTGAACCCTGCTGGCGGTGCAGTCAGGCCTTTAAAGCCTTCTGATGAGAAATTCACTTTGGAGTTCTCAGCTCAGCTCAGTAGCTCGGCCCGTCCCAGCTCCTCTCCTCGCATCCCGTTCCATCCCATCTCGTCTGGTTTTGGTTCCCACTCCGCTGCGCTGCAGTCAGAGCTCCAAGTCCCCACTCATTCCCATCTCCCACCCTCGGATTGAAGCTCTAGGAGCTAGACGACCACCACCCAGCTCGGACTCGATGAGAGAGTAGTTTAAGGAGGAATAGAAGAAGCATCAGCAGCAGCAGCAGCTCGAGCTGTTGCGGCCAATGCGGGCTTGTAGCCGTGATAGCCAGACTATCCCATCTAACTATGTCCTTGAGGTGTGAGGAAACACATGTGGGCGGAGTCGTATGCCTTTGACACTGTGTGCAGCAGCCACCGAGCCATTTGTGCATGTTACGGATTTCCAGGCCCATTGGAACGCATGGTGTGACTGATCCTGGACTCACCGAGAGACCGAGAGGGAGACAGTTTACATGTGTGAGTGATTGATTGAGTTTCACGTACATCGAAATGAGTCGTATCGGAGAAGGAGTATGAGAATCGAGCTCGAGGAGAAGATTGCAGACCAGACCAGGTGCTTACGAACTTCTCTGAGCTCGAGTGCTCGAGAGTGAGTGACAGACAGGTTGTTGTACATGTGAGTGAGTGCATATGAGATCCGCGTGGTAGCTGCATGTTTTTAGAGCTGTGCCCTGCACGAACCTGACGTCCGTGTGTCGAGCTTTTCGCGTATCTGGGAGGACCGAGCGAGTGAGGGAGAATCAACTGAGACCCGTACGCGGCTGATTCTGCGCAATTCCTACCCGTGGGCATGACTAGACTCTGATTGTCCGTCTGTCTCTTACTCAATGAGTGCATTGCAGCTCAGATTGGTAGCCAGTCCGATTTCTGATTTTATATTCGCCAGGCTCCAACTTTTGGAAGGTCACGGACAACCCTCCTCCTTGCGGAAGGAAAGCTGTCCTTTAATATCTCGTCACCGACCCTGTTGCTTTTCCACCTTTTTTCACAGTGTTTCACGAGTGAGCCCCGTTTGATGGATGTGTGCTCGTTTCCGCAGAAAGCTTCCGTGCATCGGGTCCGAAGAATCTGTCGAGCTGAGACAGTGAGGAGTCGAGCCGAAGGTTTCCCCGGGCGAGTACTCGAAAGGAGGAGATGGCACCTACGAAGACGGGGTCCCTCGGGGGCAGTGATACGGATGGCATTGTGGGCAGCTACGGCGAGATGCAGGAACAGCACCAGAAGATTGAGCAGCTCGAAAACGACGAGCAGCTTACTATTGGTGGCCGAGCCAAGGACTTGCTCTGGCATGGTGGATCTGCCACCGACGCCTGGTTCAGTGCAGCCTCCAACCAGGTCCTTTTCCCCTCGCTGCTGTCGGTGCAATTTTCTATCGAGCTGTGTGCTTTGTTCATTTTTTAGCTTCCCCACAATCCGCGCAGCCTCAATCCCCGAGCAGAAACTCGTGTCAGCGCGGCCCTCTCTTTCTCTCTCCCCCTCTCTCTTGGTTCACGCGGAGCACGAGCGCAACTTTCATTCCGAGAGAACGTGCCGCGAGATAGTTGTGATGGCTTGAATTCTGCGCGCTGGATGGCACTCGATGTTGTACTCCTTGCGGCTTACAGCGTTTTCCTTTCAGTGCCCTTCCTTCCTGTCACAGAGTTCCTTCGATCATTCGTCCTTTTCAGGGAAACGCATTTGATTCTCCATCGAGCTGGTATTTCCCTGAAAATTTACGCTCCTTCTCGAAAACAGTAATTTGTGTCCGCGAGTGATACGACAGCGGTTCAATGAGTTAGGCAGCAGGTGATGTGGGCTCAGCTCGTACGTCGAAGAGCGAGGCCAGGCGAATGGTCTCACATGAGCGACGCTTTTCATCATGGGAACAGTCCATGGGAACCTGAATTGTTGAACTGCTCTGCTTTCCAGTTTCGCTTTCAGATTAGAAAATGCGAGCTTTACATCGTGAGCAGTGGTCTTTCGGTCCAAGGCCATTGACTCCAGTCGTCCGGTCTTCCAGTCTCCTCCAGGGGTGCTGCGACCTTGAGCCTTCCAAGGGGGGCATTAGTTGCGTCTTCTCAGAGGGTTTTCTCTATTGGAGAAGAACACTCTTGTTCTTCGGAGGTGCGATTTCTAATTATAGCTTAAAAGTGAGGCCCCTGTCTGAAGTACTCGGACTGTCCGTAAGCAGATGACGCTTCGTCTGGTTGGTGCTGCTTTGTCGAGTATGTGTAGGAAGCATGTCCGAGAATAGGGGGATAGTGATGTAATCCAGTTGCTCATTTCTTATCTAACCAGTTGGTTGGTGTATGCGCGGGTGGTGGTGTTGCTGGTGATTGTGCAGGTGGCTCAAGTTCTGCTGACTCTGCCATACTCTTTCTCACAGCTGGGAATAGCTTCAGGAGTTACCTTCCAAATATTTTACGGTCTGGTCGGATGTTGGACATGCTATCTCATCACCACCCTGTACTGCGAGTACCGTGCTCGTAAGGAGAAGGAGGGCCAGGACTTCAAAAATCATGTCATCCAGGTGCGTGCGTGCTGTGCGATCACTTTTTCGCCTAAGCCATGCTGCTCTGTTAGAGCTTGAATCTCTGCCTCTCCACTTGCCTGCCATCGTTTGACATCGAGGGCTTCCAACATTTGAAATCGGAAGATTGAGATGGCATGTGAACTGTCTTCTCTGGTGCTTTGCAGTGGTTTGAGGTGCTGGGTGGACTGTTGGGGCCATACTGGAGGATGGCTGGTCTTGTCTTCAACTGTGTTTTCCTACTCTTCGGATCCGTTATCCAGCTCATAGCCTGCGCAAGGTGATGGTGGTGCCATGCCATGGCTTGTCTCTGAAGTTTGAGTCAGTCAGCTCCATCCACCCTGAGCGCAGCGGAATGAATGCAATGTTTTCTGTCCCGGACTGAGTCTTTGATTTGATTTTGTTTGCTGATTTGTTTCCGTGGGCTGTGCAGTAACATATACTTGATCAATGATAAATTGGACAAGCGTACATGGACGTACATCTTTGGCGCATGCTGTGCTACGACTGTGTTCATTCCCACCTTCCACAACTTCCGGGTCTGGTCGTTCCTCGGCTTGATTATGATCACTTACACTGCGTGGTACATGACCATCAGTTCCCTCATTCACGGACAGGTACGTAGACCCCAGCTAGCGCAGCTTTTTCAGACCCGATTTCTGAACGCTGAGCACGGCAGAGTGCTTGATCTGGATCTCATCTAATTCCGATTCGTGACACGAGTGGATGAATGACTTCAACCTTTGCAGGTTGACAACGTTGAGCACTCTGGGCCCACTAGCCAGGTCCTGTATTTCACTGGAGCTACCAACATTCTCTACACATTTGGCGGTCATGCTGTCACTGTGTAAGACTCTCTCTCTCCCTCCCCTGACGTTTGTCTTCAAGTGGGCCGGTGATTTGCCTTAGGCTAAGAGGCAAAGCCAATTTTCATTAGGCTTTGGATGAGTGATCTAGTGAATAACAGTACTCGACGAAGCGAACGGCAAGCTGAATTTGCTGATTTATCTAATTTTGGCGCAGAGAAATCATGCACGCCATGTACAAGCCTGCGAAATTCAAGGTCGTGTATCTGCTGGCAACAATCTACGTCTTCACATTGACACTGCCATCCGCCGTTGCTGTGTACTGGGCTTTTGGTGACAAGCTTCTCAAGGCTTCCAACGCCCTGTCTCTGCTCCCAAGAACCAAGTGGAGAGACGCAGCTGTCGTGCTCATGCTTATCCATCAGGTAACTTACCGTCCACTATGGTGTCCAAAATCTAGTTCTTTGAGCCCGGGCATCGGAGATTGAAAATGCTTGTCGGTAAATTTCTGACTCGATTGGAAATGTTCTGGGCAGTTCATCACATTCGGATTTGCTTCGATGCCACTTTACTTCGTGTGGGAGAAGTTTCTGGGCGTCCACAAGACGAAGAACCTTCTCTTCCGGGCCTTGTGCAGAATGCCCGTCGTACTTCCCATCTGGTTCCTGGCAATCATCTTCCCCTTCTTCGGACCTATTAACTCAGCCGTGGGAGCTTTACTGGTGACATTCACTGTATACATCATTCCATGTGCCGCCCACATGGCTGTGTACCGTTCCTCGTACGCACGAATGGTAAGCTCACAGAGCTCTGCCATCATTGCCTTTGACCATTTGCTTTCGAGTTTGAATGTTTCTGGTTGTTTGACAACCAAACGTCGGTCAGATGTCTGTCAATGGAGTGGGGCGTCGAGTGAGTTGGCCTACGTCTCCTACTGTTGTAGGGCTGCGAGCTTAGGTGGAAGTAAAGTGGCTCTTTCAGTGGCACTCGGAGGCAAGGGTGCTTCACTTGGTCGTGTGTGTGTCTGTGTGCGTCTACGAGAGCTGAATGATCACGATGGACTTTTGCTGCGCAGAATGCCGTCTTCAAACCTCCGAGATTCCTTCCCAGCTGGACTCTGATGTACATGTTCAACATCTTCCTCCTGATCTGGATCCTAGTGGTGGGAGTAGGTTTCGGAGGCTGGGCGAGTATGACCAACTTCGTCAGGCAGATCGATACGTTCGGCCTATTCGCCAAGTGCTTCCAGTGCCCTCCTCGCGCGGTTGCGGCTGCGGCACCGTCCTTGAAATTGGCCTAAACGATCGCTGCTGCTGTCAGCTCTATACTACCGACCCATACTACTAC

mRNA

>Mapoly0107s0048.1
GGGTCGGGGACACTGAGGGTGAGTTAAAGTGAGTGAGTGCGCGAGCTAGCTCGCAGGCCTGAACCCTGCTGGCGGTGCAGTCAGGCCTTTAAAGCCTTCTGATGAGAAATTCACTTTGGAGTTCTCAGCTCAGCTCAGTAGCTCGGCCCGTCCCAGCTCCTCTCCTCGCATCCCGTTCCATCCCATCTCGTCTGGTTTTGGTTCCCACTCCGCTGCGCTGCAGTCAGAGCTCCAAGTCCCCACTCATTCCCATCTCCCACCCTCGGATTGAAGCTCTAGGAGCTAGACGACCACCACCCAGCTCGGACTCGATGAGAGAGTAGTTTAAGGAGGAATAGAAGAAGCATCAGCAGCAGCAGCAGCTCGAGCTGTTGCGGCCAATGCGGGCTTGTAGCCGTGATAGCCAGACTATCCCATCTAACTATGTCCTTGAGGTGTGAGGAAACACATGTGGGCGGAGTCGTATGCCTTTGACACTGTGTGCAGCAGCCACCGAGCCATTTGTGCATGTTACGGATTTCCAGGCCCATTGGAACGCATGGTGTGACTGATCCTGGACTCACCGAGAGACCGAGAGGGAGACAGTTTACATGTGTGAGTGATTGATTGAGTTTCACGTACATCGAAATGAGTCGTATCGGAGAAGGAGTATGAGAATCGAGCTCGAGGAGAAGATTGCAGACCAGACCAGAAAGCTTCCGTGCATCGGGTCCGAAGAATCTGTCGAGCTGAGACAGTGAGGAGTCGAGCCGAAGGTTTCCCCGGGCGAGTACTCGAAAGGAGGAGATGGCACCTACGAAGACGGGGTCCCTCGGGGGCAGTGATACGGATGGCATTGTGGGCAGCTACGGCGAGATGCAGGAACAGCACCAGAAGATTGAGCAGCTCGAAAACGACGAGCAGCTTACTATTGGTGGCCGAGCCAAGGACTTGCTCTGGCATGGTGGATCTGCCACCGACGCCTGGTTCAGTGCAGCCTCCAACCAGGTGGCTCAAGTTCTGCTGACTCTGCCATACTCTTTCTCACAGCTGGGAATAGCTTCAGGAGTTACCTTCCAAATATTTTACGGTCTGGTCGGATGTTGGACATGCTATCTCATCACCACCCTGTACTGCGAGTACCGTGCTCGTAAGGAGAAGGAGGGCCAGGACTTCAAAAATCATGTCATCCAGTGGTTTGAGGTGCTGGGTGGACTGTTGGGGCCATACTGGAGGATGGCTGGTCTTGTCTTCAACTGTGTTTTCCTACTCTTCGGATCCGTTATCCAGCTCATAGCCTGCGCAAGTAACATATACTTGATCAATGATAAATTGGACAAGCGTACATGGACGTACATCTTTGGCGCATGCTGTGCTACGACTGTGTTCATTCCCACCTTCCACAACTTCCGGGTCTGGTCGTTCCTCGGCTTGATTATGATCACTTACACTGCGTGGTACATGACCATCAGTTCCCTCATTCACGGACAGGTTGACAACGTTGAGCACTCTGGGCCCACTAGCCAGGTCCTGTATTTCACTGGAGCTACCAACATTCTCTACACATTTGGCGGTCATGCTGTCACTGTAGAAATCATGCACGCCATGTACAAGCCTGCGAAATTCAAGGTCGTGTATCTGCTGGCAACAATCTACGTCTTCACATTGACACTGCCATCCGCCGTTGCTGTGTACTGGGCTTTTGGTGACAAGCTTCTCAAGGCTTCCAACGCCCTGTCTCTGCTCCCAAGAACCAAGTGGAGAGACGCAGCTGTCGTGCTCATGCTTATCCATCAGTTCATCACATTCGGATTTGCTTCGATGCCACTTTACTTCGTGTGGGAGAAGTTTCTGGGCGTCCACAAGACGAAGAACCTTCTCTTCCGGGCCTTGTGCAGAATGCCCGTCGTACTTCCCATCTGGTTCCTGGCAATCATCTTCCCCTTCTTCGGACCTATTAACTCAGCCGTGGGAGCTTTACTGGTGACATTCACTGTATACATCATTCCATGTGCCGCCCACATGGCTGTGTACCGTTCCTCGTACGCACGAATGAATGCCGTCTTCAAACCTCCGAGATTCCTTCCCAGCTGGACTCTGATGTACATGTTCAACATCTTCCTCCTGATCTGGATCCTAGTGGTGGGAGTAGGTTTCGGAGGCTGGGCGAGTATGACCAACTTCGTCAGGCAGATCGATACGTTCGGCCTATTCGCCAAGTGCTTCCAGTGCCCTCCTCGCGCGGTTGCGGCTGCGGCACCGTCCTTGAAATTGGCCTAAACGATCGCTGCTGCTGTCAGCTCTATACTACCGACCCATACTACTAC

CDS

>Mapoly0107s0048.1
