Mapoly0122s0029



Description

GATA-4/5/6 transcription factors

Reference DB

Database ID Description
GO GO:0005515 Protein binding
GO GO:0005622 Intracellular
GO GO:0008270 Zinc ion binding
KOG KOG1601 GATA-4/5/6 transcription factors
OrthoMCL OG5_141646
PFAM PF00643 B-box zinc finger
PFAM PF06203 CCT motif
PANTHER PTHR31874 FAMILY NOT NAMED
PANTHER PTHR31874:SF1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBBX6 transcription factor, BBX Mapoly0122s0029.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0122s0029.1 scaffold_122:257934..260280  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0122s0029.1  

Gene structure:

mRNA scaffold_122:257934..260280  ( + strand )
five_prime_UTR scaffold_122:257934..258404  ( + strand )
CDS scaffold_122:258405..259517  ( + strand )
three_prime_UTR scaffold_122:259518..260280  ( + strand )

Sequences:

Gene

>Mapoly0122s0029.1
GGGCGGGCAGGGTGAATGGTGAAAGGTGAAAGTAGCCGCGAGCCAGCAGCAGCAGCGATGGCATGGTAGCGATGCAGTGCCGTACGCAGAGTATATCCCGTCGCTTTTCCATGTTGCTTTCCGCATCCTGGAGGATCGAACCTCTTGCATCACCGGAAATTGGGGTACCGTTCAAAAAATCGGTACGGGGGTGGCCGAGGAGTTCAGATTCTCGAGGCTCTGCTGCTGGCCAGTGTGTGTAGGAGTGTGGTTCGACGAGCAGAATCGCCTCTCGCATCGGGCCTATCGGCGCGCGCGAGCTATGGTGGTCTCGGTGGCAGAAGGTGTCTGAGCCGGATATGTGCTCGTGTCTGCGGCCGTACCTGAGCGAAGAAGGAGGAGAGAAGGTCGAGGGTGTCGTCGTCGTCGTCGCTCGTGGTGCGCGGCTTCGAAGGCGATAGAAGTTCTCGGATTCGACAGAAGGCGCAAGGCATGAAGAGCAAGGCAAGTGCAATTGGCGGAATGGCAGCTGCGATGGCCATCGCAGGCCGAGCGGCTCGGCCCTGCGATGTGTGCGGCCGCGAGCGCGCTCGATGGTACTGCGCGGCCGACGAAGCGTATCTGTGCGAGCCGTGCGATGGGTCCGTGCACAACGCGAATGCTCTGGCCTCGCGTCACGAGCGCGTGCGCCTCTCGCCGAATGGCGCGCCCATGAAAATCGATCGCCACCGCAAAGACGACACCACCTCCACCACCTCGCTCGCGGACCAGGCCCCGCCCGATCGACTGGCGATCAGCTCGAGAAAAAAGCAGTTCCGCGACAACCGAGCCTCTCAGCGCGCAACTGCGCCCGCTGGGCCTCCGGCGACATTGCAAGCCACTCCCTCGGCGCAGCAGGACCCCGGCTCGCAGGCCTTCGAGGTGAAGCTCGAGAGGAGCAGCCCCGAGGACGCGCAGATCTACTTCGACGAGCTGCCGCGCGATCCGAGATCGCCTCTCGGCTCGCCGTGCCGCGATAGCAAAGGCGAGCCCGATTACGCGCACCACTTCATGGTCTTCGACGAGTGCGAGGTGGACGATGTGCTGACCCCGGACGAATGCGAAGCGGAAGGTGTGGCGGGCGGGCTCGAGTCATCGGCAGGGGATTTCGATGCGCTCGGCGAGCAGGAGGACTCGGAGGCAGCCGGGGGCTCGGGCATGGAGAAGCCCGAGCCGGGAATGTTTCTGCCGCTCACGAGCACCGCGAGCACCGTGCAGTCCTCGAAGGACGAGGAGGGCAGCCATGTTCCATCGCTGAGGTTGAATTACGCGGACATTCTCAACGCCTGGTCTGATCGAGGAACTCTGTGGACCGGGGGCCATGCGCAGACAGTGCCCGAGGATTCGACCTCCGATGCCGCGGCGAATCCCGATCACGGGGTCGTCCCGTTGCTCGCCGGCGAAGATGGCAACTCGGCTCGAGAAGCTCGCGTCAATCGGTACCGCGAGAAGCGTCGAACTCGTCTCTTCTCCAAGAAAATCCGGTACGAGGTTCGGAAGCTGAACGCCGAGCGTCGGCCTCGCATGAAGGGCCGATTTGTGAAGAGGTCCGCTGGCGAGCAATAACCCTCCGGATGCACGTCTGCTGCTGCTGCTGCTACGCGCGACGCCCATGCGAGTGAAGCGGATTTCGCCGGCCCTGCGCCTCTGCCACCATTTTATTCCATTCCATTCCATTGCGCTCCGTCCAGTGCACTGGCCTCACGGGCAGATCGAAGTAGCATCCACACAATTTTCTTGTGTTCCGAGTGTCGTCGGAGTTCACGCGGGGAGGGGGAGGGTCTGCATTATGGTCGGAGGATTGCCCTCGCAGCAGGTGTGCAACCTGTGGTTGCGTTGTGTCTCGACGCTGGAGAAATTTTGGACGAAGCGAGGAACGAAGACGGATTGAATGCTTGAATGAATGAATGAAAACAAGGAATCAAGGGAAGGCAGAGAAAGTTGTGAGCCGTAAATCATGGCAGCGAGTTGCGCTCACTTGTAAATCCCGTGTCCCGTGCGATTCTAGGGCGACCCAGGATTGGCAAGGTTCCAGTCACTGCACACGGGTCGCTTTGGGAGCCAGAGGAGTGTAGTATATGGATAGAAGGATTAATTTTATAGGAACGGGAAGACGATTCCCTGTATATTTCTGCACATTTTGTATAAAGTGGGATGAGTTTCCCTTGAGAGACATTTGATTCGCACTTTGAAGAGCCGTTTGCTCTTCAATCGCTCGCCCAACTTATCGTCATCGGTGACATTGGGCCGAGCGGGATTGACAGTCATGCTTGCAGGAATATTTACAAGCGCTTCAACACCCGCAGAATTACTTCCGACATCACGAGGC

