Mapoly0124s0021



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_143051
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR31945 FAMILY NOT NAMED
PANTHER PTHR31945:SF5

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH1 transcription factor, bHLH Mapoly0124s0021.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0124s0021.1 scaffold_124:166164..170914  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0124s0021.1  

Gene structure:

mRNA scaffold_124:166164..170914  ( + strand )
five_prime_UTR scaffold_124:166164..167998  ( + strand )
CDS scaffold_124:167999..168841  ( + strand )
CDS scaffold_124:169760..170011  ( + strand )
CDS scaffold_124:170227..170397  ( + strand )
CDS scaffold_124:170606..170692  ( + strand )
three_prime_UTR scaffold_124:170693..170914  ( + strand )

Sequences:

Gene

>Mapoly0124s0021.1
CTCGCGGGCATTGTCTTCCCAGAAGAGTAGAGCATTGGATGGATCTTTCTTTCTACCACGATCCTGTGGGAAATTTACTTTACTCCGAAGGGTGAGATAGCGCGACGAGGCACTTTCCCGGGCACGAAGTGACATGGTACGAGGATCGTTGTCAATGTGCGAATCTAATTCCGTAGTACGTTCCTTACTCTATAGGGCTTCCGAACCTTTTCCCCGAGCGGAAGAAAGGAAGTGACTAGCGAGTGTGAGCCGAAAGCTGACCTCGCTAGCTCTCTCTCTCGCCCAAAAGGCAAGATTTGAGAGCCCCAACTCTGACCCCATCGCTATAAGAGGGAAGTCAGGCGCGGCGGGCCCATGGGTCTGCCATCGATCCGTCTTTGTATGTATTTTATCTGCACGTACTGTGCATCCCCACCTGCGATCCTGCACCATGCACTGTGGCATGTCAACCACCGGGGGATGAAATTTGTCCTCCACGACTGTCGCGTCTCCAAACGATGGGCTCGATTGGCAGACATTCCAAAGCCTACTCGCTTTTCGAAACGCCTCGCCTACCGAGCGCCCGCGTCAACAAACGGCCCAAGACGAAAATTATCATCGAGCAAGAAAGCTAGCCAACCTAAAACAGGAGCCGACTAATTTCGACAACTTGACAATTCGCCAATTTGCAGATGTTCTTCCGGCTGCGGCCGTCAGTCTCGAGATCGAATGAGACCAGCGTCGGTCGCGACTCTTGTTGTTTTTGCTGTCGTTGTTTTTCTTCTTGGCCTCGACGATTGGACGCCGGGAGGCCGCGAATCGGGGACGCGACGAATTTATTTCTCCTCCGCCTGTAGCCGGATGGGCCGATGGACGAACGGACGGCCGGATTGTCGGATGGCTGGGCAGGGCTGGGTTGGTCTGGGCCCCGGGAAAATCTGCGTATCAATATCGGAGCAGCGCGCGCTGCAAAAGCTGTCGCCGGTGCTCGGGGGCTGCGCTAGCGAGCGAGCGAGCGAGCGATGGAGGAAGGGGAAAGCGTCGATAGGATCGAGCGAGCGAGCAGAGGAGCAAGAGGCCGGCGGAGAATATGTGCGTCGCTTTTCGAAGTTCCTCTCGAAAGCTGAAAGTCCAAAGCGCTCGAGGGAGGGAGGGAGGGAGGGAGGGGTGGGGGAGGAGGAGGTCTTGCCGGGCCCGAGTCAAACGACAGGAAGGACAGGGAGTCAGATCGGGGGCGACGGGAGGGAACACGTGAACTTCGTGCATCTGGAGCGGGCAATGGGTGGACGAGCAATATCCATCAATGACTCGGCGAGATATGTCAGCAGCAGCCCAACAAGGGATGAATGTACTGGTCCGTATCCCGACCTCGGCTCCGGCCCCGGCCCCGGCCCCGACCCGACCCGACCCGACCGCCTGTACCGGCCGCGAGTCGAAATCATAATGTCCGGCCGTCGATCGAGTCGAGGTCCGGTCCGGTCCGGTCCGTCAGGCTGCCGCTGCTGCGATCGCCCTCTTGAGCTTCGAAATTCGAGCTCTGCTGCTGCTGCTGCAGTTTCATGCGTGCCGGACTATTGCGAGGGCCCGTGACTGACAGGCCCGCGCGCTCTGATTGCTCGCACTGTTGAGTATGATTAATGTCTCGAAACGGCGAGTAGATAATTCCCCCGCGATCGAGCTCGAGGCCAGCAACAGCAGCGGCGCGAGACGCCCGAAGAGGAATCGCTGCAGATTCAGCGAGCGCTCGAGATCCGTACTCGGGCTCATGACATCGCTCGAGGCCATGACCGCTCGGCTCTTGAAGCTCTAGCCAGCCCCCCCCCCCCCCCCCCCTCCCCCCGGCCCTCCGCCCCTCCATGGACTCCTTCACCGCCGCCGATCCCAACTTGCACGAGATTCTCGAGCGTGGTGCTGCTGCTGCTGCCCCACAGTCCGGTACTGGTCCCGATTTTCTGACCGCGCTCGGCGACGGGGTGGGAGTGGGAGGGGGAGTGTTGGGGCCGCACAGCAGCAGCAGCGCCGGCAGCGACTCCTTTCTGCGCCAGGCCGAGGTGCCCAAGCCCAAGTGGCCTGCTGCCCCGCGCTGGATGATTCAACAACATATCGGGCCTCCCCCGAGCTTCCCTCTCGCTGCTGCTGCTGCTGCTGCTGCTCCTGTTCCTGCTGCCGTCGTCGTCGTGCCCTCTGCTGCTGCGAGTGGCGGTTCCAAGTTCTCCAAGCCTGCGTCGCTAGCGAGCCCCGTCTCCGGCCCTGGCCCGGGCTCGAGCGACGACAGGCCTGTGAAAGTGTGGTGTGACAGAAACAGCAAGCAAGCGCTTCTCAAGAGCGAGGGCGAGAATGCACCGCCTTCCAAACTTATAGCGATGGCGAAATGCGACAGCCACAACACCAACATCATCATCAACAACAACAACAATATCACCAACACCAGCAAATCTTCGATGGTCCTTGACACTCTTCCGGCTGCTGCTGCTGCTGCTGCCGCCGATTCGCCACGAGGAAATGTGATCGCCAAAGATGGCGTCGATGTGGATTTGAAGCAGATAGACTCGTCGGATTGCAGCGACCACATGGAAGAGCAGGAAGACAAGGCCACGAACCGGACCGTGTCCAAGAACCTGGTTTCCGAGCGCAAGCGCCGCAAGAAGTTGAACGAGGGCCTGTACACATTGCGGGCCCTTGTGCCGAGAATAAGCAAGGTTTGTTGCCGGCAGCTCGTCGCAATTTGAACTCGTCGGTCGATCTCAGTTTGGGTTTCTTGACTCCGATACTCGCGCACGCACGCACTTGACCCTCGCGTAGTATCAGCCTGATGCGAGTGCTGTCTCAGTGCGCAGGACACTAGGAATATTGTCTCAAATTGCAAGGCCGCCTCGCGTCGACGGTGGCCGACCGCACTGAAACTGATTTCAGTGCCTCTGTGGAGGCTGAATGATCGCAAGATATCTTCTCCTTCTTTTCGTCCGACTAGAAGCACTTTTCGTTGGTGTGATGCGTAATTGTAGCTTCACAATAAGATCAGCAGCACTTGGGATGTGTTGCGACCCAGCACAGCAGAGTCATTCGTATGCTATTTCCGTTTCTGTTAGCTGCGATTACGAGGGCGTTTTCTATCTCGTTCATTCTCGCGATGGAAAGAACAGCCCGCCAGGAACTTCGATATCAGATTCTCGATCAGTTCGGAATCCATATCTCAAACACAGTGCGTCTTGTTGCCGCGTGGTCTCGGTAGGTGTCCATGTCTACTGCAGCCTAATGGAGATCATAGACCTGAGAATGCATTCAAAAGTTACTGAGAGAAATGCACCCTTGCGAGGACGATAGGACTGGCAAATTGCCGAGATGGAGGTCTAGAGGTGTGCAGACTGAACGAGAAATCCGACAGCCGCTCGACTGGCACCCAGTCGTCGAGTTGCAGGACCCTCGTAGCAATTTCATCTCGAAGCGCCAGCCATCTTCAGCTCATGCTGTTGTTAGCTCACAGGCGTTTGAATCGATAGTGACTTGACAGGCCGCTCCTAGTGGGACATTCCACCAGTAGTCAAGGTTCAGGTCCGAGATTTTCGCGCAGGTACACCAGTTTTTGCCTCTTATTCGAAGCCTGTTGTGTGATGTAGATGGATAAAGCATCCATTATCGGCGATGCCATCGACTACGTTCGTGAACTTCAGAAGGAAGTGGACGATCTGCAAACGGCTATCTCAGAGGTCGAAGCCTCGAGGAAAAGCGGCAATCTAGACACAGAGGAAATGTCTCAAAATGCCCAGATTATGGAAAATAGTATGGTAACAGAGGATTTCGAAAAAGCAAGCCGAAACAACACTCCAGGATCCAACGACGACACAACCACAGAACAGAAAATCTTGAAAGTAAAGTGCACTTCCTTTGCTCCCTTCAGTCCTATGAATAGTTGGACCGACCACCAAATATGAAACTTAGGTTCTTTGGTTATAGGCAAGGGTTGGCAAACTTCGAGTTATGCTGAAATCAGCGATCGCTTTGAATGTCGATTCTGCTTGTGCTCAAACAATCGATGTATCGCGGAATGAGTCTGACAGATGGTCATGTTTCTTCGTATATACAGTTGGACGTAGCGAAAATGGAGGAGAAGAGTTACCACCTCCGGATATTTTGCACCAAAGGCCCAGGGGTGTTCGTGCTACTCATGCGATCGCTTGAAGCGCTAGGCATGGAGGTTTTGAGTGCTAATTTGACATCCTTCGAAGAAAACATTCTCAACACGTTCATCGCCGAGGTACAGTTCTCAGCTCTTCCAGTGATCTTTTCGACAGTAATCACATTGACAAGGCAGTTTTTTATTTTGGTCTGGTTGGCAGTAGAATGGGGATGAAAATAGCAGAAGGCCGGCAGATTTGCACGGTACGCACGCCAGAGTAGTTTTGGCAACATCCTTGATGTGTAAACCTCTGAGATTGTCTTCTATGGCCTTGCATGGTTTCCAGATCAAGGACTTGGAAGCGATGAAGACCGAAGAAGTGAAGGCAGCAATTTTGGACGTCTGTGCACGGTTTGGCTTACAAACGACATGAAGTGGTGTTTCTCGATGCCAGGCGTCGGTCCATGTTGTACAGGTGATCATGATGGATCAGTTAGATAGTCAGAATCATAGAAACCCTTGTACATATCTGAATGAATCAAACGAAACTAAACGTGTACAAAAGCAGGCGAGGCTCTTAGTATATACTTCGCGAAAGTAGTTGGAAAGATCGCATCTCGAAATTCAATAAAGGTTTTGCAGGACTGCAGCTATC

