Mapoly0114s0037



Description

NAI1, DNA BINDING / TRANSCRIPTION FACTOR

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_162137
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR23042 CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS
PANTHER PTHR23042:SF25 NAI1, DNA BINDING / TRANSCRIPTION FACTOR

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH23 transcription factor, bHLH Mapoly0114s0037.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0114s0037.1 scaffold_114:474823..479561  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0114s0037.1  

Gene structure:

mRNA scaffold_114:474823..479561  ( - strand )
three_prime_UTR scaffold_114:474823..475501  ( - strand )
three_prime_UTR scaffold_114:476591..476644  ( - strand )
CDS scaffold_114:476645..476719  ( - strand )
CDS scaffold_114:477165..477539  ( - strand )
CDS scaffold_114:477884..478816  ( - strand )
five_prime_UTR scaffold_114:478817..479561  ( - strand )

Sequences:

Gene

>Mapoly0114s0037.1
AGAGAGAGGGAGCGAGAGAGAGAGAGAGAGAGAGAGAGAGGAGATGGAGAGAAGGGCCTGAAGAAGAGAGATGGGCGACAGAGTGAGAGACAGAGAGAGCGAAGTGTCCAGCCTTCCCTTTTCTCGCAGCATCCAAGAGGACCGATTCGCTCGAGAGATCCAGTGATGGATTATCCGGGTTCCCTGAATCTTACGTGTTCATGACTTCTGGTGCTCACAGGTGGAGCAGCTTTGTGGAGCCGAGGAGGAGGATCCGCGAGGAACATGCGAGCATGACGCGGCTGTGACGTGCGCTTTTGCAAAGAATAATAGCCTTCTGAACGAGCACACACGAGAACGATCCAGCACACGGATCCTTCGAAAAATGTGAAAGAGCTGCAGCCGCGCAGATTTCTTCTTCTCGCGTTCCATGACAGCACCGCTGCCTTGCTCAAGCTCGAGGGAACCGACATGAGGACCTTGCAAATGCTCGACCCGGGGCTGGGGTGTTCAGGAATTACTCTCCGTGGCTCTAGCGGACGGTCCCAGCTGAAGAAGCCGGGAGTGGGCACATGAATGCCGACTCCGCTGCAGCACAATCGAGCTTCTCCTTCCGCTGTTGGTATTGTTCAACCTGGCGTGCACCTCGCTGCCGAATCCTCCTCCTCCTCCTCCTCCCAAAGTGACTCCAGCCCGACTCGAAGGCGCTTCAAACTCAGCGCAAGAGATCTTCACCGACCGGCAGTGACTGTCCGATTTATGAAAGATGTGTCCGGAGCTTTCTCAAGACGTATCTCAGGATCATCTCTCGCGAGTTTTCTACCCGGAGTCGTTCATTTATGACAAATTTGATCACCAGCATACGCTCTTGTTCAATCATGTACCTCATTGTGCTGGGCAATACAAACCACCCGACGCTCAGACGCTCGATGCCCAGGGCTTGGCAGCTGGAACGCATGCTCCGCTCAGCGCTGCCGATGTGGGGCAGCATGGGCGGCCATCCCAAGCGATTTCCATCGAAATGGTGGCTGGAGGCGGAGGAGGAGGTGGCGGTTCACACCAAGCGCAACAATCATACTCGGTAGGTGCTCTAGCGCCCGCCTCTGCTGCTCCCACCACCGAAGCATCGGCGGAGTACCCTCCCCTTCACATCAGCTGCAGCGACAATCAGCTGATGCCGGAGATAGACTGCTGCGGCTGGATGAAGGACGTGCTGGATGAATTTCTCCTCACCTCGCAGGACATACCGCGCTTGGCCCCGCTCGTTCCCGGGCACAGCTCGACGATCAACCTCCCGTCCGTGCTCTCCCCGCTGGGCCTGCCGTCGAAGCTCGAATTCTCCGCAAGCCTGCAGGCCTCCCCTCCTCCTGCCGGAAATGCTCCGCAGAAATCCTCCAGCATGAGTCCCAGGTCTGTGGAGGCGATGCAGACGGGGGAGCTCGCAGCTGCTGCTGCAGCAACAACGCCGAAAAGCCCTCCGAAGTCGAAAGTCTCATCGCCCACTCCCGGGCCCTTGAAAGTCCGCGCGTCCAAGCGTCTGCAGAGGGAAGACAGCACGAGAAAAGTGTCGAAATGGGCGCAAAAGGCCAACCTGGCGAATGTGGATCAGGTCGAGCACGTGATTCGGGAACGACAGCGCAGGGATGACATGAGTTACAAAATTGCAACCCTGGAACGCCTTCTACCGCAGGGGCCTAAGGTATCCTATATAAGCCATCCTGCCTGCTTACTTGTCTTCTGACGGGGCCGGATGGGACTCTCGTTCTGGTGGTGTATGCAGCTGACAGCTCTCGCACCGATACGGCTTCTCTTATGCCTCCGATTGGAGTGATGGAACTGCGCTCGGTGTTGGTTGCGTGTTTATCGTAGTTCTTGACTGCAGACCGGATAGTCAGTTTTAATCCCCTCCAGCTCGTGCGCTGGGATATGTTCCTACTGTGTGCGCTGCTGTGTTCCTAGTTTCCATGAGTCTCACGTTTGGAATTGTCCAAATCTGCGAGATTATTCAATTCGTGCCCCTAAGTTCGTGTTTTCGTTACGAAGCGTGACAGGGCTTCAATTGTGCACGACAGTGTTCAGTACGTGAAGTCGTTACAGCAAAGAGTGGAGGAACTGACCAAGAAATCTGCGGAGCTACAGATGATGAAGCGCTCCGTAAAATTCAGCGCTCCTGTCAAAGTCAGTGTGGAAGATAAGAGAGCGCGATCGCCCGAAGATTCACAGGCGCCATTCCGCCTTGTGAACTTCCATCTTCAGGTCGAAGGTGGCGATGAAGCTGTCACTGTCTCGAACTGCAGATGCAATCTTGATTTCCTGAGCCTTACCATGAAGGCTCTAGAGCAATTACAGCTGGATCTTTGTCGAAGCAGTATCACCAAGATGCCAGACGGAGCCTTCTTCTGCATCATTGCTTGCAAGGTCTGCTCGAAACTCAACCTCCCATGCTCATCTGAGACTAACTTGTAATTGCTTGCCTGAATGTCGGATTCATATCACGCAGTTCTCGTCATCGACTTCCGATTCTCCGCAAATATCGTGGAGAGAGAGAACTTGTGATATTAATGAATGAAGTGCTTGATTATCTACTCAGGTTCTCTCTCACGTGATCATGCACTGATTTTAGGGTTTTTCTCCACACTTGCTCAGAGTCTTAGCAAATTTTACTTAATTCAGACTTCGAGCACCGGCCGTAATTCTAGTGGCCAATCGAGGTAAATACTTCACCCAATGGTAGCGCCATATAGCATGTCGCATGCAGTTAGTAGATCCGAGGACTGAAGAGCCTCTACTGTCTCGAGGCCAGCACAGATGGTGGTCGGTCTGTCTGACATGTTTGTTCACTTGGTTGTCATGTTTATCACAGGCTCGAGTTGGAGGAGCAGCGGTACCCTCATCGGCTGCACTTGCGCTCAAACTCAAGGCAGCAGTGGAATTGTAAGAGTATGAAGCTGGCGTCGAAGTCGAGAAGCTACTCTAATATTCACTACACTAGGTATAAAAGAACCCTTCGAGCATGTGCATCTATCTGCGGGCATGCTTCAAAGGGCATCGGAGGACTTCAACAGGGGACAGACTTTTGAAGTCATCTCGTTTCGCTTCTGAGTCCACGTTGTGTCGCTCAGACGTACTCCTTGCAGAAGTTGATGTGATTCTCATGACGAATACGTCGTTTATTTTCTAAACAGCCTCTCGATCATATGTACAGCTTTTCTTTCAATTTGGAGCTTTTTGTGTCGTCTGATTCCACATAGATTTCGACAACACCTCCTTTCTGTCTCATTCACAGGCATGTAAAGAACTAGTCCACCCGGTCAGTAGCACTCGCCTGGAATGCAGCTCTCAAGCTCTCATGCCCTATGCAGAAAAGTCGTCTTTGTTGTAGCGTGGTCACATTTTGACCAAATGACAGCTTAATTCTTCTCAGAAAGACTGGTAGCGACTATGGCAGTGCTCTTCCCAATCAAGCGTGCTTGGTAACTTGAGAGCTCCTGGTTGTCCTGAACTCTTGATGCCAATGTGTGGATGGACTTCCCGAGTCACACGAGAATGATTGAAAGTCACGTATCCTTCAGTCGCAGGAGTCGTCATCATGCGAGGGTCCAGGGCGAGGTTGAGCAGATTAGGAAGCGAGAACAACTCAAGTCTCTAAATAAGTGCGTCGATGCTCGCAGTCGACTGGATAGGAATAAGGGCCCTGAGTTAATGAGAATAGACTCGGTGCAAGAACACTCACTCTTTCGACAACTTCTACATCTTGGTAACGATTCTGAGTCCGCTTGTATCTTGAGAAGGGTCGTGACATAGGAATAAGATCACGTGTCGACATGTGCAAGTACTGTGTGCACCAAAACGAGGGTCAGCGCCAAAGCACAACTTTTCATGTGGAGGTGAACACGGGCTCATAACTGGGCGAAACTCGTGTTAGTTGTGGTGTACAGTAAATTGATTCCTGTAGCCCATCCGTCCCAATTCCAATAGGAGTTACCTTCAATACAAGCAGAGCTGTCTATATAGCTCAAGAACATCGTACACCATGTTCTAGTTCGGGACTGCTGTGGTGGCCCGACCGGGTTGAATGCAGTGCTATGAGGGTCCAGGTGTCGTAAACTGTGGCGAACTTCGAAAAACCAAATTACTCTGACAACCCAGTTTAACGAGACCGAACACTTTTGCATCCGAGGGTGTTATTGAACCTGCCCAAATCGAGCCACACGTACACGTGCCCCTTCCACTCGATCTGCCCTCCAACGACGCACTCAGTAACATGAAGACTGAGCACTGTGATTATAGCAGGACAACTGGACAACGATTACCAACTTCGGTCAGTCGATGAGACAAGTACATAAGAACATGATCGGACGAGACGGGAAAGCGCGAGATAATGAGGAGATGACTGAAGGTGGAATGATCCGAATTGACTTCTGGAATGATGTATGATCTGAATGTGCTGAGTTGCCCACCTCTCGTCAAGCGTGGCTTACGACTCAGGAATTCGAAGACGGTGTCCGGTTACCGTTTCGGTGCACAAAATATACTCCTGACATACACGTTCGGTCTTCCTTTCGCTCGAGCGTGCCGAAGACCATCAGTCTTCAGAACTACTCTTGCTGATGGTTGAAACCGCATGTACAATGGATGTCGCAAGGCTTGACCTGAAATGGAAGACATTCCAGTGATAGGTCCTTCTTGGGAGAATGTTTTTCTGATCGTCTCGGTCCTTCTATTATACTATATCGAGGTTATAGTCGAAATTTAATAAT

