Mapoly0122s0020



Description

Basic region leucine zipper

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_170423
PFAM PF07716 Basic region leucine zipper

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP13 transcription factor, bZIP Mapoly0122s0020.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0122s0020.1 scaffold_122:192973..196676  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0122s0020.2 scaffold_122:192973..196437  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0122s0020.1  

Gene structure:

mRNA scaffold_122:192973..196676  ( + strand )
five_prime_UTR scaffold_122:192973..193493  ( + strand )
five_prime_UTR scaffold_122:193780..194189  ( + strand )
CDS scaffold_122:194190..195662  ( + strand )
three_prime_UTR scaffold_122:195663..196676  ( + strand )

Sequences:

Gene

>Mapoly0122s0020.1
GTGGAGGGGGCGTAGAGGACGGGGTGTGGGATGGCTATGGCGGGGCTGGTCCACAGGCAGGCCCCAAGGTGCTTACCGTATTTAAAATTCCGCGACCGCGAGGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAAGCGCAGGTCGGCGAAAGAAATCCGAGGCACGGCCGGGCTCAGAGCCCAGAGCAGAACGCGACCGGGTCCCTGGAGGCTGGACGCGAGCAGCAGCAGAGAAGTGCGGGGCACGAGCATGAGCCGAGTTCAGGAAATCCCAATTGCCCTCGGTCTCTTTTGCTGGTGGTGGTGCTGCAGCTATTGCTATTTCTTCGCTGGGAAGGCTAAAGAAGTAACCTCGTAGTGAGCGATATCGAGACAGAGAGAGAGAGAGAGAGGGAGAGAGCGCGAGCGAGCGATCGGCAGGATCTTCCGGGCGCAGCAGCTTCAAGAACGACATCGCAGCTGGATAGTCTCGAAGATTCTCTTTCGAGTGCAGAGGTGAGAAATCGAGCTTCTCGTGAGGAGGAGGAGGAGGAGGTGGTGCATGAGAGAAATGGCGGGACTGGAATAAAGTGCAGTTGATTGAGGAATTGATTGGGGAGTGAGATAAGAACGAGAAAGAGGGCTAGGTGAAGAACCACAAAGTCTTGTTTTTCCTGCGCTGTGGAGAGGAGGGGTGCAATCGGGGTGAAGGGGGATTGATTCTGGAGGGGAGAGGATAGTGTCGATGAGGTTTGTGTTAACCGGTGTCTTTGTTGCTTCGTGTTATTGGGCTTGAGACCAGGCGCTAGGGAAGAGAGGCGAGTCGAGGAGAGTAGAGGAGAGAAGACGACGCAGGGTGAAGAGAAGTGAAATCGAGTACATTGTCTAGGGTATTCAAATGACTGACTGCCTTGTTTTGTCTTCGGGGCCGGATGGTGAGAATTTAGGGAGAGGAAGGAAGATGAAGGGAAGGAAGGAAGCGATGATGGTAATGATCGGGTGGTTGCATTGTGGTGCGAATTGCCTTGTGAAGGAAGTGGTTTTTGATATTGATGATGGTGCAGGGTCGTTCTGTTGGAAGTGGTGGAGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGTAAGAAGACGAAGAAGCAGAAGAAGATTTGCAGTGTTGCGTGAAGGGGAGCGGAGTTGAAGCGGTCGTGGGTTATGATGGACGACGGGGAGGTCGATTCTCCGGATTCAGGAGGGTTACGGGGTCTGCAATCTAGCGATTACTCGCATTTTCTGGATGATAGTAGTATCATTCAGAGTGATTGGGACAATCTCATGCGAACGACGCAAGTGTGCTCTCACAAACATATTTGCAATCCTACAACAGGTCCCGACAACACTCACACCCATACGTGCGAGCACACTCACACGCATACGATCGCCAGCGGAGACGAGGAGAAGCTGACCAAGAAGAAACGACCTTCAGGTAACAAGGAAGCCGTCAGGAAGTACAGGGAGAAGCAAAAGGCCGTCAAGGTCAATCTCGAAGTCAGAAACGCGGAACTGGAGAAGGAGAATTCCAAGATTCCCGAGCTCTTGAAAGAGAATCTCAGACTTCGACGGAAATTGTTGGAGCAGGTGCCCACCCAAGCTGCATTGGACCAGTCTAACGCCGAAAATAAGAGGCTCAAGACTCTTCTCCTTCATCTGAGGCGACTCATCGATTCGGAGCTGGACTCCACAAGCCTTCAGAAACACCCTCTCAACCTCGCCACCAGAGTCGACGGTTGTGCTTCCGGACAGGCCCACCTTCCTCCTGGCAATTACTACTCCTCCGTGGTGCCATGTGCCGCGCCTCTGCCATGTTACCCAGCCCGGCCAGCATCTCAGACCGGGGTCACGGATCTTGATCGCATGGCAAGTGTCGGATGGCACACTGAGTGCGAGCATGTGAACACCGTGTGTCACGATCCAGAGTCGGAAGCCCACGTGGTGTCTGCCCAGTGCACACCGTTTCATGCCGAAGGTAGCACTAAAGCCGCCTGTAATGCATCTGTCTCGAATCACAAAAGCAATGTCGTCGGCTTCGTTAAAGGCGCCAGGCGGAGGAGCAACTCCTCACATCCCATTCCAATTGCCTATCATGCTGGCGGAGTGCCCTGCGCCGCTCCAGTCCCTTGTTTCAATGGCCTCAAGGCTGTGAACCAACCGGAATTGATCCAGCAACAGCGCGTCGAGAACCTTAGCTGGGAAGGGGGCTGTGAAATTATGACTGATATGTGCCAGGATACTGAAATGACCGCCGACTCCAGTCCTCATTGCACTGCATTGAGCCCTGAAGAAGTGACACAGAGTGCGAGCACGGTATCAAGGAAGGAGCCTGCTCTCACCTCATCTAAACTACGGGCTGAAGGTGACAGCCCTGAAGAGCAGATGTTTCCACCAGGAGGATATTTCCCCGAAGGACCGCAGTGCGGTGGACTTCCTCCTTGTTTTGGTTCAACACCCGGGTCCCAGACTTTTAGTGACAGTTGGTTTGAAGACTGCGACTTCATCAATGGTGTTTGCCAAGCTCACACTGGGGGAGCACAATCTAGCCAGGCAGTTGGTTCGTTCAGACCTGAAGATGCCACTCACAGCACCAGGTCAGCTTTGCCGACTGTATCTGAACCCATATGCCAGAAATGAGGGCGTAATGTGTGGATGCACTGGCTTGAAATTGGAGGCACTGCTGAGGCCAGCCTGTTTGATTTCATGTCACATCAGAGATGGTTTTTTGGGTAAGGAACAACAATCATTGTTCCCACTGAGTTTTTTCAAGGATTTGGCCACCGAGTGTTACTTAGTAGATGTGTCCCAGATTTACCCATGTGCTTTGAGCATTTTCTTGTAACTAGTTCTGTACCTGGATTTGCACAATGTGCTCAGTGTGATGAGATAAGACCTGTCGGGGCATCAACTCTCATTCGACGTGAAGGGCGACGAAGGGGAGGCAGTTTTTTGATGAGCACCAGTGCAACTAATTTTTGTAGGGAAATAAAAGTAGGTCGGAGGAGTCTCGCTTAGGAGGACAGTTTGACTGATTGCTCTGGTTCGCTGTCTGCACAATACATCTGCTGATTGAATTTTAACAGGTCATCAATAGATTATTACTTCTGTACAAATGTCGTTTCTCTAGAAGGGGATATTGAAAGCATATATATATGAGCTAGCGTATACTAGCCAGAACAAAACTGCCATGTCCTACTGAATGTCACGTAAATAGAGTCCTGAGAAGGAAGATTGTTGACAAGTTTCTGTACTTTTGACGATGGGAAGCTGGGTGCTAAGATGTCGAAGGTCACAGTTTTGGAAAGACTTGTCAAGTCTGACCTCACCGAACATAAGTTGACTGTTATGCTACGACCTTTTTTTGGTTGATCCTTTAACTTAATTGGTAATTGATTCCTGCCATGTTTGGACGTTGACAATAATGTGTACTACATAGACGTCTTGATGTCGAATGCGAACCAACAGTCCGTTAGAGACGTTGTTGGCACAGCTCTGACTGCATGGATCTTTTGCTCTTGAAGATTTCACTCTGATGTTAGTTATAAGCTTACCGTACACCATGTGTCTCTTGGATCTGGAGGAATTGATAATGTGGATATTGGAATCTACACGGTTAATTATTTACACATTTTCTTTGTCTGTTTGGACGAG

