Mapoly0115s0036



Description

Multidrug/pheromone exporter, ABC superfamily

Reference DB

Database ID Description
GO GO:0005524 ATP binding
GO GO:0006810 Transport
GO GO:0016021 Integral to membrane
GO GO:0016887 ATPase activity
GO GO:0042626 ATPase activity, coupled to transmembrane movement of substances
GO GO:0055085 Transmembrane transport
KOG KOG0055 Multidrug/pheromone exporter, ABC superfamily
OrthoMCL OG5_126596
PFAM PF00005 ABC transporter
PFAM PF00664 ABC transporter transmembrane region
PANTHER PTHR24221 FAMILY NOT NAMED
PANTHER PTHR24221:SF138

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABCB5 Auxin transport Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0115s0036.1 scaffold_115:336943..346322  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0115s0036.1  

Gene structure:

mRNA scaffold_115:336943..346322  ( + strand )
five_prime_UTR scaffold_115:336943..338060  ( + strand )
CDS scaffold_115:338061..338546  ( + strand )
CDS scaffold_115:338909..338963  ( + strand )
CDS scaffold_115:339316..339491  ( + strand )
CDS scaffold_115:339970..340170  ( + strand )
CDS scaffold_115:340427..340686  ( + strand )
CDS scaffold_115:340892..341202  ( + strand )
CDS scaffold_115:341424..341647  ( + strand )
CDS scaffold_115:342554..342942  ( + strand )
CDS scaffold_115:343157..343563  ( + strand )
CDS scaffold_115:343774..344015  ( + strand )
CDS scaffold_115:344145..345398  ( + strand )
three_prime_UTR scaffold_115:345399..346322  ( + strand )

Sequences:

Gene

>Mapoly0115s0036.1
GGGGCCGGAGCGCCCGGTGGCCGGGCGAGGCGGAATCCGCGGGACGTTATGCAACCAAGTACGGCCGGGGGTACTACGGACCGAGGGTCGAGAAACAGCGGTAGCATAGATCCGCCGGAAGGTGGGGGGCTCCAAGACCTCGTCCTCGTCGCCGACCGAGTGACTAGAGAGAGAGAGGGAGAGAGAGAATTCAGCGACCCTTCGCCTCGTCGCGGATTGGCGTGATCAAGTGGTGAAAACTGCTCGTCCCGACCAGCGAGCGGGATCGGGATCGGGATCGGGAGCAGGAACAGGAACAGGGGGTGGGGGTGGGGTTGGGGTGGAGTGGGGTGGGGGGCAGTGCGCGGAGAGCGAGATTCGACTGACGCGAGACCGGCGTGCTGCGGATCGTTTTTACGGATCGCGATTGGGGAGAGAATCACTAGCAGACGAGATCAGCAGCGCGAGAGAGAGATCGCACATTAGGATGATGATCCCGATCAATCCAGGTGTTCATGTGTACCTCGACTCGCGGTTTCCTTCCAGAAACCGATCCGAGGCCAACTCCAGGCCCATGCTGCGAATCTCTTGATTCTCTCGAACAGTTTCTGCTTCGGGACTTTCAGTTTTCGAGTTTCGAAGGTCTGAGATCCGGAGACGATTACTCCCACCAAAAATTGCTTTCCCGGAATTCAGATCTTCATCATAGCTTACGATGACTGCCTCGGCTCGCAATTGGCGACGAAATTGGCTTGCGTCGGAGACCATTAACGTACAAGAATGTCGTAGATCACCGCAACGAATGATGTTGTGTGTCTTTTGGAAGTGGCCCGTGGACATGTCTCCACGTTGGGCTTCGAAAGCGTGAGACAGTTCCAAGGGGGAACCGCAGTGCCCGTTCCGCCCGGACAGATCTGGTGACCATTGAGGGCACAATCATTTCGGCGAACCCTTGGACGATCACCGAGTTTCACACAATGAATCTTTCCACTCACGTGCATGAAGTGCATGAAGGGCTCGATGGCTTTTCCTGAACCTTCGAGAAGTGCACGCTCGGATTTTTCGTCGAAGAATTCTTGCTCTTCAGGTCACCACGATATAAACCCCGACAGTGTCACAGTTTTTCACCACAATCTGATATGGAATCCACGAAGGACGTCGAGAGTATTGCTGGACTCGAAGTGCCGCAGTCTGAAGGTAACTCCAGCCACTCCATGACGGCTGAAGCGAATTCTCCAGCACCACAACAACCCACGGCAGATCTCCAAGGCGGCGACCATGCAACCCCAGCCCCAGCCCCAGCACCAGCAACAGACCTGGTGAACGAGGGCAATCCCCAATCTGGAATCACGTTAGGAGAGAGATGGAAGAGGATAAGGGCGAAGCTCTTCCGCAGACGAGCAGCAACACATTTGAAACCTGCTGTCGTAAACCCTCAAGTGCCATTCTACAAACTCTTCATGTTCGCCGACTGGTGGGATTACCTGTTGATTGTTCTGGGCACGATCGGAGCGTGTGTGCATGGAGTTTCAGTGCCCATATTTTTCCTCTTTTTTGGAGCCCTGATCGACGCCTTTGGAGCAAATTACGCCAATCCACAAAAAATGGGGCAGGAAGTCAGCAAGGTGACTCACATGTACATGTCCCCCACCCATCGTTGCATGCGTTAAGCTTTGAGAAAGGTCACGCCATTTAGAGACTGGGATCCCAGAACCTAATAGTCGTCTCTGAGTCATCAGCAGACGAGTGGTTTTCAGATGAAAGTGGAAGCTTACAATTCTTAGAAGGATCAGAATCCTCCATGAAACTCTGGAAGAAGCAGTCAGGTCTCGAGTTCGTGTGAATTTGCATACACCATAGCTGGAGAGGTAAATCAGACTTGAAAAACTATCGAAGAGAACATTGAAGGCCCTTACATGGGATGGGATGTTGCATATGCCAAGGACTGACGCTAACACACATCTTGCCTGTTTTGCTCGTGTGACAGTACGCCTTGTATTTGTTTTACCTCGGCTGCGTAGTTTTGGGCGCTTCCTGGCTGGGTACGTAATTGTGAACTGATTTGGACAATATGCATGCTAGAGAGCTTTTAGACATGTGTTATTTCCATCTGCTTGCAGAGTTTCACTTGTCTCCTCCAACGATGGCGTAATCAAGGTCAGTTCAAATCGTACATCGTCCGTGCTTGATCAGATCACTACTGATCAGATGAATGCTGGCCAGCCAGAACTAACATGTTTGAAAGCATGGAAGTACTAGCGGTCTTGACGCATTTTGGAAGAAGTAGCAACCGAGTGGGTGGGTATAGATCACTTGGATGTCCAGAATTCCCCTGGATCCAGGAAGAGTATCAGCTGATTCTGCAATGGTGTGCGTGAATTGGATACTGTACAGAGATTTCAAGCTGGATACAAGCTGGCGAGAGACAAAGCTCACGCATGAGAACGAAATTTCTGAAAGCAGTTCTGAGTCAAGAGATCGCTTTTTTTGATCCCGATGGAACAACGAGCGCCATAGTCAATCGCATCTCCACAGACACTGCCTTTGTGCAAGACGCGATCAGCGAAAAGGTTATTTTAGTGCGTCGTCTTCTGACTTTTTTATTGAATCGAACTGTAGAATTGAATTTTACAATGTCTGGAGGAATTGAACACACTCATTATCAATGATAAGCATCATAGTCTTCTTTCCAGTAACGGAGCGCTTTATTACCTACAAAATTGGGTCCGATCATGAGATGCCCGGCTCGTCAAGTGTTAATCTGTGGGACCCATGGCTGCCTGCATTGAGTTCCGGCATGCAAACATATGCTGCACGGAGACAGCAGTGAAATTCAATCCATAAGTCACCGATCGCATGGCAGATAACATGTTACCCAGATAGCAGACAAGAATGTATATACTGACATCGGAAGCAGGGATAACTATGGGCCCACACAGGACACACTCTCCAACAGGCCTCCCTACACCTAAGAATCCAGGCAGCTCCAAATCCCCTGAGCAACAGAGCATGCTGCCAATGCTAACGATAGTGCAATTGGGCGTGCAGGCGGGAAACTACATCCATTTCATGGCGAAATTCATCGCTGGTTTCGTGGTGGCTTTCTGCTCGGTCTGGCAGCTCTCTCTCACAACTCTGGCCGTCGTTCCAGCCATAGTGCTAGCAGGTGCAGCCTACGCTCTGACTATGATTGGTCACGAAACGAAAAGTCTAGCAGCGTATGAAGAAGCTGGCAAGGTGGCTCAACAGGTATATCTCAGATTCGTCCATGCAGAGCCTGTATCCGCACGACACGTCTTGCCATGTATAGTTTCCAGACAGAGCACTTCCAAACAGAAAAATGCCAGACTGTTCTCAGCTCACCACAACTCATCTCTCCTACAAGTTTCAGGCCTTCACTTCGACCTTGAGGAAGCAATTCTGGCAGTAGGAAAGTACTGCATGAATGGAAATTCGTCTTTGTTATCTGACATGAGGTCTGTTTGCCACATGCTGGTGTGACAAGGTGGTAGCTCAAGTGCGTACGGTGTATTCTTTTGGGGGAGAAGCCAAGGCTGTACAAGAATATGCCAAAGCGCTACAAACTACGTTGAGGCTGGGCAAGCAAGGGGGTTTTGCCAAAGGACTGGGGCTGGGAGTGACTTACGGACTGACCGTGGGCGCATGGGCTCTCCTCCTCTGGTATTCCGGAATTCTCGTTCGAGCGGGAACTACAAATGGAGGCAAAGCGTTTACCACCATCCTCAACGTGATTGTTGGCGGGATGTAAGGTTTTCCTTAACAACCCCAAGCTGATGAAGCTGATGCTGATGCTTTGATGTAAAATCTTTAGTTCGCCTGAAGAAACTCTTACAGTCAAACACAGAATCTGCTCAGACTTTTTCCCAGAAATGTCATTTTTCTTTCCCGATAATTGTTTGTGGGACATCTGCGTGAATTGAAGTTCGCCACTCCATCATGGTCCATGCAGTGCTCTCGGACAAGCTGCTCCAAATCTGGCGTCCTTCTCGCGTGGAAAGTCAGCCGCTCACAATATTCTGGAGATGATTAACCGAAAGCCTGCAATCGATCAGACGACGGGGAGAAAGCTGACCAGCGTAAATGGCCAGATTGAATTCCAGGAAGTTTGTTTCAGTTATCCATCGCGAGCCGAAGTGGTTGTACTTCAGGACTTTAATCTCATAATTCCGCCAGGTAGAACTGTGGCGCTTGTCGGAAGCAGCGGTTCTGGTAAAAGCACCATCGTTGGCCTGATCGAGCGGTTTTACGAGCCCACTTCAGGTACGGCAGGAAACAATTTCTTCCACATCGACCAACAATCTGAAGAATCTTAAGGTTTCCAGGGGAGCATGGTTCCGAATTCCTCCATATTGTGCATGTACTTGGTCCTGGACAGGGTCCTCATCCCCAATTTGAGATGTGAGTTGAATGTACATTGCGTTGGAGACAATTCTGAACCAAAACCTTTTCGAAAATCTCATAATCAATGTCGAACTCTGTAGGAAAAGTTCTGTTGGACGGGCGGAATATCCAGCGTCTGCACCTGAAGTGGTTAAGACAGCAGATGGGCCTCGTGAACCAGGAACCTGCTCTATTTGCCACCAGCATTTGGGAGAATCTTCTATATGGCAAGGGGACTGCCAGCAAGGAAGAAGTTCTGGCTGCTACAACAGCTGCAAATGCACACAGCTTCATCAGCCAGTTGCCATCGGGCTATGATACGCAGGTTACTAAGCCGTCAAACCCTCAATTCGAAACTCACTTCTTCCAAGAATTCCTCCTCGTCTTTGCAATTGAGTTCGCTAATTTCTCTGAGCAGCTTTTAGGACTGATGTACTGGGTGCTACTGCAATTCCCCGAACCTTGCCTTCTTCCTTCTGCTTAGGTCTGTACCGCATAACCCCTGCTTACTGCTACAGGTTCGGGCATTCACTCCAGGCCTGAAACCTTGAAACGCTCTGAAGCGCCCTTCTTTTGCCATTTGTGTAGATATATTATCGTCAACCAGGACCTGTCTGAGCTTTCGACCAACGCTTATATAGTGGAAGTAAGTGACTTTCAAGATAATAGAGTCGACGGTGGATTGAGGACCTAAGTGGACAACTTAAAAAATCTAAGAGATCAGACATGAACACAAAGTTATAATTAAATGAGTCAGACAACAACACGATTGCCAGCGAATTCCCGGCCTGTTAGTATTGATATTGAGGAGCAAACACAGTCGTTATATTCAGCAGTCTTACCTGGGTCTCGATAAGATGCAAAGTTTGTTGTTGCTTTTCGCAGCGAACATATAAATTTCTCAGTGAACAAGGCTCTCCTCTGTCACTTCAATCTGTGAATCTGGAATACACACGAAAATTCCAATGCACTTATTGTAATATAGTGTTGTTTCTAGATTTGGACGATTTCTGTAAGTTCTAAATGTCCAAATAAGTAAAGATTTAGCAGCATTGTACCGTGACACCTCCATGTTGAGGTGTGTGTGTCTCTCTCTATCTCTCTCTGTCTGTAAGCAGATAACTCTTGATAGCAACAGAAACCTTCTGGCTTCCAAATTTCGAGTTGTTACAGGCACATGAATTATATGCCCATGATCTAAGCCTCGGAAGAATGATGTGTATCTATGCAGGTGGGGGAGAGAGGTGTGCAACTCTCCGGAGGCCAAAGGCAGAGGATAGCAATCGCTCGAGCCATGTTAAAGGACCCGAAGATCTTACTCTTAGACGAGGCTACTAGTGCTTTAGACCCTGGTTCCCAGCAAATTGTGCAAGAAGCTATAGATCGGTTGATGGTTGGCCGGACAACTGTGGTGGTAACCCATCAACTAGCAGCAGTCCGGAAAGCGGATATCATCGGGGTCATGCACAACGGGACCTTGATTGAGATCGGCACTCACGAAGAGTTGTTAGAATTGGGCGAAAGAGGTACCTACGCAGGGTTGGTGAGGTTACAAGAGGCAGGCTACTACGCACAAGGAGGGAGTCTAGTTCCAGGATTCAAACAGCACTTGAAAGTTGGGTAAGTTCTTCACTCTGTGCTCCGTGAATTAGTTCAGTGCTCGTTTGGATGAGATTACATCCCAGCATGTCAGTCTACTACCAGTGGTCGCATTGACTTGGACTCCATGATTTAGCTCGTACACAGAGTCAGAGTGTCATCATCTGCAAAGCACAATGAAACGAGAAATTAAGCTACGAAGTCATTCGACCCTCTGACGCTGCATTTTTTGCAGGGAGGAGATTTTGTCTGCTCCTGCGAAGGAGTCCAAGAGAGGTCCTATCAAAGGACTTGCGGAAGGAGTATCAGAGCTCCGAGAGTCTGACACCCCGTGCAACGAAGGGCCCGTTCTATGGCGACTGCTGAAGTTGAACTCCTCCGAATGGCACTACGGCCTGCTGGGCACGATCGGAGCAATCATCGCCGGTTGCGAATTTCCCTTGGTTGCGCTGACGATCGGCCAGGTTCTGACGAGCTTCTACAATCCTGACAAAAACTACATGGAACGCGAGGTGCGGAAGTATACCTTGATGTTCACCGCGGCCATCGTGGTCGTCATCATGGGCCACCTGCTTCAACATTTCTACTTCGCTGCCATGGGCGAGACCCTCACCGCGCGCGTTCGAAAAATGATGTTTTCAGGTGAATTTTACGAAAGAAATCGACACAGCCTCTTGTGTACCAGAATCTTTCTCGAGCTCCATTCCTTTCTGATCTGCAATGCACACGAATGATTGTCCAAATTCTCCTGTCCAGTCTTCTAGATGCACGCAGGAAGGACGATTGTGATAGTAAATGTGACTGAACAGAATCACCTAAACTCGACTCGCTGAACTGAACTGAATCGTTCAGGTATCCTACGGAACGAGATGGGCTGGTACGACAGAGAGGAGAGCAACAGCAATGTCCTGGCGCTGTCTCTCGCAACCGATGCAACATCGGTGCGGGCGGCCATTGCCGACCGGATCTGCATCGTCGTGCAGAACATATCTCTAGTGGCGACGGCGTTCGTGATCGCATTCTTTCTGCAATGGCGAGTGGCTTGCGTCATGTTCGCCACGTTCCCTCTGCTGATCGCATCTCTGGTGGGCGAGGTACGAGTCTGCACCTTTTGCTCGTTGTTCCATGTCTGATCAGAAAGAAAGAAGCTGCAGATTGCACGACCATGTGTGGCATGTGTGCTGAACTGCGGCAATCCTGACAGAAGTGTTGATACATTTCAGAACTTTTTCTTGAGGGGATTCAGTGGGGACTTGACCAAGGCGTATGCGAGAGCGAGCGCAACCGTAGGTGAGGCAGTCGGTAACATCCACACTGTGGCGGCCTTCTGTGCAGAGGACAAGGTCGTCGATCTGTTCAACAGAGAGCTCAAAGTGCCGCAGAGAAACGCCACCCTCCGAGCTCACATCGCAGGCGTCGGCTATGGGCTGTCGCAATTCTTCATGTACGGCTCGTACGCAGTGGCCCTCTGGTACGCCTCGTCGCTCGTCATGAAGCGCGAGGCCACGTTCGGCGACTCGATCAAGATCATCATGGTGCTGATCTTCGCCGCCTTCGGAGTGGCCGAAACCATCGCCATGGCGCCGGACTTCGTCAAAGGCGACCAGGCCCTTCTCTCGGTCTTCAAGATCCTCGATCGCAAGACGGAGATCGACCCCGACGATCCGAAATCCGAGAAGCTCACCGAAGTGCAAGGCGAGATCGAATTCCACAGCGTGGCCTTCAATTACCCGATGCGGCCGACGGTGTCTGTCTTCAAGGACTTGAGCCTGAGAGTGCGTGCAGGCACGAGCTTGGCATTGGTCGGAGAGAGCGGATCCGGCAAGAGCTCGGTGATCGCGCTGATCCAGCGATTCTACAATCCCATCTCCGGAACCATTTGCATCGATGGCAAGGACGTGATGAGGCTGAATGTCCGATCGCTGCGGCAGCACATCGGCGTGGTGCAGCAGGAGCCTGCGCTCTTCGCCGCCAGCATCCACGACAACATTCTGTACGGGAAGGAGAGCGCATCGGAGAGCGAGGTCGTCGAGGCAGCGAAGACGGCCAACGCGCACAACTTCGTGAGCGCATTGCCGCAGGGCTATGAGACATCGGTCGGGGACAGAGGAATCAAGCTCTCGGGAGGGCAGAAACAGCGAGTGGCCATCGCCAGGGCGGTGATCCGAAGCCCTGCGATCCTGCTGCTCGACGAGGCGACGAGTGCGCTCGATGCGGAGTCGGAGAAACTCGTGCAACAAGCGCTCGATCGGATCATGAAAGGCCGCACGACCGTCATCATCGCGCACCGATTGTCGACCATTCGCAACGCCGACAGGATCGCCATGATGCGAAACGGCCACATTCTCGAACTCGGCACGCACGACGACCTCATGGGCCTCGACGGCGCGTACGCTCGATTCGTCCACATGCAGCAGTTCCGATGCCCTGCTTCGCTGTCGTTCACTCTCGACAGCGATCCCGCGCTCTTGAACTAGAATTTCTCCGCAAATTCCGATGTATCTCGGCGAAATATCTTCATTTCTGACTGTCGACGATCGATTCATGCTCTCGCGTCGACATGAACAAGAAGGTAGTCAGTCAATCAGTCAGTCAGTCTCGTTCACGCCCACAATTTGGTCGTGGAGGAGTAAACTCGGGAATTTCAACCTCACCTCCCGATTCCGAGGTGAGCTCGTACTGGCGCTAATTAAAATCCTGTCCTTCTCTGTCGGGCAATCACTTCGTGTAAATAAAATTTCGGCCACCCGGAGTATCATCTCTCTTGGAATTCGAGAAGAAGATGGCAAGCATAACCTGCGAAGAATTGGAGGGAACTGCGGAGGAGAGCCAAGACGTAACCTGAAGATCGGACTGCTGGCCTGCCTCAAAATATTTGGCTCGCCGTAATTTGGAACGATGGATGCTCTGCCCGAAAGAACAGAAGGAATTGATTGAGGACATAATTTCACCGTCGTGCGAATTGAGGTTCAGAAGAGCCAATTGATCGACCCAATTCTCTGATCTGCTTCGCGCCAACATCCATCGAACGATCGATCGATCTTCAGGAAAGACGTCTCCATTCTTTGCTCCAATTCGAGTACAGCCTCGAGTGAAATCAGACTCACTCGTTGAATGCGAAGCGCCGAATTCGAGCAGATTTAGCGCCGAGGGCAGTTATGCAAGCGAAGGAACTGTAGCCGTTGCCGGACAAGGGAGTAGATGGGTGGATGGATGGATACTCGGCGCAGTCGTTGTCAGTAGCGATTATTTTCACTTCTCGTTGTTACAAGTCTAAAGAGATTCCGGAGCCATAATGTAGAGGCAGTCTATGTATTTGATCTCTTGTCTTCGATATTTCTTCTCTTTCAGAGAGAAGCCCTGTAAATAATGAAACCTCTCGAGCTTCTGATTTTCGCAAC