mRNA

>Mapoly0114s0037.1
AGAGAGAGGGAGCGAGAGAGAGAGAGAGAGAGAGAGAGAGGAGATGGAGAGAAGGGCCTGAAGAAGAGAGATGGGCGACAGAGTGAGAGACAGAGAGAGCGAAGTGTCCAGCCTTCCCTTTTCTCGCAGCATCCAAGAGGACCGATTCGCTCGAGAGATCCAGTGATGGATTATCCGGGTTCCCTGAATCTTACGTGTTCATGACTTCTGGTGCTCACAGGTGGAGCAGCTTTGTGGAGCCGAGGAGGAGGATCCGCGAGGAACATGCGAGCATGACGCGGCTGTGACGTGCGCTTTTGCAAAGAATAATAGCCTTCTGAACGAGCACACACGAGAACGATCCAGCACACGGATCCTTCGAAAAATGTGAAAGAGCTGCAGCCGCGCAGATTTCTTCTTCTCGCGTTCCATGACAGCACCGCTGCCTTGCTCAAGCTCGAGGGAACCGACATGAGGACCTTGCAAATGCTCGACCCGGGGCTGGGGTGTTCAGGAATTACTCTCCGTGGCTCTAGCGGACGGTCCCAGCTGAAGAAGCCGGGAGTGGGCACATGAATGCCGACTCCGCTGCAGCACAATCGAGCTTCTCCTTCCGCTGTTGGTATTGTTCAACCTGGCGTGCACCTCGCTGCCGAATCCTCCTCCTCCTCCTCCTCCCAAAGTGACTCCAGCCCGACTCGAAGGCGCTTCAAACTCAGCGCAAGAGATCTTCACCGACCGGCAGTGACTGTCCGATTTATGAAAGATGTGTCCGGAGCTTTCTCAAGACGTATCTCAGGATCATCTCTCGCGAGTTTTCTACCCGGAGTCGTTCATTTATGACAAATTTGATCACCAGCATACGCTCTTGTTCAATCATGTACCTCATTGTGCTGGGCAATACAAACCACCCGACGCTCAGACGCTCGATGCCCAGGGCTTGGCAGCTGGAACGCATGCTCCGCTCAGCGCTGCCGATGTGGGGCAGCATGGGCGGCCATCCCAAGCGATTTCCATCGAAATGGTGGCTGGAGGCGGAGGAGGAGGTGGCGGTTCACACCAAGCGCAACAATCATACTCGGTAGGTGCTCTAGCGCCCGCCTCTGCTGCTCCCACCACCGAAGCATCGGCGGAGTACCCTCCCCTTCACATCAGCTGCAGCGACAATCAGCTGATGCCGGAGATAGACTGCTGCGGCTGGATGAAGGACGTGCTGGATGAATTTCTCCTCACCTCGCAGGACATACCGCGCTTGGCCCCGCTCGTTCCCGGGCACAGCTCGACGATCAACCTCCCGTCCGTGCTCTCCCCGCTGGGCCTGCCGTCGAAGCTCGAATTCTCCGCAAGCCTGCAGGCCTCCCCTCCTCCTGCCGGAAATGCTCCGCAGAAATCCTCCAGCATGAGTCCCAGGTCTGTGGAGGCGATGCAGACGGGGGAGCTCGCAGCTGCTGCTGCAGCAACAACGCCGAAAAGCCCTCCGAAGTCGAAAGTCTCATCGCCCACTCCCGGGCCCTTGAAAGTCCGCGCGTCCAAGCGTCTGCAGAGGGAAGACAGCACGAGAAAAGTGTCGAAATGGGCGCAAAAGGCCAACCTGGCGAATGTGGATCAGGTCGAGCACGTGATTCGGGAACGACAGCGCAGGGATGACATGAGTTACAAAATTGCAACCCTGGAACGCCTTCTACCGCAGGGGCCTAAGCGTGACAGGGCTTCAATTGTGCACGACAGTGTTCAGTACGTGAAGTCGTTACAGCAAAGAGTGGAGGAACTGACCAAGAAATCTGCGGAGCTACAGATGATGAAGCGCTCCGTAAAATTCAGCGCTCCTGTCAAAGTCAGTGTGGAAGATAAGAGAGCGCGATCGCCCGAAGATTCACAGGCGCCATTCCGCCTTGTGAACTTCCATCTTCAGGTCGAAGGTGGCGATGAAGCTGTCACTGTCTCGAACTGCAGATGCAATCTTGATTTCCTGAGCCTTACCATGAAGGCTCTAGAGCAATTACAGCTGGATCTTTGTCGAAGCAGTATCACCAAGATGCCAGACGGAGCCTTCTTCTGCATCATTGCTTGCAAGGCTCGAGTTGGAGGAGCAGCGGTACCCTCATCGGCTGCACTTGCGCTCAAACTCAAGGCAGCAGTGGAATTGTAAGAGTATGAAGCTGGCGTCGAAGTCGAGAAGCTACTCTAATATTCACTACACTAGTGCTATGAGGGTCCAGGTGTCGTAAACTGTGGCGAACTTCGAAAAACCAAATTACTCTGACAACCCAGTTTAACGAGACCGAACACTTTTGCATCCGAGGGTGTTATTGAACCTGCCCAAATCGAGCCACACGTACACGTGCCCCTTCCACTCGATCTGCCCTCCAACGACGCACTCAGTAACATGAAGACTGAGCACTGTGATTATAGCAGGACAACTGGACAACGATTACCAACTTCGGTCAGTCGATGAGACAAGTACATAAGAACATGATCGGACGAGACGGGAAAGCGCGAGATAATGAGGAGATGACTGAAGGTGGAATGATCCGAATTGACTTCTGGAATGATGTATGATCTGAATGTGCTGAGTTGCCCACCTCTCGTCAAGCGTGGCTTACGACTCAGGAATTCGAAGACGGTGTCCGGTTACCGTTTCGGTGCACAAAATATACTCCTGACATACACGTTCGGTCTTCCTTTCGCTCGAGCGTGCCGAAGACCATCAGTCTTCAGAACTACTCTTGCTGATGGTTGAAACCGCATGTACAATGGATGTCGCAAGGCTTGACCTGAAATGGAAGACATTCCAGTGATAGGTCCTTCTTGGGAGAATGTTTTTCTGATCGTCTCGGTCCTTCTATTATACTATATCGAGGTTATAGTCGAAATTTAATAAT