mRNA

>Mapoly0122s0020.1
GTGGAGGGGGCGTAGAGGACGGGGTGTGGGATGGCTATGGCGGGGCTGGTCCACAGGCAGGCCCCAAGGTGCTTACCGTATTTAAAATTCCGCGACCGCGAGGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAAGCGCAGGTCGGCGAAAGAAATCCGAGGCACGGCCGGGCTCAGAGCCCAGAGCAGAACGCGACCGGGTCCCTGGAGGCTGGACGCGAGCAGCAGCAGAGAAGTGCGGGGCACGAGCATGAGCCGAGTTCAGGAAATCCCAATTGCCCTCGGTCTCTTTTGCTGGTGGTGGTGCTGCAGCTATTGCTATTTCTTCGCTGGGAAGGCTAAAGAAGTAACCTCGTAGTGAGCGATATCGAGACAGAGAGAGAGAGAGAGAGGGAGAGAGCGCGAGCGAGCGATCGGCAGGATCTTCCGGGCGCAGCAGCTTCAAGAACGACATCGCAGCTGGATAGTCTCGAAGATTCTCTTTCGAGTGCAGAGGCGCTAGGGAAGAGAGGCGAGTCGAGGAGAGTAGAGGAGAGAAGACGACGCAGGGTGAAGAGAAGTGAAATCGAGTACATTGTCTAGGGTATTCAAATGACTGACTGCCTTGTTTTGTCTTCGGGGCCGGATGGTGAGAATTTAGGGAGAGGAAGGAAGATGAAGGGAAGGAAGGAAGCGATGATGGTAATGATCGGGTGGTTGCATTGTGGTGCGAATTGCCTTGTGAAGGAAGTGGTTTTTGATATTGATGATGGTGCAGGGTCGTTCTGTTGGAAGTGGTGGAGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGTAAGAAGACGAAGAAGCAGAAGAAGATTTGCAGTGTTGCGTGAAGGGGAGCGGAGTTGAAGCGGTCGTGGGTTATGATGGACGACGGGGAGGTCGATTCTCCGGATTCAGGAGGGTTACGGGGTCTGCAATCTAGCGATTACTCGCATTTTCTGGATGATAGTAGTATCATTCAGAGTGATTGGGACAATCTCATGCGAACGACGCAAGTGTGCTCTCACAAACATATTTGCAATCCTACAACAGGTCCCGACAACACTCACACCCATACGTGCGAGCACACTCACACGCATACGATCGCCAGCGGAGACGAGGAGAAGCTGACCAAGAAGAAACGACCTTCAGGTAACAAGGAAGCCGTCAGGAAGTACAGGGAGAAGCAAAAGGCCGTCAAGGTCAATCTCGAAGTCAGAAACGCGGAACTGGAGAAGGAGAATTCCAAGATTCCCGAGCTCTTGAAAGAGAATCTCAGACTTCGACGGAAATTGTTGGAGCAGGTGCCCACCCAAGCTGCATTGGACCAGTCTAACGCCGAAAATAAGAGGCTCAAGACTCTTCTCCTTCATCTGAGGCGACTCATCGATTCGGAGCTGGACTCCACAAGCCTTCAGAAACACCCTCTCAACCTCGCCACCAGAGTCGACGGTTGTGCTTCCGGACAGGCCCACCTTCCTCCTGGCAATTACTACTCCTCCGTGGTGCCATGTGCCGCGCCTCTGCCATGTTACCCAGCCCGGCCAGCATCTCAGACCGGGGTCACGGATCTTGATCGCATGGCAAGTGTCGGATGGCACACTGAGTGCGAGCATGTGAACACCGTGTGTCACGATCCAGAGTCGGAAGCCCACGTGGTGTCTGCCCAGTGCACACCGTTTCATGCCGAAGGTAGCACTAAAGCCGCCTGTAATGCATCTGTCTCGAATCACAAAAGCAATGTCGTCGGCTTCGTTAAAGGCGCCAGGCGGAGGAGCAACTCCTCACATCCCATTCCAATTGCCTATCATGCTGGCGGAGTGCCCTGCGCCGCTCCAGTCCCTTGTTTCAATGGCCTCAAGGCTGTGAACCAACCGGAATTGATCCAGCAACAGCGCGTCGAGAACCTTAGCTGGGAAGGGGGCTGTGAAATTATGACTGATATGTGCCAGGATACTGAAATGACCGCCGACTCCAGTCCTCATTGCACTGCATTGAGCCCTGAAGAAGTGACACAGAGTGCGAGCACGGTATCAAGGAAGGAGCCTGCTCTCACCTCATCTAAACTACGGGCTGAAGGTGACAGCCCTGAAGAGCAGATGTTTCCACCAGGAGGATATTTCCCCGAAGGACCGCAGTGCGGTGGACTTCCTCCTTGTTTTGGTTCAACACCCGGGTCCCAGACTTTTAGTGACAGTTGGTTTGAAGACTGCGACTTCATCAATGGTGTTTGCCAAGCTCACACTGGGGGAGCACAATCTAGCCAGGCAGTTGGTTCGTTCAGACCTGAAGATGCCACTCACAGCACCAGGTCAGCTTTGCCGACTGTATCTGAACCCATATGCCAGAAATGAGGGCGTAATGTGTGGATGCACTGGCTTGAAATTGGAGGCACTGCTGAGGCCAGCCTGTTTGATTTCATGTCACATCAGAGATGGTTTTTTGGGTAAGGAACAACAATCATTGTTCCCACTGAGTTTTTTCAAGGATTTGGCCACCGAGTGTTACTTAGTAGATGTGTCCCAGATTTACCCATGTGCTTTGAGCATTTTCTTGTAACTAGTTCTGTACCTGGATTTGCACAATGTGCTCAGTGTGATGAGATAAGACCTGTCGGGGCATCAACTCTCATTCGACGTGAAGGGCGACGAAGGGGAGGCAGTTTTTTGATGAGCACCAGTGCAACTAATTTTTGTAGGGAAATAAAAGTAGGTCGGAGGAGTCTCGCTTAGGAGGACAGTTTGACTGATTGCTCTGGTTCGCTGTCTGCACAATACATCTGCTGATTGAATTTTAACAGGTCATCAATAGATTATTACTTCTGTACAAATGTCGTTTCTCTAGAAGGGGATATTGAAAGCATATATATATGAGCTAGCGTATACTAGCCAGAACAAAACTGCCATGTCCTACTGAATGTCACGTAAATAGAGTCCTGAGAAGGAAGATTGTTGACAAGTTTCTGTACTTTTGACGATGGGAAGCTGGGTGCTAAGATGTCGAAGGTCACAGTTTTGGAAAGACTTGTCAAGTCTGACCTCACCGAACATAAGTTGACTGTTATGCTACGACCTTTTTTTGGTTGATCCTTTAACTTAATTGGTAATTGATTCCTGCCATGTTTGGACGTTGACAATAATGTGTACTACATAGACGTCTTGATGTCGAATGCGAACCAACAGTCCGTTAGAGACGTTGTTGGCACAGCTCTGACTGCATGGATCTTTTGCTCTTGAAGATTTCACTCTGATGTTAGTTATAAGCTTACCGTACACCATGTGTCTCTTGGATCTGGAGGAATTGATAATGTGGATATTGGAATCTACACGGTTAATTATTTACACATTTTCTTTGTCTGTTTGGACGAG