mRNA

>Mapoly0115s0036.1
GGGGCCGGAGCGCCCGGTGGCCGGGCGAGGCGGAATCCGCGGGACGTTATGCAACCAAGTACGGCCGGGGGTACTACGGACCGAGGGTCGAGAAACAGCGGTAGCATAGATCCGCCGGAAGGTGGGGGGCTCCAAGACCTCGTCCTCGTCGCCGACCGAGTGACTAGAGAGAGAGAGGGAGAGAGAGAATTCAGCGACCCTTCGCCTCGTCGCGGATTGGCGTGATCAAGTGGTGAAAACTGCTCGTCCCGACCAGCGAGCGGGATCGGGATCGGGATCGGGAGCAGGAACAGGAACAGGGGGTGGGGGTGGGGTTGGGGTGGAGTGGGGTGGGGGGCAGTGCGCGGAGAGCGAGATTCGACTGACGCGAGACCGGCGTGCTGCGGATCGTTTTTACGGATCGCGATTGGGGAGAGAATCACTAGCAGACGAGATCAGCAGCGCGAGAGAGAGATCGCACATTAGGATGATGATCCCGATCAATCCAGGTGTTCATGTGTACCTCGACTCGCGGTTTCCTTCCAGAAACCGATCCGAGGCCAACTCCAGGCCCATGCTGCGAATCTCTTGATTCTCTCGAACAGTTTCTGCTTCGGGACTTTCAGTTTTCGAGTTTCGAAGGTCTGAGATCCGGAGACGATTACTCCCACCAAAAATTGCTTTCCCGGAATTCAGATCTTCATCATAGCTTACGATGACTGCCTCGGCTCGCAATTGGCGACGAAATTGGCTTGCGTCGGAGACCATTAACGTACAAGAATGTCGTAGATCACCGCAACGAATGATGTTGTGTGTCTTTTGGAAGTGGCCCGTGGACATGTCTCCACGTTGGGCTTCGAAAGCGTGAGACAGTTCCAAGGGGGAACCGCAGTGCCCGTTCCGCCCGGACAGATCTGGTGACCATTGAGGGCACAATCATTTCGGCGAACCCTTGGACGATCACCGAGTTTCACACAATGAATCTTTCCACTCACGTGCATGAAGTGCATGAAGGGCTCGATGGCTTTTCCTGAACCTTCGAGAAGTGCACGCTCGGATTTTTCGTCGAAGAATTCTTGCTCTTCAGGTCACCACGATATAAACCCCGACAGTGTCACAGTTTTTCACCACAATCTGATATGGAATCCACGAAGGACGTCGAGAGTATTGCTGGACTCGAAGTGCCGCAGTCTGAAGGTAACTCCAGCCACTCCATGACGGCTGAAGCGAATTCTCCAGCACCACAACAACCCACGGCAGATCTCCAAGGCGGCGACCATGCAACCCCAGCCCCAGCCCCAGCACCAGCAACAGACCTGGTGAACGAGGGCAATCCCCAATCTGGAATCACGTTAGGAGAGAGATGGAAGAGGATAAGGGCGAAGCTCTTCCGCAGACGAGCAGCAACACATTTGAAACCTGCTGTCGTAAACCCTCAAGTGCCATTCTACAAACTCTTCATGTTCGCCGACTGGTGGGATTACCTGTTGATTGTTCTGGGCACGATCGGAGCGTGTGTGCATGGAGTTTCAGTGCCCATATTTTTCCTCTTTTTTGGAGCCCTGATCGACGCCTTTGGAGCAAATTACGCCAATCCACAAAAAATGGGGCAGGAAGTCAGCAAGTACGCCTTGTATTTGTTTTACCTCGGCTGCGTAGTTTTGGGCGCTTCCTGGCTGGAGATTTCAAGCTGGATACAAGCTGGCGAGAGACAAAGCTCACGCATGAGAACGAAATTTCTGAAAGCAGTTCTGAGTCAAGAGATCGCTTTTTTTGATCCCGATGGAACAACGAGCGCCATAGTCAATCGCATCTCCACAGACACTGCCTTTGTGCAAGACGCGATCAGCGAAAAGGCGGGAAACTACATCCATTTCATGGCGAAATTCATCGCTGGTTTCGTGGTGGCTTTCTGCTCGGTCTGGCAGCTCTCTCTCACAACTCTGGCCGTCGTTCCAGCCATAGTGCTAGCAGGTGCAGCCTACGCTCTGACTATGATTGGTCACGAAACGAAAAGTCTAGCAGCGTATGAAGAAGCTGGCAAGGTGGCTCAACAGGTGGTAGCTCAAGTGCGTACGGTGTATTCTTTTGGGGGAGAAGCCAAGGCTGTACAAGAATATGCCAAAGCGCTACAAACTACGTTGAGGCTGGGCAAGCAAGGGGGTTTTGCCAAAGGACTGGGGCTGGGAGTGACTTACGGACTGACCGTGGGCGCATGGGCTCTCCTCCTCTGGTATTCCGGAATTCTCGTTCGAGCGGGAACTACAAATGGAGGCAAAGCGTTTACCACCATCCTCAACGTGATTGTTGGCGGGATTGCTCTCGGACAAGCTGCTCCAAATCTGGCGTCCTTCTCGCGTGGAAAGTCAGCCGCTCACAATATTCTGGAGATGATTAACCGAAAGCCTGCAATCGATCAGACGACGGGGAGAAAGCTGACCAGCGTAAATGGCCAGATTGAATTCCAGGAAGTTTGTTTCAGTTATCCATCGCGAGCCGAAGTGGTTGTACTTCAGGACTTTAATCTCATAATTCCGCCAGGTAGAACTGTGGCGCTTGTCGGAAGCAGCGGTTCTGGTAAAAGCACCATCGTTGGCCTGATCGAGCGGTTTTACGAGCCCACTTCAGGAAAAGTTCTGTTGGACGGGCGGAATATCCAGCGTCTGCACCTGAAGTGGTTAAGACAGCAGATGGGCCTCGTGAACCAGGAACCTGCTCTATTTGCCACCAGCATTTGGGAGAATCTTCTATATGGCAAGGGGACTGCCAGCAAGGAAGAAGTTCTGGCTGCTACAACAGCTGCAAATGCACACAGCTTCATCAGCCAGTTGCCATCGGGCTATGATACGCAGGTGGGGGAGAGAGGTGTGCAACTCTCCGGAGGCCAAAGGCAGAGGATAGCAATCGCTCGAGCCATGTTAAAGGACCCGAAGATCTTACTCTTAGACGAGGCTACTAGTGCTTTAGACCCTGGTTCCCAGCAAATTGTGCAAGAAGCTATAGATCGGTTGATGGTTGGCCGGACAACTGTGGTGGTAACCCATCAACTAGCAGCAGTCCGGAAAGCGGATATCATCGGGGTCATGCACAACGGGACCTTGATTGAGATCGGCACTCACGAAGAGTTGTTAGAATTGGGCGAAAGAGGTACCTACGCAGGGTTGGTGAGGTTACAAGAGGCAGGCTACTACGCACAAGGAGGGAGTCTAGTTCCAGGATTCAAACAGCACTTGAAAGTTGGGGAGGAGATTTTGTCTGCTCCTGCGAAGGAGTCCAAGAGAGGTCCTATCAAAGGACTTGCGGAAGGAGTATCAGAGCTCCGAGAGTCTGACACCCCGTGCAACGAAGGGCCCGTTCTATGGCGACTGCTGAAGTTGAACTCCTCCGAATGGCACTACGGCCTGCTGGGCACGATCGGAGCAATCATCGCCGGTTGCGAATTTCCCTTGGTTGCGCTGACGATCGGCCAGGTTCTGACGAGCTTCTACAATCCTGACAAAAACTACATGGAACGCGAGGTGCGGAAGTATACCTTGATGTTCACCGCGGCCATCGTGGTCGTCATCATGGGCCACCTGCTTCAACATTTCTACTTCGCTGCCATGGGCGAGACCCTCACCGCGCGCGTTCGAAAAATGATGTTTTCAGGTATCCTACGGAACGAGATGGGCTGGTACGACAGAGAGGAGAGCAACAGCAATGTCCTGGCGCTGTCTCTCGCAACCGATGCAACATCGGTGCGGGCGGCCATTGCCGACCGGATCTGCATCGTCGTGCAGAACATATCTCTAGTGGCGACGGCGTTCGTGATCGCATTCTTTCTGCAATGGCGAGTGGCTTGCGTCATGTTCGCCACGTTCCCTCTGCTGATCGCATCTCTGGTGGGCGAGAACTTTTTCTTGAGGGGATTCAGTGGGGACTTGACCAAGGCGTATGCGAGAGCGAGCGCAACCGTAGGTGAGGCAGTCGGTAACATCCACACTGTGGCGGCCTTCTGTGCAGAGGACAAGGTCGTCGATCTGTTCAACAGAGAGCTCAAAGTGCCGCAGAGAAACGCCACCCTCCGAGCTCACATCGCAGGCGTCGGCTATGGGCTGTCGCAATTCTTCATGTACGGCTCGTACGCAGTGGCCCTCTGGTACGCCTCGTCGCTCGTCATGAAGCGCGAGGCCACGTTCGGCGACTCGATCAAGATCATCATGGTGCTGATCTTCGCCGCCTTCGGAGTGGCCGAAACCATCGCCATGGCGCCGGACTTCGTCAAAGGCGACCAGGCCCTTCTCTCGGTCTTCAAGATCCTCGATCGCAAGACGGAGATCGACCCCGACGATCCGAAATCCGAGAAGCTCACCGAAGTGCAAGGCGAGATCGAATTCCACAGCGTGGCCTTCAATTACCCGATGCGGCCGACGGTGTCTGTCTTCAAGGACTTGAGCCTGAGAGTGCGTGCAGGCACGAGCTTGGCATTGGTCGGAGAGAGCGGATCCGGCAAGAGCTCGGTGATCGCGCTGATCCAGCGATTCTACAATCCCATCTCCGGAACCATTTGCATCGATGGCAAGGACGTGATGAGGCTGAATGTCCGATCGCTGCGGCAGCACATCGGCGTGGTGCAGCAGGAGCCTGCGCTCTTCGCCGCCAGCATCCACGACAACATTCTGTACGGGAAGGAGAGCGCATCGGAGAGCGAGGTCGTCGAGGCAGCGAAGACGGCCAACGCGCACAACTTCGTGAGCGCATTGCCGCAGGGCTATGAGACATCGGTCGGGGACAGAGGAATCAAGCTCTCGGGAGGGCAGAAACAGCGAGTGGCCATCGCCAGGGCGGTGATCCGAAGCCCTGCGATCCTGCTGCTCGACGAGGCGACGAGTGCGCTCGATGCGGAGTCGGAGAAACTCGTGCAACAAGCGCTCGATCGGATCATGAAAGGCCGCACGACCGTCATCATCGCGCACCGATTGTCGACCATTCGCAACGCCGACAGGATCGCCATGATGCGAAACGGCCACATTCTCGAACTCGGCACGCACGACGACCTCATGGGCCTCGACGGCGCGTACGCTCGATTCGTCCACATGCAGCAGTTCCGATGCCCTGCTTCGCTGTCGTTCACTCTCGACAGCGATCCCGCGCTCTTGAACTAGAATTTCTCCGCAAATTCCGATGTATCTCGGCGAAATATCTTCATTTCTGACTGTCGACGATCGATTCATGCTCTCGCGTCGACATGAACAAGAAGGTAGTCAGTCAATCAGTCAGTCAGTCTCGTTCACGCCCACAATTTGGTCGTGGAGGAGTAAACTCGGGAATTTCAACCTCACCTCCCGATTCCGAGGTGAGCTCGTACTGGCGCTAATTAAAATCCTGTCCTTCTCTGTCGGGCAATCACTTCGTGTAAATAAAATTTCGGCCACCCGGAGTATCATCTCTCTTGGAATTCGAGAAGAAGATGGCAAGCATAACCTGCGAAGAATTGGAGGGAACTGCGGAGGAGAGCCAAGACGTAACCTGAAGATCGGACTGCTGGCCTGCCTCAAAATATTTGGCTCGCCGTAATTTGGAACGATGGATGCTCTGCCCGAAAGAACAGAAGGAATTGATTGAGGACATAATTTCACCGTCGTGCGAATTGAGGTTCAGAAGAGCCAATTGATCGACCCAATTCTCTGATCTGCTTCGCGCCAACATCCATCGAACGATCGATCGATCTTCAGGAAAGACGTCTCCATTCTTTGCTCCAATTCGAGTACAGCCTCGAGTGAAATCAGACTCACTCGTTGAATGCGAAGCGCCGAATTCGAGCAGATTTAGCGCCGAGGGCAGTTATGCAAGCGAAGGAACTGTAGCCGTTGCCGGACAAGGGAGTAGATGGGTGGATGGATGGATACTCGGCGCAGTCGTTGTCAGTAGCGATTATTTTCACTTCTCGTTGTTACAAGTCTAAAGAGATTCCGGAGCCATAATGTAGAGGCAGTCTATGTATTTGATCTCTTGTCTTCGATATTTCTTCTCTTTCAGAGAGAAGCCCTGTAAATAATGAAACCTCTCGAGCTTCTGATTTTCGCAAC