CDS

>Mapoly0114s0037.1
ATGTGTCCGGAGCTTTCTCAAGACGTATCTCAGGATCATCTCTCGCGAGTTTTCTACCCGGAGTCGTTCATTTATGACAAATTTGATCACCAGCATACGCTCTTGTTCAATCATGTACCTCATTGTGCTGGGCAATACAAACCACCCGACGCTCAGACGCTCGATGCCCAGGGCTTGGCAGCTGGAACGCATGCTCCGCTCAGCGCTGCCGATGTGGGGCAGCATGGGCGGCCATCCCAAGCGATTTCCATCGAAATGGTGGCTGGAGGCGGAGGAGGAGGTGGCGGTTCACACCAAGCGCAACAATCATACTCGGTAGGTGCTCTAGCGCCCGCCTCTGCTGCTCCCACCACCGAAGCATCGGCGGAGTACCCTCCCCTTCACATCAGCTGCAGCGACAATCAGCTGATGCCGGAGATAGACTGCTGCGGCTGGATGAAGGACGTGCTGGATGAATTTCTCCTCACCTCGCAGGACATACCGCGCTTGGCCCCGCTCGTTCCCGGGCACAGCTCGACGATCAACCTCCCGTCCGTGCTCTCCCCGCTGGGCCTGCCGTCGAAGCTCGAATTCTCCGCAAGCCTGCAGGCCTCCCCTCCTCCTGCCGGAAATGCTCCGCAGAAATCCTCCAGCATGAGTCCCAGGTCTGTGGAGGCGATGCAGACGGGGGAGCTCGCAGCTGCTGCTGCAGCAACAACGCCGAAAAGCCCTCCGAAGTCGAAAGTCTCATCGCCCACTCCCGGGCCCTTGAAAGTCCGCGCGTCCAAGCGTCTGCAGAGGGAAGACAGCACGAGAAAAGTGTCGAAATGGGCGCAAAAGGCCAACCTGGCGAATGTGGATCAGGTCGAGCACGTGATTCGGGAACGACAGCGCAGGGATGACATGAGTTACAAAATTGCAACCCTGGAACGCCTTCTACCGCAGGGGCCTAAGCGTGACAGGGCTTCAATTGTGCACGACAGTGTTCAGTACGTGAAGTCGTTACAGCAAAGAGTGGAGGAACTGACCAAGAAATCTGCGGAGCTACAGATGATGAAGCGCTCCGTAAAATTCAGCGCTCCTGTCAAAGTCAGTGTGGAAGATAAGAGAGCGCGATCGCCCGAAGATTCACAGGCGCCATTCCGCCTTGTGAACTTCCATCTTCAGGTCGAAGGTGGCGATGAAGCTGTCACTGTCTCGAACTGCAGATGCAATCTTGATTTCCTGAGCCTTACCATGAAGGCTCTAGAGCAATTACAGCTGGATCTTTGTCGAAGCAGTATCACCAAGATGCCAGACGGAGCCTTCTTCTGCATCATTGCTTGCAAGGCTCGAGTTGGAGGAGCAGCGGTACCCTCATCGGCTGCACTTGCGCTCAAACTCAAGGCAGCAGTGGAATTGTAA

Protein

>Mapoly0114s0037.1
MCPELSQDVSQDHLSRVFYPESFIYDKFDHQHTLLFNHVPHCAGQYKPPDAQTLDAQGLAAGTHAPLSAADVGQHGRPSQAISIEMVAGGGGGGGGSHQAQQSYSVGALAPASAAPTTEASAEYPPLHISCSDNQLMPEIDCCGWMKDVLDEFLLTSQDIPRLAPLVPGHSSTINLPSVLSPLGLPSKLEFSASLQASPPPAGNAPQKSSSMSPRSVEAMQTGELAAAAAATTPKSPPKSKVSSPTPGPLKVRASKRLQREDSTRKVSKWAQKANLANVDQVEHVIRERQRRDDMSYKIATLERLLPQGPKRDRASIVHDSVQYVKSLQQRVEELTKKSAELQMMKRSVKFSAPVKVSVEDKRARSPEDSQAPFRLVNFHLQVEGGDEAVTVSNCRCNLDFLSLTMKALEQLQLDLCRSSITKMPDGAFFCIIACKARVGGAAVPSSAALALKLKAAVEL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>