CDS

>Mapoly0122s0020.1
ATGATGGACGACGGGGAGGTCGATTCTCCGGATTCAGGAGGGTTACGGGGTCTGCAATCTAGCGATTACTCGCATTTTCTGGATGATAGTAGTATCATTCAGAGTGATTGGGACAATCTCATGCGAACGACGCAAGTGTGCTCTCACAAACATATTTGCAATCCTACAACAGGTCCCGACAACACTCACACCCATACGTGCGAGCACACTCACACGCATACGATCGCCAGCGGAGACGAGGAGAAGCTGACCAAGAAGAAACGACCTTCAGGTAACAAGGAAGCCGTCAGGAAGTACAGGGAGAAGCAAAAGGCCGTCAAGGTCAATCTCGAAGTCAGAAACGCGGAACTGGAGAAGGAGAATTCCAAGATTCCCGAGCTCTTGAAAGAGAATCTCAGACTTCGACGGAAATTGTTGGAGCAGGTGCCCACCCAAGCTGCATTGGACCAGTCTAACGCCGAAAATAAGAGGCTCAAGACTCTTCTCCTTCATCTGAGGCGACTCATCGATTCGGAGCTGGACTCCACAAGCCTTCAGAAACACCCTCTCAACCTCGCCACCAGAGTCGACGGTTGTGCTTCCGGACAGGCCCACCTTCCTCCTGGCAATTACTACTCCTCCGTGGTGCCATGTGCCGCGCCTCTGCCATGTTACCCAGCCCGGCCAGCATCTCAGACCGGGGTCACGGATCTTGATCGCATGGCAAGTGTCGGATGGCACACTGAGTGCGAGCATGTGAACACCGTGTGTCACGATCCAGAGTCGGAAGCCCACGTGGTGTCTGCCCAGTGCACACCGTTTCATGCCGAAGGTAGCACTAAAGCCGCCTGTAATGCATCTGTCTCGAATCACAAAAGCAATGTCGTCGGCTTCGTTAAAGGCGCCAGGCGGAGGAGCAACTCCTCACATCCCATTCCAATTGCCTATCATGCTGGCGGAGTGCCCTGCGCCGCTCCAGTCCCTTGTTTCAATGGCCTCAAGGCTGTGAACCAACCGGAATTGATCCAGCAACAGCGCGTCGAGAACCTTAGCTGGGAAGGGGGCTGTGAAATTATGACTGATATGTGCCAGGATACTGAAATGACCGCCGACTCCAGTCCTCATTGCACTGCATTGAGCCCTGAAGAAGTGACACAGAGTGCGAGCACGGTATCAAGGAAGGAGCCTGCTCTCACCTCATCTAAACTACGGGCTGAAGGTGACAGCCCTGAAGAGCAGATGTTTCCACCAGGAGGATATTTCCCCGAAGGACCGCAGTGCGGTGGACTTCCTCCTTGTTTTGGTTCAACACCCGGGTCCCAGACTTTTAGTGACAGTTGGTTTGAAGACTGCGACTTCATCAATGGTGTTTGCCAAGCTCACACTGGGGGAGCACAATCTAGCCAGGCAGTTGGTTCGTTCAGACCTGAAGATGCCACTCACAGCACCAGGTCAGCTTTGCCGACTGTATCTGAACCCATATGCCAGAAATGA

