Mapoly0110s0028



Description

GATA-4/5/6 transcription factors

Reference DB

Database ID Description
GO GO:0005515 Protein binding
GO GO:0005622 Intracellular
GO GO:0008270 Zinc ion binding
KOG KOG1601 GATA-4/5/6 transcription factors
OrthoMCL OG5_144994
PFAM PF00643 B-box zinc finger
PFAM PF06203 CCT motif
PANTHER PTHR31319 FAMILY NOT NAMED
PANTHER PTHR31319:SF1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBBX5 transcription factor, BBX Mapoly0110s0028.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0110s0028.1 scaffold_110:385628..390041  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0110s0028.1  

Gene structure:

mRNA scaffold_110:385628..390041  ( - strand )
three_prime_UTR scaffold_110:385628..387362  ( - strand )
CDS scaffold_110:387363..387716  ( - strand )
CDS scaffold_110:387944..388801  ( - strand )
five_prime_UTR scaffold_110:388802..390041  ( - strand )

Sequences:

Gene

>Mapoly0110s0028.1
CTCCACCCCCCCTTGCCCCTCCCCAGCTCAGTATGCTTGTGTGAACTCGCTCTCTTAGTGGCTCACTCTTCTGTGACTCCTTAGGTTTTTCGTTCCTCCGGTCTCTTCCTCCTCTCTTTCCTCTTTGCATTTCTCTGTGTCTCTCTCCTCTCGCTGCTTCTCCTCCCGCTCTTCCTCCGGTGGTCCTCCCACTCTTCTTCTTCCTTCTTGCTGGACACAGTCACTGCCTCCGCTTTCCGCTTTCCGCTCGTGTTTTCTTCGGCTTTTGTGGTTGTCTTATCGTGATTTTCTCGATAGTCGTCCGTAGTCGCCTCTCCCTCTGCCAAATTTGTTGCGAGTGTTCTGAGCCTTTGAAGCCAGAGGTCTCGAGTGCTTCTCTGCTTCTCCGTGTGTTGTTTGCGTTGAAGCAACGGCAGCAGCAGCTGCAGCTTGCGAGTTTGTGAAGGTGTTGTTTCCAGTACCGAATCCGAGAAGTTCGAGAGCGGCGCTATTGCACGCCGGGCCGGAACCAGTTTCGGCAGCAGAGATCGCGGTCGTGATCAGAGGTTGCATCAGGAAGCGTGGGGTGAATTTCGGAAGGCTTCATGATTTGCAGTGGAGTTTGGTCGAATAGTCTCGTATCTCTGGACATGCAGCAGCAGACTCGTCCGTCCGGTTCTACGGAGGTTCGTGGTTGATCGCTAGAGGGTATTGCGGTCCGAGGTTCTTCTGAGGAAGTTAAAGCAGGCGTCTTTGACAGGCACCCTGGAGGCGAGTAGTAGCAGTGGCAGGGAGGTGAAGGGCGACGGTTAACACCGGATTGAGTCGAGCGCGTCGGGGTTCTCATCGCTACTGAGGCAGAAGAGGTCTTGTCTTGAGGAAATCCTCAGGAGACATTAGCTCTCTAAGGAAGCCGATCTGGTCGAACGATTCTCACGTGTTCAGAACGAGCTTTCTGGTTTCTCTTACGTCTAAGCTTGTAAAGTAGTCGGCAATTTCTCTGGAGATCGCTCTCGAGGAACGATCGCAGGCGCAGGGCCGAGGATTCGATTCCGGATCCACCAGGCAGAGAAGTTACAGCAGCTGATCGTCGACACATGCAGTAGCGGAGGATTCTGTGAGCAGGAGGAGGCGGACGAGGAACCTGCCGGGAGAAGCAGAGGTAGTGCAAGCGAAGTTTGTGAGTTAGAGAGGGAGGAAAAGGGGAAGGGAAAGAGTCTCGTGCCCAGAGAGGCAGGAACTTCTAGCTAGTGAACAGAGTATGCCGAAGCCTTGTGATGCATGTCAGTCATCGAGCGCAGTCGTCTACTGCCGGGCCGACGCCGCCTTCCTGTGCGCAGGGTGTGACACCAAAGTCCATGGCGCCAACAAGCTGGCGCAACGCCACGAGCGAGTCTGGGTGTGCGAGGTGTGCGAGGTCGCGCCAGCCGTGGTGACGTGCAAGGCGGACGCCGCCGCGCTCTGCGTCGCGTGCGACACCGATATCCACTCGGCCAACCCGTTGGCCCGGCGCCATGAGCGGACGCCCGTCACTCCCTTCTACGAGTGCCCGGGCCAGTCCATCAAGGTGGCGCACATTAGCGCGCTGGTCGCGCCCCAGGGCGGGCAGGGCCGCGACGACGACGCGGACCTCGACGCCGACGAGCACTCAGTCGCGGAGGAGGCCGCGTCGTGGCTGCTGCCCAACCCCAAGCCGCTGACGGAGAACAACATCCTCGGCGACGACAAGGGCTCCATGGGCCAGGGCGAGATGGGGTCGCTGGTGAACGACGACGGGGACGACGACGATCTCGAGCCTTCATCGTTCCTCGTGCCCAGCGGCGGCTTCAGCCCGAATTCCACCCTCTCGCACAAGAGCGACGGCATGAGCATGAAGCACCACAAGTCCAAAGTGGAAGCCAATGCCGGCGACCTGTTCTCCGACGTCGATCCTTACCTGGATCTCGACTACGCCACCGTGGTCGGGGCCAATCCCAACCTGGGCGCAGACAGTCTCGTGCCAGTACACAGCGACCACCCCGCGCACTCGTCGCCCTCCATGTCCACCGGATCGGGCTCCTTCGAGGGCGAGGCCGTGTGCAAGGCCGGCTATGGCTACGAATCGTCGCTGACTCACAGCGTGAGTCCCTCCCTCCTCCCTCCTCCCCCCTCCCCCTCCCAACTCTCACCTCCTCTCCCCCATCGCTCTGCATGCGCGGGGCTTTTGTTTGCCGTGGCGGCTGCTGTCGTCTCGTCTCGTGTGATTGGGATGCAATTGCAATGTCTGCGTGCGGCTGGCCGTCGTGACGGTCGCGGCGCAGGGGCAGGGGAGGCAAGACTGACTCTGGTTGTGTGCCAATAATTCAGATGTCGTCGTCGTCGCTGGACGTGGGGATCGTGCCGGACACGAACGCGCTGAGCGACATCTCGACGCCGTACGACGGGAGCCAGGGGCACGGGTTCGAGTTCCCGCCGCGAATGCTGCACATGGCGCAGGTGGAGCCGCCGATGGCGCGCGAGGCGCGAGTGATGCGCTACAAGGAGAAGCGGAAGAACCGCAAGTTCGAGAAGACCATCCGGTACGCGTCGCGCAAGGCGTACGCGGAGTCGCGGCCCCGGATCAAGGGCCGGTTCGCCAAGCGCAACCCGACGGACATGAGCCTGCAGGACATGTACCCGAACGTCCCGGACTCGGGCTTCGGCGTCGTGCCAGCCTTCTGAGCGCGCGCCGCGCCGCGCGCGCGAGGCGAGACGTCCGGCTTGCAATCAAGCTAGACCTTGTGACTTGGTTGTAGTCATTCCACCCGTGAAACTTGTTGCCGAGCCATACGGACTACCAACCAAGAGACTAGTGCAGAGACAAGACTGTGAGAGGTTCGGACGGTCTTGTTCTGAAAGGTGTATCGAGAGGAGCATGTGTCAGTCAGCCCATTTTCTCGTCTCAAAGTGGCAGTCGCGTCCAGAGCAAAGGCTCTGTCGCGGCCGAGGTGTCTTCATAGTACTAAGGAGAGAATGTGTGATTACGTTCCTACTGGACCCAGCCGGCCGGGTTGTCCACTCATCTTCTGCTCGGAAGAGTGTCGTGGGGGGCCCTGCGGGGCTCGATGATGATGGAAGGAAGTATGCCACACACACGCGAAGAGTACTAGCTGGCAGGGAAGGGAGTGCACGGCGGGAGGGAGGGCGAGGCCGGGCCCCGAGCGACTTCGGCTCTGCCCTGCTCCTGTCTCCCGACGTTGCACGAATTGTGGATATTGCCGGGTTTTCTTCCCATCCAAAAGGACGGGTTGCATGCAGCAGGAGGTTCTGGTGTACATGTGGATTGTTCTACTCCCTGGTTGAAGTGGAGTGGTTGTAAGTGCTTTTTATGAGGAATTCGATTATGTACCGGTGAAGATTTTGGTAAGAAGAAGAAGATGACATGTTCCGCTGTCAATATCTCTCTGAGGTGCCCGGGGTGAGAGGAGAGGCGAGGAGAGGAGAGGACAGCTGACGAGAGGGAGAGGGGTGGGGGAGAGGGGGAGAGAGAGGGAGAGGGAAAGCAGGGGATGATATAGTGTGCTACATCGCTGTGGACTAGGTTGTTTGCGACTAGATTTTTTGTCATCCAGGTGTTTGGAAGTTGGTTCATTTGCAGTCTCTGTTCAACCTTCTGCAACGGACGAACACCTGGCATGATTCTGTACTTCATAAATAACCCACGAAAGAGCTCCAAGCGTTGGAACAGAAACTTAGTAGATAGCACAGCTTAGTTCTATTCTTGTGGTAACATCGTTTACATGATGTATTGCAGTCCGAAGCAGCTCAGCCCAGGTGGCCCAATGGCCAGACCCAATACAATACTCTGGTGGCGGCCTAAGGCCAGACCAATCAATACTCTCTGGCTTGTAGTGGATTGTAAGAAGGTGTGATCCGCCTGTAGTTATGCGTTAAGGATACAACTCCTTCGCCACAAGACCTCATTTGACGACAATTCAAAGATCCAGTGTTTTTAACCGCCACGGTTGTGGTTCAATTTTGTACTCCTGGTCGATGCTTTCTGAATGTACAGTTGGTTTCCCGATAAACCGTCGAGTTTTCTCGCTCTCGTGTCATCATCCGAGCCTTCTACTCTCTGTCCTGGTGTCGTTCACGTCTCTTTCTCGAGTCGCCTCGTTCGGAATTGAGTCTCCAATTCTCCAGTTTGGATTTTGGAGTCCAGCAAGTATTTAATTCTGGACTCCCGCCGGATGGCATGCCGAGATGGCAGCATTTCAATGTGTCAGGAATGTCTGAGCAATCTCCGTGCGGCTTGTGCATCGCCGTCATGCTCGAAGCGTGAACCGTGATACCGTCGACCGGCCTCCGGTAGAGAAGCGCACCAGCCGGAGCCGCCGAGAAGGTGGAGGATGTTATAATTCTGACCGGTCACCGAGCGGGACGTACCGTGCCCAGAGGTGACCAACGACGAGAGGAC