mRNA

>Mapoly0122s0029.1
GGGCGGGCAGGGTGAATGGTGAAAGGTGAAAGTAGCCGCGAGCCAGCAGCAGCAGCGATGGCATGGTAGCGATGCAGTGCCGTACGCAGAGTATATCCCGTCGCTTTTCCATGTTGCTTTCCGCATCCTGGAGGATCGAACCTCTTGCATCACCGGAAATTGGGGTACCGTTCAAAAAATCGGTACGGGGGTGGCCGAGGAGTTCAGATTCTCGAGGCTCTGCTGCTGGCCAGTGTGTGTAGGAGTGTGGTTCGACGAGCAGAATCGCCTCTCGCATCGGGCCTATCGGCGCGCGCGAGCTATGGTGGTCTCGGTGGCAGAAGGTGTCTGAGCCGGATATGTGCTCGTGTCTGCGGCCGTACCTGAGCGAAGAAGGAGGAGAGAAGGTCGAGGGTGTCGTCGTCGTCGTCGCTCGTGGTGCGCGGCTTCGAAGGCGATAGAAGTTCTCGGATTCGACAGAAGGCGCAAGGCATGAAGAGCAAGGCAAGTGCAATTGGCGGAATGGCAGCTGCGATGGCCATCGCAGGCCGAGCGGCTCGGCCCTGCGATGTGTGCGGCCGCGAGCGCGCTCGATGGTACTGCGCGGCCGACGAAGCGTATCTGTGCGAGCCGTGCGATGGGTCCGTGCACAACGCGAATGCTCTGGCCTCGCGTCACGAGCGCGTGCGCCTCTCGCCGAATGGCGCGCCCATGAAAATCGATCGCCACCGCAAAGACGACACCACCTCCACCACCTCGCTCGCGGACCAGGCCCCGCCCGATCGACTGGCGATCAGCTCGAGAAAAAAGCAGTTCCGCGACAACCGAGCCTCTCAGCGCGCAACTGCGCCCGCTGGGCCTCCGGCGACATTGCAAGCCACTCCCTCGGCGCAGCAGGACCCCGGCTCGCAGGCCTTCGAGGTGAAGCTCGAGAGGAGCAGCCCCGAGGACGCGCAGATCTACTTCGACGAGCTGCCGCGCGATCCGAGATCGCCTCTCGGCTCGCCGTGCCGCGATAGCAAAGGCGAGCCCGATTACGCGCACCACTTCATGGTCTTCGACGAGTGCGAGGTGGACGATGTGCTGACCCCGGACGAATGCGAAGCGGAAGGTGTGGCGGGCGGGCTCGAGTCATCGGCAGGGGATTTCGATGCGCTCGGCGAGCAGGAGGACTCGGAGGCAGCCGGGGGCTCGGGCATGGAGAAGCCCGAGCCGGGAATGTTTCTGCCGCTCACGAGCACCGCGAGCACCGTGCAGTCCTCGAAGGACGAGGAGGGCAGCCATGTTCCATCGCTGAGGTTGAATTACGCGGACATTCTCAACGCCTGGTCTGATCGAGGAACTCTGTGGACCGGGGGCCATGCGCAGACAGTGCCCGAGGATTCGACCTCCGATGCCGCGGCGAATCCCGATCACGGGGTCGTCCCGTTGCTCGCCGGCGAAGATGGCAACTCGGCTCGAGAAGCTCGCGTCAATCGGTACCGCGAGAAGCGTCGAACTCGTCTCTTCTCCAAGAAAATCCGGTACGAGGTTCGGAAGCTGAACGCCGAGCGTCGGCCTCGCATGAAGGGCCGATTTGTGAAGAGGTCCGCTGGCGAGCAATAACCCTCCGGATGCACGTCTGCTGCTGCTGCTGCTACGCGCGACGCCCATGCGAGTGAAGCGGATTTCGCCGGCCCTGCGCCTCTGCCACCATTTTATTCCATTCCATTCCATTGCGCTCCGTCCAGTGCACTGGCCTCACGGGCAGATCGAAGTAGCATCCACACAATTTTCTTGTGTTCCGAGTGTCGTCGGAGTTCACGCGGGGAGGGGGAGGGTCTGCATTATGGTCGGAGGATTGCCCTCGCAGCAGGTGTGCAACCTGTGGTTGCGTTGTGTCTCGACGCTGGAGAAATTTTGGACGAAGCGAGGAACGAAGACGGATTGAATGCTTGAATGAATGAATGAAAACAAGGAATCAAGGGAAGGCAGAGAAAGTTGTGAGCCGTAAATCATGGCAGCGAGTTGCGCTCACTTGTAAATCCCGTGTCCCGTGCGATTCTAGGGCGACCCAGGATTGGCAAGGTTCCAGTCACTGCACACGGGTCGCTTTGGGAGCCAGAGGAGTGTAGTATATGGATAGAAGGATTAATTTTATAGGAACGGGAAGACGATTCCCTGTATATTTCTGCACATTTTGTATAAAGTGGGATGAGTTTCCCTTGAGAGACATTTGATTCGCACTTTGAAGAGCCGTTTGCTCTTCAATCGCTCGCCCAACTTATCGTCATCGGTGACATTGGGCCGAGCGGGATTGACAGTCATGCTTGCAGGAATATTTACAAGCGCTTCAACACCCGCAGAATTACTTCCGACATCACGAGGC