Protein

>Mapoly0122s0020.1
MMDDGEVDSPDSGGLRGLQSSDYSHFLDDSSIIQSDWDNLMRTTQVCSHKHICNPTTGPDNTHTHTCEHTHTHTIASGDEEKLTKKKRPSGNKEAVRKYREKQKAVKVNLEVRNAELEKENSKIPELLKENLRLRRKLLEQVPTQAALDQSNAENKRLKTLLLHLRRLIDSELDSTSLQKHPLNLATRVDGCASGQAHLPPGNYYSSVVPCAAPLPCYPARPASQTGVTDLDRMASVGWHTECEHVNTVCHDPESEAHVVSAQCTPFHAEGSTKAACNASVSNHKSNVVGFVKGARRRSNSSHPIPIAYHAGGVPCAAPVPCFNGLKAVNQPELIQQQRVENLSWEGGCEIMTDMCQDTEMTADSSPHCTALSPEEVTQSASTVSRKEPALTSSKLRAEGDSPEEQMFPPGGYFPEGPQCGGLPPCFGSTPGSQTFSDSWFEDCDFINGVCQAHTGGAQSSQAVGSFRPEDATHSTRSALPTVSEPICQK

Mapoly0122s0020.2  

Gene structure:

mRNA scaffold_122:192973..196437  ( + strand )
five_prime_UTR scaffold_122:192973..193493  ( + strand )
five_prime_UTR scaffold_122:194042..194189  ( + strand )
CDS scaffold_122:194190..195662  ( + strand )
three_prime_UTR scaffold_122:195663..196437  ( + strand )

Sequences:

Gene

>Mapoly0122s0020.2
GTGGAGGGGGCGTAGAGGACGGGGTGTGGGATGGCTATGGCGGGGCTGGTCCACAGGCAGGCCCCAAGGTGCTTACCGTATTTAAAATTCCGCGACCGCGAGGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAAGCGCAGGTCGGCGAAAGAAATCCGAGGCACGGCCGGGCTCAGAGCCCAGAGCAGAACGCGACCGGGTCCCTGGAGGCTGGACGCGAGCAGCAGCAGAGAAGTGCGGGGCACGAGCATGAGCCGAGTTCAGGAAATCCCAATTGCCCTCGGTCTCTTTTGCTGGTGGTGGTGCTGCAGCTATTGCTATTTCTTCGCTGGGAAGGCTAAAGAAGTAACCTCGTAGTGAGCGATATCGAGACAGAGAGAGAGAGAGAGAGGGAGAGAGCGCGAGCGAGCGATCGGCAGGATCTTCCGGGCGCAGCAGCTTCAAGAACGACATCGCAGCTGGATAGTCTCGAAGATTCTCTTTCGAGTGCAGAGGTGAGAAATCGAGCTTCTCGTGAGGAGGAGGAGGAGGAGGTGGTGCATGAGAGAAATGGCGGGACTGGAATAAAGTGCAGTTGATTGAGGAATTGATTGGGGAGTGAGATAAGAACGAGAAAGAGGGCTAGGTGAAGAACCACAAAGTCTTGTTTTTCCTGCGCTGTGGAGAGGAGGGGTGCAATCGGGGTGAAGGGGGATTGATTCTGGAGGGGAGAGGATAGTGTCGATGAGGTTTGTGTTAACCGGTGTCTTTGTTGCTTCGTGTTATTGGGCTTGAGACCAGGCGCTAGGGAAGAGAGGCGAGTCGAGGAGAGTAGAGGAGAGAAGACGACGCAGGGTGAAGAGAAGTGAAATCGAGTACATTGTCTAGGGTATTCAAATGACTGACTGCCTTGTTTTGTCTTCGGGGCCGGATGGTGAGAATTTAGGGAGAGGAAGGAAGATGAAGGGAAGGAAGGAAGCGATGATGGTAATGATCGGGTGGTTGCATTGTGGTGCGAATTGCCTTGTGAAGGAAGTGGTTTTTGATATTGATGATGGTGCAGGGTCGTTCTGTTGGAAGTGGTGGAGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGTAAGAAGACGAAGAAGCAGAAGAAGATTTGCAGTGTTGCGTGAAGGGGAGCGGAGTTGAAGCGGTCGTGGGTTATGATGGACGACGGGGAGGTCGATTCTCCGGATTCAGGAGGGTTACGGGGTCTGCAATCTAGCGATTACTCGCATTTTCTGGATGATAGTAGTATCATTCAGAGTGATTGGGACAATCTCATGCGAACGACGCAAGTGTGCTCTCACAAACATATTTGCAATCCTACAACAGGTCCCGACAACACTCACACCCATACGTGCGAGCACACTCACACGCATACGATCGCCAGCGGAGACGAGGAGAAGCTGACCAAGAAGAAACGACCTTCAGGTAACAAGGAAGCCGTCAGGAAGTACAGGGAGAAGCAAAAGGCCGTCAAGGTCAATCTCGAAGTCAGAAACGCGGAACTGGAGAAGGAGAATTCCAAGATTCCCGAGCTCTTGAAAGAGAATCTCAGACTTCGACGGAAATTGTTGGAGCAGGTGCCCACCCAAGCTGCATTGGACCAGTCTAACGCCGAAAATAAGAGGCTCAAGACTCTTCTCCTTCATCTGAGGCGACTCATCGATTCGGAGCTGGACTCCACAAGCCTTCAGAAACACCCTCTCAACCTCGCCACCAGAGTCGACGGTTGTGCTTCCGGACAGGCCCACCTTCCTCCTGGCAATTACTACTCCTCCGTGGTGCCATGTGCCGCGCCTCTGCCATGTTACCCAGCCCGGCCAGCATCTCAGACCGGGGTCACGGATCTTGATCGCATGGCAAGTGTCGGATGGCACACTGAGTGCGAGCATGTGAACACCGTGTGTCACGATCCAGAGTCGGAAGCCCACGTGGTGTCTGCCCAGTGCACACCGTTTCATGCCGAAGGTAGCACTAAAGCCGCCTGTAATGCATCTGTCTCGAATCACAAAAGCAATGTCGTCGGCTTCGTTAAAGGCGCCAGGCGGAGGAGCAACTCCTCACATCCCATTCCAATTGCCTATCATGCTGGCGGAGTGCCCTGCGCCGCTCCAGTCCCTTGTTTCAATGGCCTCAAGGCTGTGAACCAACCGGAATTGATCCAGCAACAGCGCGTCGAGAACCTTAGCTGGGAAGGGGGCTGTGAAATTATGACTGATATGTGCCAGGATACTGAAATGACCGCCGACTCCAGTCCTCATTGCACTGCATTGAGCCCTGAAGAAGTGACACAGAGTGCGAGCACGGTATCAAGGAAGGAGCCTGCTCTCACCTCATCTAAACTACGGGCTGAAGGTGACAGCCCTGAAGAGCAGATGTTTCCACCAGGAGGATATTTCCCCGAAGGACCGCAGTGCGGTGGACTTCCTCCTTGTTTTGGTTCAACACCCGGGTCCCAGACTTTTAGTGACAGTTGGTTTGAAGACTGCGACTTCATCAATGGTGTTTGCCAAGCTCACACTGGGGGAGCACAATCTAGCCAGGCAGTTGGTTCGTTCAGACCTGAAGATGCCACTCACAGCACCAGGTCAGCTTTGCCGACTGTATCTGAACCCATATGCCAGAAATGAGGGCGTAATGTGTGGATGCACTGGCTTGAAATTGGAGGCACTGCTGAGGCCAGCCTGTTTGATTTCATGTCACATCAGAGATGGTTTTTTGGGTAAGGAACAACAATCATTGTTCCCACTGAGTTTTTTCAAGGATTTGGCCACCGAGTGTTACTTAGTAGATGTGTCCCAGATTTACCCATGTGCTTTGAGCATTTTCTTGTAACTAGTTCTGTACCTGGATTTGCACAATGTGCTCAGTGTGATGAGATAAGACCTGTCGGGGCATCAACTCTCATTCGACGTGAAGGGCGACGAAGGGGAGGCAGTTTTTTGATGAGCACCAGTGCAACTAATTTTTGTAGGGAAATAAAAGTAGGTCGGAGGAGTCTCGCTTAGGAGGACAGTTTGACTGATTGCTCTGGTTCGCTGTCTGCACAATACATCTGCTGATTGAATTTTAACAGGTCATCAATAGATTATTACTTCTGTACAAATGTCGTTTCTCTAGAAGGGGATATTGAAAGCATATATATATGAGCTAGCGTATACTAGCCAGAACAAAACTGCCATGTCCTACTGAATGTCACGTAAATAGAGTCCTGAGAAGGAAGATTGTTGACAAGTTTCTGTACTTTTGACGATGGGAAGCTGGGTGCTAAGATGTCGAAGGTCACAGTTTTGGAAAGACTTGTCAAGTCTGACCTCACCGAACATAAGTTGACTGTTATGCTACGACCTTTTTTTGGTTGATCCTTTAACTTAATTGGTAATTGATTCCTGCCATGTTTGGACG