CDS

>Mapoly0115s0036.1
ATGGAATCCACGAAGGACGTCGAGAGTATTGCTGGACTCGAAGTGCCGCAGTCTGAAGGTAACTCCAGCCACTCCATGACGGCTGAAGCGAATTCTCCAGCACCACAACAACCCACGGCAGATCTCCAAGGCGGCGACCATGCAACCCCAGCCCCAGCCCCAGCACCAGCAACAGACCTGGTGAACGAGGGCAATCCCCAATCTGGAATCACGTTAGGAGAGAGATGGAAGAGGATAAGGGCGAAGCTCTTCCGCAGACGAGCAGCAACACATTTGAAACCTGCTGTCGTAAACCCTCAAGTGCCATTCTACAAACTCTTCATGTTCGCCGACTGGTGGGATTACCTGTTGATTGTTCTGGGCACGATCGGAGCGTGTGTGCATGGAGTTTCAGTGCCCATATTTTTCCTCTTTTTTGGAGCCCTGATCGACGCCTTTGGAGCAAATTACGCCAATCCACAAAAAATGGGGCAGGAAGTCAGCAAGTACGCCTTGTATTTGTTTTACCTCGGCTGCGTAGTTTTGGGCGCTTCCTGGCTGGAGATTTCAAGCTGGATACAAGCTGGCGAGAGACAAAGCTCACGCATGAGAACGAAATTTCTGAAAGCAGTTCTGAGTCAAGAGATCGCTTTTTTTGATCCCGATGGAACAACGAGCGCCATAGTCAATCGCATCTCCACAGACACTGCCTTTGTGCAAGACGCGATCAGCGAAAAGGCGGGAAACTACATCCATTTCATGGCGAAATTCATCGCTGGTTTCGTGGTGGCTTTCTGCTCGGTCTGGCAGCTCTCTCTCACAACTCTGGCCGTCGTTCCAGCCATAGTGCTAGCAGGTGCAGCCTACGCTCTGACTATGATTGGTCACGAAACGAAAAGTCTAGCAGCGTATGAAGAAGCTGGCAAGGTGGCTCAACAGGTGGTAGCTCAAGTGCGTACGGTGTATTCTTTTGGGGGAGAAGCCAAGGCTGTACAAGAATATGCCAAAGCGCTACAAACTACGTTGAGGCTGGGCAAGCAAGGGGGTTTTGCCAAAGGACTGGGGCTGGGAGTGACTTACGGACTGACCGTGGGCGCATGGGCTCTCCTCCTCTGGTATTCCGGAATTCTCGTTCGAGCGGGAACTACAAATGGAGGCAAAGCGTTTACCACCATCCTCAACGTGATTGTTGGCGGGATTGCTCTCGGACAAGCTGCTCCAAATCTGGCGTCCTTCTCGCGTGGAAAGTCAGCCGCTCACAATATTCTGGAGATGATTAACCGAAAGCCTGCAATCGATCAGACGACGGGGAGAAAGCTGACCAGCGTAAATGGCCAGATTGAATTCCAGGAAGTTTGTTTCAGTTATCCATCGCGAGCCGAAGTGGTTGTACTTCAGGACTTTAATCTCATAATTCCGCCAGGTAGAACTGTGGCGCTTGTCGGAAGCAGCGGTTCTGGTAAAAGCACCATCGTTGGCCTGATCGAGCGGTTTTACGAGCCCACTTCAGGAAAAGTTCTGTTGGACGGGCGGAATATCCAGCGTCTGCACCTGAAGTGGTTAAGACAGCAGATGGGCCTCGTGAACCAGGAACCTGCTCTATTTGCCACCAGCATTTGGGAGAATCTTCTATATGGCAAGGGGACTGCCAGCAAGGAAGAAGTTCTGGCTGCTACAACAGCTGCAAATGCACACAGCTTCATCAGCCAGTTGCCATCGGGCTATGATACGCAGGTGGGGGAGAGAGGTGTGCAACTCTCCGGAGGCCAAAGGCAGAGGATAGCAATCGCTCGAGCCATGTTAAAGGACCCGAAGATCTTACTCTTAGACGAGGCTACTAGTGCTTTAGACCCTGGTTCCCAGCAAATTGTGCAAGAAGCTATAGATCGGTTGATGGTTGGCCGGACAACTGTGGTGGTAACCCATCAACTAGCAGCAGTCCGGAAAGCGGATATCATCGGGGTCATGCACAACGGGACCTTGATTGAGATCGGCACTCACGAAGAGTTGTTAGAATTGGGCGAAAGAGGTACCTACGCAGGGTTGGTGAGGTTACAAGAGGCAGGCTACTACGCACAAGGAGGGAGTCTAGTTCCAGGATTCAAACAGCACTTGAAAGTTGGGGAGGAGATTTTGTCTGCTCCTGCGAAGGAGTCCAAGAGAGGTCCTATCAAAGGACTTGCGGAAGGAGTATCAGAGCTCCGAGAGTCTGACACCCCGTGCAACGAAGGGCCCGTTCTATGGCGACTGCTGAAGTTGAACTCCTCCGAATGGCACTACGGCCTGCTGGGCACGATCGGAGCAATCATCGCCGGTTGCGAATTTCCCTTGGTTGCGCTGACGATCGGCCAGGTTCTGACGAGCTTCTACAATCCTGACAAAAACTACATGGAACGCGAGGTGCGGAAGTATACCTTGATGTTCACCGCGGCCATCGTGGTCGTCATCATGGGCCACCTGCTTCAACATTTCTACTTCGCTGCCATGGGCGAGACCCTCACCGCGCGCGTTCGAAAAATGATGTTTTCAGGTATCCTACGGAACGAGATGGGCTGGTACGACAGAGAGGAGAGCAACAGCAATGTCCTGGCGCTGTCTCTCGCAACCGATGCAACATCGGTGCGGGCGGCCATTGCCGACCGGATCTGCATCGTCGTGCAGAACATATCTCTAGTGGCGACGGCGTTCGTGATCGCATTCTTTCTGCAATGGCGAGTGGCTTGCGTCATGTTCGCCACGTTCCCTCTGCTGATCGCATCTCTGGTGGGCGAGAACTTTTTCTTGAGGGGATTCAGTGGGGACTTGACCAAGGCGTATGCGAGAGCGAGCGCAACCGTAGGTGAGGCAGTCGGTAACATCCACACTGTGGCGGCCTTCTGTGCAGAGGACAAGGTCGTCGATCTGTTCAACAGAGAGCTCAAAGTGCCGCAGAGAAACGCCACCCTCCGAGCTCACATCGCAGGCGTCGGCTATGGGCTGTCGCAATTCTTCATGTACGGCTCGTACGCAGTGGCCCTCTGGTACGCCTCGTCGCTCGTCATGAAGCGCGAGGCCACGTTCGGCGACTCGATCAAGATCATCATGGTGCTGATCTTCGCCGCCTTCGGAGTGGCCGAAACCATCGCCATGGCGCCGGACTTCGTCAAAGGCGACCAGGCCCTTCTCTCGGTCTTCAAGATCCTCGATCGCAAGACGGAGATCGACCCCGACGATCCGAAATCCGAGAAGCTCACCGAAGTGCAAGGCGAGATCGAATTCCACAGCGTGGCCTTCAATTACCCGATGCGGCCGACGGTGTCTGTCTTCAAGGACTTGAGCCTGAGAGTGCGTGCAGGCACGAGCTTGGCATTGGTCGGAGAGAGCGGATCCGGCAAGAGCTCGGTGATCGCGCTGATCCAGCGATTCTACAATCCCATCTCCGGAACCATTTGCATCGATGGCAAGGACGTGATGAGGCTGAATGTCCGATCGCTGCGGCAGCACATCGGCGTGGTGCAGCAGGAGCCTGCGCTCTTCGCCGCCAGCATCCACGACAACATTCTGTACGGGAAGGAGAGCGCATCGGAGAGCGAGGTCGTCGAGGCAGCGAAGACGGCCAACGCGCACAACTTCGTGAGCGCATTGCCGCAGGGCTATGAGACATCGGTCGGGGACAGAGGAATCAAGCTCTCGGGAGGGCAGAAACAGCGAGTGGCCATCGCCAGGGCGGTGATCCGAAGCCCTGCGATCCTGCTGCTCGACGAGGCGACGAGTGCGCTCGATGCGGAGTCGGAGAAACTCGTGCAACAAGCGCTCGATCGGATCATGAAAGGCCGCACGACCGTCATCATCGCGCACCGATTGTCGACCATTCGCAACGCCGACAGGATCGCCATGATGCGAAACGGCCACATTCTCGAACTCGGCACGCACGACGACCTCATGGGCCTCGACGGCGCGTACGCTCGATTCGTCCACATGCAGCAGTTCCGATGCCCTGCTTCGCTGTCGTTCACTCTCGACAGCGATCCCGCGCTCTTGAACTAG