mRNA

>Mapoly0110s0028.1
CTCCACCCCCCCTTGCCCCTCCCCAGCTCAGTATGCTTGTGTGAACTCGCTCTCTTAGTGGCTCACTCTTCTGTGACTCCTTAGGTTTTTCGTTCCTCCGGTCTCTTCCTCCTCTCTTTCCTCTTTGCATTTCTCTGTGTCTCTCTCCTCTCGCTGCTTCTCCTCCCGCTCTTCCTCCGGTGGTCCTCCCACTCTTCTTCTTCCTTCTTGCTGGACACAGTCACTGCCTCCGCTTTCCGCTTTCCGCTCGTGTTTTCTTCGGCTTTTGTGGTTGTCTTATCGTGATTTTCTCGATAGTCGTCCGTAGTCGCCTCTCCCTCTGCCAAATTTGTTGCGAGTGTTCTGAGCCTTTGAAGCCAGAGGTCTCGAGTGCTTCTCTGCTTCTCCGTGTGTTGTTTGCGTTGAAGCAACGGCAGCAGCAGCTGCAGCTTGCGAGTTTGTGAAGGTGTTGTTTCCAGTACCGAATCCGAGAAGTTCGAGAGCGGCGCTATTGCACGCCGGGCCGGAACCAGTTTCGGCAGCAGAGATCGCGGTCGTGATCAGAGGTTGCATCAGGAAGCGTGGGGTGAATTTCGGAAGGCTTCATGATTTGCAGTGGAGTTTGGTCGAATAGTCTCGTATCTCTGGACATGCAGCAGCAGACTCGTCCGTCCGGTTCTACGGAGGTTCGTGGTTGATCGCTAGAGGGTATTGCGGTCCGAGGTTCTTCTGAGGAAGTTAAAGCAGGCGTCTTTGACAGGCACCCTGGAGGCGAGTAGTAGCAGTGGCAGGGAGGTGAAGGGCGACGGTTAACACCGGATTGAGTCGAGCGCGTCGGGGTTCTCATCGCTACTGAGGCAGAAGAGGTCTTGTCTTGAGGAAATCCTCAGGAGACATTAGCTCTCTAAGGAAGCCGATCTGGTCGAACGATTCTCACGTGTTCAGAACGAGCTTTCTGGTTTCTCTTACGTCTAAGCTTGTAAAGTAGTCGGCAATTTCTCTGGAGATCGCTCTCGAGGAACGATCGCAGGCGCAGGGCCGAGGATTCGATTCCGGATCCACCAGGCAGAGAAGTTACAGCAGCTGATCGTCGACACATGCAGTAGCGGAGGATTCTGTGAGCAGGAGGAGGCGGACGAGGAACCTGCCGGGAGAAGCAGAGGTAGTGCAAGCGAAGTTTGTGAGTTAGAGAGGGAGGAAAAGGGGAAGGGAAAGAGTCTCGTGCCCAGAGAGGCAGGAACTTCTAGCTAGTGAACAGAGTATGCCGAAGCCTTGTGATGCATGTCAGTCATCGAGCGCAGTCGTCTACTGCCGGGCCGACGCCGCCTTCCTGTGCGCAGGGTGTGACACCAAAGTCCATGGCGCCAACAAGCTGGCGCAACGCCACGAGCGAGTCTGGGTGTGCGAGGTGTGCGAGGTCGCGCCAGCCGTGGTGACGTGCAAGGCGGACGCCGCCGCGCTCTGCGTCGCGTGCGACACCGATATCCACTCGGCCAACCCGTTGGCCCGGCGCCATGAGCGGACGCCCGTCACTCCCTTCTACGAGTGCCCGGGCCAGTCCATCAAGGTGGCGCACATTAGCGCGCTGGTCGCGCCCCAGGGCGGGCAGGGCCGCGACGACGACGCGGACCTCGACGCCGACGAGCACTCAGTCGCGGAGGAGGCCGCGTCGTGGCTGCTGCCCAACCCCAAGCCGCTGACGGAGAACAACATCCTCGGCGACGACAAGGGCTCCATGGGCCAGGGCGAGATGGGGTCGCTGGTGAACGACGACGGGGACGACGACGATCTCGAGCCTTCATCGTTCCTCGTGCCCAGCGGCGGCTTCAGCCCGAATTCCACCCTCTCGCACAAGAGCGACGGCATGAGCATGAAGCACCACAAGTCCAAAGTGGAAGCCAATGCCGGCGACCTGTTCTCCGACGTCGATCCTTACCTGGATCTCGACTACGCCACCGTGGTCGGGGCCAATCCCAACCTGGGCGCAGACAGTCTCGTGCCAGTACACAGCGACCACCCCGCGCACTCGTCGCCCTCCATGTCCACCGGATCGGGCTCCTTCGAGGGCGAGGCCGTGTGCAAGGCCGGCTATGGCTACGAATCGTCGCTGACTCACAGCATGTCGTCGTCGTCGCTGGACGTGGGGATCGTGCCGGACACGAACGCGCTGAGCGACATCTCGACGCCGTACGACGGGAGCCAGGGGCACGGGTTCGAGTTCCCGCCGCGAATGCTGCACATGGCGCAGGTGGAGCCGCCGATGGCGCGCGAGGCGCGAGTGATGCGCTACAAGGAGAAGCGGAAGAACCGCAAGTTCGAGAAGACCATCCGGTACGCGTCGCGCAAGGCGTACGCGGAGTCGCGGCCCCGGATCAAGGGCCGGTTCGCCAAGCGCAACCCGACGGACATGAGCCTGCAGGACATGTACCCGAACGTCCCGGACTCGGGCTTCGGCGTCGTGCCAGCCTTCTGAGCGCGCGCCGCGCCGCGCGCGCGAGGCGAGACGTCCGGCTTGCAATCAAGCTAGACCTTGTGACTTGGTTGTAGTCATTCCACCCGTGAAACTTGTTGCCGAGCCATACGGACTACCAACCAAGAGACTAGTGCAGAGACAAGACTGTGAGAGGTTCGGACGGTCTTGTTCTGAAAGGTGTATCGAGAGGAGCATGTGTCAGTCAGCCCATTTTCTCGTCTCAAAGTGGCAGTCGCGTCCAGAGCAAAGGCTCTGTCGCGGCCGAGGTGTCTTCATAGTACTAAGGAGAGAATGTGTGATTACGTTCCTACTGGACCCAGCCGGCCGGGTTGTCCACTCATCTTCTGCTCGGAAGAGTGTCGTGGGGGGCCCTGCGGGGCTCGATGATGATGGAAGGAAGTATGCCACACACACGCGAAGAGTACTAGCTGGCAGGGAAGGGAGTGCACGGCGGGAGGGAGGGCGAGGCCGGGCCCCGAGCGACTTCGGCTCTGCCCTGCTCCTGTCTCCCGACGTTGCACGAATTGTGGATATTGCCGGGTTTTCTTCCCATCCAAAAGGACGGGTTGCATGCAGCAGGAGGTTCTGGTGTACATGTGGATTGTTCTACTCCCTGGTTGAAGTGGAGTGGTTGTAAGTGCTTTTTATGAGGAATTCGATTATGTACCGGTGAAGATTTTGGTAAGAAGAAGAAGATGACATGTTCCGCTGTCAATATCTCTCTGAGGTGCCCGGGGTGAGAGGAGAGGCGAGGAGAGGAGAGGACAGCTGACGAGAGGGAGAGGGGTGGGGGAGAGGGGGAGAGAGAGGGAGAGGGAAAGCAGGGGATGATATAGTGTGCTACATCGCTGTGGACTAGGTTGTTTGCGACTAGATTTTTTGTCATCCAGGTGTTTGGAAGTTGGTTCATTTGCAGTCTCTGTTCAACCTTCTGCAACGGACGAACACCTGGCATGATTCTGTACTTCATAAATAACCCACGAAAGAGCTCCAAGCGTTGGAACAGAAACTTAGTAGATAGCACAGCTTAGTTCTATTCTTGTGGTAACATCGTTTACATGATGTATTGCAGTCCGAAGCAGCTCAGCCCAGGTGGCCCAATGGCCAGACCCAATACAATACTCTGGTGGCGGCCTAAGGCCAGACCAATCAATACTCTCTGGCTTGTAGTGGATTGTAAGAAGGTGTGATCCGCCTGTAGTTATGCGTTAAGGATACAACTCCTTCGCCACAAGACCTCATTTGACGACAATTCAAAGATCCAGTGTTTTTAACCGCCACGGTTGTGGTTCAATTTTGTACTCCTGGTCGATGCTTTCTGAATGTACAGTTGGTTTCCCGATAAACCGTCGAGTTTTCTCGCTCTCGTGTCATCATCCGAGCCTTCTACTCTCTGTCCTGGTGTCGTTCACGTCTCTTTCTCGAGTCGCCTCGTTCGGAATTGAGTCTCCAATTCTCCAGTTTGGATTTTGGAGTCCAGCAAGTATTTAATTCTGGACTCCCGCCGGATGGCATGCCGAGATGGCAGCATTTCAATGTGTCAGGAATGTCTGAGCAATCTCCGTGCGGCTTGTGCATCGCCGTCATGCTCGAAGCGTGAACCGTGATACCGTCGACCGGCCTCCGGTAGAGAAGCGCACCAGCCGGAGCCGCCGAGAAGGTGGAGGATGTTATAATTCTGACCGGTCACCGAGCGGGACGTACCGTGCCCAGAGGTGACCAACGACGAGAGGAC