mRNA

>Mapoly0122s0020.2
GTGGAGGGGGCGTAGAGGACGGGGTGTGGGATGGCTATGGCGGGGCTGGTCCACAGGCAGGCCCCAAGGTGCTTACCGTATTTAAAATTCCGCGACCGCGAGGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAGATGCTGATTCGGAGGCGAAGGCGCAAGCGCAGGTCGGCGAAAGAAATCCGAGGCACGGCCGGGCTCAGAGCCCAGAGCAGAACGCGACCGGGTCCCTGGAGGCTGGACGCGAGCAGCAGCAGAGAAGTGCGGGGCACGAGCATGAGCCGAGTTCAGGAAATCCCAATTGCCCTCGGTCTCTTTTGCTGGTGGTGGTGCTGCAGCTATTGCTATTTCTTCGCTGGGAAGGCTAAAGAAGTAACCTCGTAGTGAGCGATATCGAGACAGAGAGAGAGAGAGAGAGGGAGAGAGCGCGAGCGAGCGATCGGCAGGATCTTCCGGGCGCAGCAGCTTCAAGAACGACATCGCAGCTGGATAGTCTCGAAGATTCTCTTTCGAGTGCAGAGGGTCGTTCTGTTGGAAGTGGTGGAGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGTAAGAAGACGAAGAAGCAGAAGAAGATTTGCAGTGTTGCGTGAAGGGGAGCGGAGTTGAAGCGGTCGTGGGTTATGATGGACGACGGGGAGGTCGATTCTCCGGATTCAGGAGGGTTACGGGGTCTGCAATCTAGCGATTACTCGCATTTTCTGGATGATAGTAGTATCATTCAGAGTGATTGGGACAATCTCATGCGAACGACGCAAGTGTGCTCTCACAAACATATTTGCAATCCTACAACAGGTCCCGACAACACTCACACCCATACGTGCGAGCACACTCACACGCATACGATCGCCAGCGGAGACGAGGAGAAGCTGACCAAGAAGAAACGACCTTCAGGTAACAAGGAAGCCGTCAGGAAGTACAGGGAGAAGCAAAAGGCCGTCAAGGTCAATCTCGAAGTCAGAAACGCGGAACTGGAGAAGGAGAATTCCAAGATTCCCGAGCTCTTGAAAGAGAATCTCAGACTTCGACGGAAATTGTTGGAGCAGGTGCCCACCCAAGCTGCATTGGACCAGTCTAACGCCGAAAATAAGAGGCTCAAGACTCTTCTCCTTCATCTGAGGCGACTCATCGATTCGGAGCTGGACTCCACAAGCCTTCAGAAACACCCTCTCAACCTCGCCACCAGAGTCGACGGTTGTGCTTCCGGACAGGCCCACCTTCCTCCTGGCAATTACTACTCCTCCGTGGTGCCATGTGCCGCGCCTCTGCCATGTTACCCAGCCCGGCCAGCATCTCAGACCGGGGTCACGGATCTTGATCGCATGGCAAGTGTCGGATGGCACACTGAGTGCGAGCATGTGAACACCGTGTGTCACGATCCAGAGTCGGAAGCCCACGTGGTGTCTGCCCAGTGCACACCGTTTCATGCCGAAGGTAGCACTAAAGCCGCCTGTAATGCATCTGTCTCGAATCACAAAAGCAATGTCGTCGGCTTCGTTAAAGGCGCCAGGCGGAGGAGCAACTCCTCACATCCCATTCCAATTGCCTATCATGCTGGCGGAGTGCCCTGCGCCGCTCCAGTCCCTTGTTTCAATGGCCTCAAGGCTGTGAACCAACCGGAATTGATCCAGCAACAGCGCGTCGAGAACCTTAGCTGGGAAGGGGGCTGTGAAATTATGACTGATATGTGCCAGGATACTGAAATGACCGCCGACTCCAGTCCTCATTGCACTGCATTGAGCCCTGAAGAAGTGACACAGAGTGCGAGCACGGTATCAAGGAAGGAGCCTGCTCTCACCTCATCTAAACTACGGGCTGAAGGTGACAGCCCTGAAGAGCAGATGTTTCCACCAGGAGGATATTTCCCCGAAGGACCGCAGTGCGGTGGACTTCCTCCTTGTTTTGGTTCAACACCCGGGTCCCAGACTTTTAGTGACAGTTGGTTTGAAGACTGCGACTTCATCAATGGTGTTTGCCAAGCTCACACTGGGGGAGCACAATCTAGCCAGGCAGTTGGTTCGTTCAGACCTGAAGATGCCACTCACAGCACCAGGTCAGCTTTGCCGACTGTATCTGAACCCATATGCCAGAAATGAGGGCGTAATGTGTGGATGCACTGGCTTGAAATTGGAGGCACTGCTGAGGCCAGCCTGTTTGATTTCATGTCACATCAGAGATGGTTTTTTGGGTAAGGAACAACAATCATTGTTCCCACTGAGTTTTTTCAAGGATTTGGCCACCGAGTGTTACTTAGTAGATGTGTCCCAGATTTACCCATGTGCTTTGAGCATTTTCTTGTAACTAGTTCTGTACCTGGATTTGCACAATGTGCTCAGTGTGATGAGATAAGACCTGTCGGGGCATCAACTCTCATTCGACGTGAAGGGCGACGAAGGGGAGGCAGTTTTTTGATGAGCACCAGTGCAACTAATTTTTGTAGGGAAATAAAAGTAGGTCGGAGGAGTCTCGCTTAGGAGGACAGTTTGACTGATTGCTCTGGTTCGCTGTCTGCACAATACATCTGCTGATTGAATTTTAACAGGTCATCAATAGATTATTACTTCTGTACAAATGTCGTTTCTCTAGAAGGGGATATTGAAAGCATATATATATGAGCTAGCGTATACTAGCCAGAACAAAACTGCCATGTCCTACTGAATGTCACGTAAATAGAGTCCTGAGAAGGAAGATTGTTGACAAGTTTCTGTACTTTTGACGATGGGAAGCTGGGTGCTAAGATGTCGAAGGTCACAGTTTTGGAAAGACTTGTCAAGTCTGACCTCACCGAACATAAGTTGACTGTTATGCTACGACCTTTTTTTGGTTGATCCTTTAACTTAATTGGTAATTGATTCCTGCCATGTTTGGACG