Protein

>Mapoly0115s0036.1
MESTKDVESIAGLEVPQSEGNSSHSMTAEANSPAPQQPTADLQGGDHATPAPAPAPATDLVNEGNPQSGITLGERWKRIRAKLFRRRAATHLKPAVVNPQVPFYKLFMFADWWDYLLIVLGTIGACVHGVSVPIFFLFFGALIDAFGANYANPQKMGQEVSKYALYLFYLGCVVLGASWLEISSWIQAGERQSSRMRTKFLKAVLSQEIAFFDPDGTTSAIVNRISTDTAFVQDAISEKAGNYIHFMAKFIAGFVVAFCSVWQLSLTTLAVVPAIVLAGAAYALTMIGHETKSLAAYEEAGKVAQQVVAQVRTVYSFGGEAKAVQEYAKALQTTLRLGKQGGFAKGLGLGVTYGLTVGAWALLLWYSGILVRAGTTNGGKAFTTILNVIVGGIALGQAAPNLASFSRGKSAAHNILEMINRKPAIDQTTGRKLTSVNGQIEFQEVCFSYPSRAEVVVLQDFNLIIPPGRTVALVGSSGSGKSTIVGLIERFYEPTSGKVLLDGRNIQRLHLKWLRQQMGLVNQEPALFATSIWENLLYGKGTASKEEVLAATTAANAHSFISQLPSGYDTQVGERGVQLSGGQRQRIAIARAMLKDPKILLLDEATSALDPGSQQIVQEAIDRLMVGRTTVVVTHQLAAVRKADIIGVMHNGTLIEIGTHEELLELGERGTYAGLVRLQEAGYYAQGGSLVPGFKQHLKVGEEILSAPAKESKRGPIKGLAEGVSELRESDTPCNEGPVLWRLLKLNSSEWHYGLLGTIGAIIAGCEFPLVALTIGQVLTSFYNPDKNYMEREVRKYTLMFTAAIVVVIMGHLLQHFYFAAMGETLTARVRKMMFSGILRNEMGWYDREESNSNVLALSLATDATSVRAAIADRICIVVQNISLVATAFVIAFFLQWRVACVMFATFPLLIASLVGENFFLRGFSGDLTKAYARASATVGEAVGNIHTVAAFCAEDKVVDLFNRELKVPQRNATLRAHIAGVGYGLSQFFMYGSYAVALWYASSLVMKREATFGDSIKIIMVLIFAAFGVAETIAMAPDFVKGDQALLSVFKILDRKTEIDPDDPKSEKLTEVQGEIEFHSVAFNYPMRPTVSVFKDLSLRVRAGTSLALVGESGSGKSSVIALIQRFYNPISGTICIDGKDVMRLNVRSLRQHIGVVQQEPALFAASIHDNILYGKESASESEVVEAAKTANAHNFVSALPQGYETSVGDRGIKLSGGQKQRVAIARAVIRSPAILLLDEATSALDAESEKLVQQALDRIMKGRTTVIIAHRLSTIRNADRIAMMRNGHILELGTHDDLMGLDGAYARFVHMQQFRCPASLSFTLDSDPALLN

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>