ATGGCACCTACGAAGACGGGGTCCCTCGGGGGCAGTGATACGGATGGCATTGTGGGCAGCTACGGCGAGATGCAGGAACAGCACCAGAAGATTGAGCAGCTCGAAAACGACGAGCAGCTTACTATTGGTGGCCGAGCCAAGGACTTGCTCTGGCATGGTGGATCTGCCACCGACGCCTGGTTCAGTGCAGCCTCCAACCAGGTGGCTCAAGTTCTGCTGACTCTGCCATACTCTTTCTCACAGCTGGGAATAGCTTCAGGAGTTACCTTCCAAATATTTTACGGTCTGGTCGGATGTTGGACATGCTATCTCATCACCACCCTGTACTGCGAGTACCGTGCTCGTAAGGAGAAGGAGGGCCAGGACTTCAAAAATCATGTCATCCAGTGGTTTGAGGTGCTGGGTGGACTGTTGGGGCCATACTGGAGGATGGCTGGTCTTGTCTTCAACTGTGTTTTCCTACTCTTCGGATCCGTTATCCAGCTCATAGCCTGCGCAAGTAACATATACTTGATCAATGATAAATTGGACAAGCGTACATGGACGTACATCTTTGGCGCATGCTGTGCTACGACTGTGTTCATTCCCACCTTCCACAACTTCCGGGTCTGGTCGTTCCTCGGCTTGATTATGATCACTTACACTGCGTGGTACATGACCATCAGTTCCCTCATTCACGGACAGGTTGACAACGTTGAGCACTCTGGGCCCACTAGCCAGGTCCTGTATTTCACTGGAGCTACCAACATTCTCTACACATTTGGCGGTCATGCTGTCACTGTAGAAATCATGCACGCCATGTACAAGCCTGCGAAATTCAAGGTCGTGTATCTGCTGGCAACAATCTACGTCTTCACATTGACACTGCCATCCGCCGTTGCTGTGTACTGGGCTTTTGGTGACAAGCTTCTCAAGGCTTCCAACGCCCTGTCTCTGCTCCCAAGAACCAAGTGGAGAGACGCAGCTGTCGTGCTCATGCTTATCCATCAGTTCATCACATTCGGATTTGCTTCGATGCCACTTTACTTCGTGTGGGAGAAGTTTCTGGGCGTCCACAAGACGAAGAACCTTCTCTTCCGGGCCTTGTGCAGAATGCCCGTCGTACTTCCCATCTGGTTCCTGGCAATCATCTTCCCCTTCTTCGGACCTATTAACTCAGCCGTGGGAGCTTTACTGGTGACATTCACTGTATACATCATTCCATGTGCCGCCCACATGGCTGTGTACCGTTCCTCGTACGCACGAATGAATGCCGTCTTCAAACCTCCGAGATTCCTTCCCAGCTGGACTCTGATGTACATGTTCAACATCTTCCTCCTGATCTGGATCCTAGTGGTGGGAGTAGGTTTCGGAGGCTGGGCGAGTATGACCAACTTCGTCAGGCAGATCGATACGTTCGGCCTATTCGCCAAGTGCTTCCAGTGCCCTCCTCGCGCGGTTGCGGCTGCGGCACCGTCCTTGAAATTGGCCTAA

Protein

>Mapoly0107s0048.1
MAPTKTGSLGGSDTDGIVGSYGEMQEQHQKIEQLENDEQLTIGGRAKDLLWHGGSATDAWFSAASNQVAQVLLTLPYSFSQLGIASGVTFQIFYGLVGCWTCYLITTLYCEYRARKEKEGQDFKNHVIQWFEVLGGLLGPYWRMAGLVFNCVFLLFGSVIQLIACASNIYLINDKLDKRTWTYIFGACCATTVFIPTFHNFRVWSFLGLIMITYTAWYMTISSLIHGQVDNVEHSGPTSQVLYFTGATNILYTFGGHAVTVEIMHAMYKPAKFKVVYLLATIYVFTLTLPSAVAVYWAFGDKLLKASNALSLLPRTKWRDAAVVLMLIHQFITFGFASMPLYFVWEKFLGVHKTKNLLFRALCRMPVVLPIWFLAIIFPFFGPINSAVGALLVTFTVYIIPCAAHMAVYRSSYARMNAVFKPPRFLPSWTLMYMFNIFLLIWILVVGVGFGGWASMTNFVRQIDTFGLFAKCFQCPPRAVAAAAPSLKLA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>