CDS

>Mapoly0122s0020.2
ATGATGGACGACGGGGAGGTCGATTCTCCGGATTCAGGAGGGTTACGGGGTCTGCAATCTAGCGATTACTCGCATTTTCTGGATGATAGTAGTATCATTCAGAGTGATTGGGACAATCTCATGCGAACGACGCAAGTGTGCTCTCACAAACATATTTGCAATCCTACAACAGGTCCCGACAACACTCACACCCATACGTGCGAGCACACTCACACGCATACGATCGCCAGCGGAGACGAGGAGAAGCTGACCAAGAAGAAACGACCTTCAGGTAACAAGGAAGCCGTCAGGAAGTACAGGGAGAAGCAAAAGGCCGTCAAGGTCAATCTCGAAGTCAGAAACGCGGAACTGGAGAAGGAGAATTCCAAGATTCCCGAGCTCTTGAAAGAGAATCTCAGACTTCGACGGAAATTGTTGGAGCAGGTGCCCACCCAAGCTGCATTGGACCAGTCTAACGCCGAAAATAAGAGGCTCAAGACTCTTCTCCTTCATCTGAGGCGACTCATCGATTCGGAGCTGGACTCCACAAGCCTTCAGAAACACCCTCTCAACCTCGCCACCAGAGTCGACGGTTGTGCTTCCGGACAGGCCCACCTTCCTCCTGGCAATTACTACTCCTCCGTGGTGCCATGTGCCGCGCCTCTGCCATGTTACCCAGCCCGGCCAGCATCTCAGACCGGGGTCACGGATCTTGATCGCATGGCAAGTGTCGGATGGCACACTGAGTGCGAGCATGTGAACACCGTGTGTCACGATCCAGAGTCGGAAGCCCACGTGGTGTCTGCCCAGTGCACACCGTTTCATGCCGAAGGTAGCACTAAAGCCGCCTGTAATGCATCTGTCTCGAATCACAAAAGCAATGTCGTCGGCTTCGTTAAAGGCGCCAGGCGGAGGAGCAACTCCTCACATCCCATTCCAATTGCCTATCATGCTGGCGGAGTGCCCTGCGCCGCTCCAGTCCCTTGTTTCAATGGCCTCAAGGCTGTGAACCAACCGGAATTGATCCAGCAACAGCGCGTCGAGAACCTTAGCTGGGAAGGGGGCTGTGAAATTATGACTGATATGTGCCAGGATACTGAAATGACCGCCGACTCCAGTCCTCATTGCACTGCATTGAGCCCTGAAGAAGTGACACAGAGTGCGAGCACGGTATCAAGGAAGGAGCCTGCTCTCACCTCATCTAAACTACGGGCTGAAGGTGACAGCCCTGAAGAGCAGATGTTTCCACCAGGAGGATATTTCCCCGAAGGACCGCAGTGCGGTGGACTTCCTCCTTGTTTTGGTTCAACACCCGGGTCCCAGACTTTTAGTGACAGTTGGTTTGAAGACTGCGACTTCATCAATGGTGTTTGCCAAGCTCACACTGGGGGAGCACAATCTAGCCAGGCAGTTGGTTCGTTCAGACCTGAAGATGCCACTCACAGCACCAGGTCAGCTTTGCCGACTGTATCTGAACCCATATGCCAGAAATGA

Protein

>Mapoly0122s0020.2
MMDDGEVDSPDSGGLRGLQSSDYSHFLDDSSIIQSDWDNLMRTTQVCSHKHICNPTTGPDNTHTHTCEHTHTHTIASGDEEKLTKKKRPSGNKEAVRKYREKQKAVKVNLEVRNAELEKENSKIPELLKENLRLRRKLLEQVPTQAALDQSNAENKRLKTLLLHLRRLIDSELDSTSLQKHPLNLATRVDGCASGQAHLPPGNYYSSVVPCAAPLPCYPARPASQTGVTDLDRMASVGWHTECEHVNTVCHDPESEAHVVSAQCTPFHAEGSTKAACNASVSNHKSNVVGFVKGARRRSNSSHPIPIAYHAGGVPCAAPVPCFNGLKAVNQPELIQQQRVENLSWEGGCEIMTDMCQDTEMTADSSPHCTALSPEEVTQSASTVSRKEPALTSSKLRAEGDSPEEQMFPPGGYFPEGPQCGGLPPCFGSTPGSQTFSDSWFEDCDFINGVCQAHTGGAQSSQAVGSFRPEDATHSTRSALPTVSEPICQK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>