CDS

>Mapoly0110s0028.1
ATGCCGAAGCCTTGTGATGCATGTCAGTCATCGAGCGCAGTCGTCTACTGCCGGGCCGACGCCGCCTTCCTGTGCGCAGGGTGTGACACCAAAGTCCATGGCGCCAACAAGCTGGCGCAACGCCACGAGCGAGTCTGGGTGTGCGAGGTGTGCGAGGTCGCGCCAGCCGTGGTGACGTGCAAGGCGGACGCCGCCGCGCTCTGCGTCGCGTGCGACACCGATATCCACTCGGCCAACCCGTTGGCCCGGCGCCATGAGCGGACGCCCGTCACTCCCTTCTACGAGTGCCCGGGCCAGTCCATCAAGGTGGCGCACATTAGCGCGCTGGTCGCGCCCCAGGGCGGGCAGGGCCGCGACGACGACGCGGACCTCGACGCCGACGAGCACTCAGTCGCGGAGGAGGCCGCGTCGTGGCTGCTGCCCAACCCCAAGCCGCTGACGGAGAACAACATCCTCGGCGACGACAAGGGCTCCATGGGCCAGGGCGAGATGGGGTCGCTGGTGAACGACGACGGGGACGACGACGATCTCGAGCCTTCATCGTTCCTCGTGCCCAGCGGCGGCTTCAGCCCGAATTCCACCCTCTCGCACAAGAGCGACGGCATGAGCATGAAGCACCACAAGTCCAAAGTGGAAGCCAATGCCGGCGACCTGTTCTCCGACGTCGATCCTTACCTGGATCTCGACTACGCCACCGTGGTCGGGGCCAATCCCAACCTGGGCGCAGACAGTCTCGTGCCAGTACACAGCGACCACCCCGCGCACTCGTCGCCCTCCATGTCCACCGGATCGGGCTCCTTCGAGGGCGAGGCCGTGTGCAAGGCCGGCTATGGCTACGAATCGTCGCTGACTCACAGCATGTCGTCGTCGTCGCTGGACGTGGGGATCGTGCCGGACACGAACGCGCTGAGCGACATCTCGACGCCGTACGACGGGAGCCAGGGGCACGGGTTCGAGTTCCCGCCGCGAATGCTGCACATGGCGCAGGTGGAGCCGCCGATGGCGCGCGAGGCGCGAGTGATGCGCTACAAGGAGAAGCGGAAGAACCGCAAGTTCGAGAAGACCATCCGGTACGCGTCGCGCAAGGCGTACGCGGAGTCGCGGCCCCGGATCAAGGGCCGGTTCGCCAAGCGCAACCCGACGGACATGAGCCTGCAGGACATGTACCCGAACGTCCCGGACTCGGGCTTCGGCGTCGTGCCAGCCTTCTGA

Protein

>Mapoly0110s0028.1
MPKPCDACQSSSAVVYCRADAAFLCAGCDTKVHGANKLAQRHERVWVCEVCEVAPAVVTCKADAAALCVACDTDIHSANPLARRHERTPVTPFYECPGQSIKVAHISALVAPQGGQGRDDDADLDADEHSVAEEAASWLLPNPKPLTENNILGDDKGSMGQGEMGSLVNDDGDDDDLEPSSFLVPSGGFSPNSTLSHKSDGMSMKHHKSKVEANAGDLFSDVDPYLDLDYATVVGANPNLGADSLVPVHSDHPAHSSPSMSTGSGSFEGEAVCKAGYGYESSLTHSMSSSSLDVGIVPDTNALSDISTPYDGSQGHGFEFPPRMLHMAQVEPPMAREARVMRYKEKRKNRKFEKTIRYASRKAYAESRPRIKGRFAKRNPTDMSLQDMYPNVPDSGFGVVPAF

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>