CDS

>Mapoly0122s0029.1
ATGAAGAGCAAGGCAAGTGCAATTGGCGGAATGGCAGCTGCGATGGCCATCGCAGGCCGAGCGGCTCGGCCCTGCGATGTGTGCGGCCGCGAGCGCGCTCGATGGTACTGCGCGGCCGACGAAGCGTATCTGTGCGAGCCGTGCGATGGGTCCGTGCACAACGCGAATGCTCTGGCCTCGCGTCACGAGCGCGTGCGCCTCTCGCCGAATGGCGCGCCCATGAAAATCGATCGCCACCGCAAAGACGACACCACCTCCACCACCTCGCTCGCGGACCAGGCCCCGCCCGATCGACTGGCGATCAGCTCGAGAAAAAAGCAGTTCCGCGACAACCGAGCCTCTCAGCGCGCAACTGCGCCCGCTGGGCCTCCGGCGACATTGCAAGCCACTCCCTCGGCGCAGCAGGACCCCGGCTCGCAGGCCTTCGAGGTGAAGCTCGAGAGGAGCAGCCCCGAGGACGCGCAGATCTACTTCGACGAGCTGCCGCGCGATCCGAGATCGCCTCTCGGCTCGCCGTGCCGCGATAGCAAAGGCGAGCCCGATTACGCGCACCACTTCATGGTCTTCGACGAGTGCGAGGTGGACGATGTGCTGACCCCGGACGAATGCGAAGCGGAAGGTGTGGCGGGCGGGCTCGAGTCATCGGCAGGGGATTTCGATGCGCTCGGCGAGCAGGAGGACTCGGAGGCAGCCGGGGGCTCGGGCATGGAGAAGCCCGAGCCGGGAATGTTTCTGCCGCTCACGAGCACCGCGAGCACCGTGCAGTCCTCGAAGGACGAGGAGGGCAGCCATGTTCCATCGCTGAGGTTGAATTACGCGGACATTCTCAACGCCTGGTCTGATCGAGGAACTCTGTGGACCGGGGGCCATGCGCAGACAGTGCCCGAGGATTCGACCTCCGATGCCGCGGCGAATCCCGATCACGGGGTCGTCCCGTTGCTCGCCGGCGAAGATGGCAACTCGGCTCGAGAAGCTCGCGTCAATCGGTACCGCGAGAAGCGTCGAACTCGTCTCTTCTCCAAGAAAATCCGGTACGAGGTTCGGAAGCTGAACGCCGAGCGTCGGCCTCGCATGAAGGGCCGATTTGTGAAGAGGTCCGCTGGCGAGCAATAA

Protein

>Mapoly0122s0029.1
MKSKASAIGGMAAAMAIAGRAARPCDVCGRERARWYCAADEAYLCEPCDGSVHNANALASRHERVRLSPNGAPMKIDRHRKDDTTSTTSLADQAPPDRLAISSRKKQFRDNRASQRATAPAGPPATLQATPSAQQDPGSQAFEVKLERSSPEDAQIYFDELPRDPRSPLGSPCRDSKGEPDYAHHFMVFDECEVDDVLTPDECEAEGVAGGLESSAGDFDALGEQEDSEAAGGSGMEKPEPGMFLPLTSTASTVQSSKDEEGSHVPSLRLNYADILNAWSDRGTLWTGGHAQTVPEDSTSDAAANPDHGVVPLLAGEDGNSAREARVNRYREKRRTRLFSKKIRYEVRKLNAERRPRMKGRFVKRSAGEQ

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>