mRNA

>Mapoly0124s0021.1
CTCGCGGGCATTGTCTTCCCAGAAGAGTAGAGCATTGGATGGATCTTTCTTTCTACCACGATCCTGTGGGAAATTTACTTTACTCCGAAGGGTGAGATAGCGCGACGAGGCACTTTCCCGGGCACGAAGTGACATGGTACGAGGATCGTTGTCAATGTGCGAATCTAATTCCGTAGTACGTTCCTTACTCTATAGGGCTTCCGAACCTTTTCCCCGAGCGGAAGAAAGGAAGTGACTAGCGAGTGTGAGCCGAAAGCTGACCTCGCTAGCTCTCTCTCTCGCCCAAAAGGCAAGATTTGAGAGCCCCAACTCTGACCCCATCGCTATAAGAGGGAAGTCAGGCGCGGCGGGCCCATGGGTCTGCCATCGATCCGTCTTTGTATGTATTTTATCTGCACGTACTGTGCATCCCCACCTGCGATCCTGCACCATGCACTGTGGCATGTCAACCACCGGGGGATGAAATTTGTCCTCCACGACTGTCGCGTCTCCAAACGATGGGCTCGATTGGCAGACATTCCAAAGCCTACTCGCTTTTCGAAACGCCTCGCCTACCGAGCGCCCGCGTCAACAAACGGCCCAAGACGAAAATTATCATCGAGCAAGAAAGCTAGCCAACCTAAAACAGGAGCCGACTAATTTCGACAACTTGACAATTCGCCAATTTGCAGATGTTCTTCCGGCTGCGGCCGTCAGTCTCGAGATCGAATGAGACCAGCGTCGGTCGCGACTCTTGTTGTTTTTGCTGTCGTTGTTTTTCTTCTTGGCCTCGACGATTGGACGCCGGGAGGCCGCGAATCGGGGACGCGACGAATTTATTTCTCCTCCGCCTGTAGCCGGATGGGCCGATGGACGAACGGACGGCCGGATTGTCGGATGGCTGGGCAGGGCTGGGTTGGTCTGGGCCCCGGGAAAATCTGCGTATCAATATCGGAGCAGCGCGCGCTGCAAAAGCTGTCGCCGGTGCTCGGGGGCTGCGCTAGCGAGCGAGCGAGCGAGCGATGGAGGAAGGGGAAAGCGTCGATAGGATCGAGCGAGCGAGCAGAGGAGCAAGAGGCCGGCGGAGAATATGTGCGTCGCTTTTCGAAGTTCCTCTCGAAAGCTGAAAGTCCAAAGCGCTCGAGGGAGGGAGGGAGGGAGGGAGGGGTGGGGGAGGAGGAGGTCTTGCCGGGCCCGAGTCAAACGACAGGAAGGACAGGGAGTCAGATCGGGGGCGACGGGAGGGAACACGTGAACTTCGTGCATCTGGAGCGGGCAATGGGTGGACGAGCAATATCCATCAATGACTCGGCGAGATATGTCAGCAGCAGCCCAACAAGGGATGAATGTACTGGTCCGTATCCCGACCTCGGCTCCGGCCCCGGCCCCGGCCCCGACCCGACCCGACCCGACCGCCTGTACCGGCCGCGAGTCGAAATCATAATGTCCGGCCGTCGATCGAGTCGAGGTCCGGTCCGGTCCGGTCCGTCAGGCTGCCGCTGCTGCGATCGCCCTCTTGAGCTTCGAAATTCGAGCTCTGCTGCTGCTGCTGCAGTTTCATGCGTGCCGGACTATTGCGAGGGCCCGTGACTGACAGGCCCGCGCGCTCTGATTGCTCGCACTGTTGAGTATGATTAATGTCTCGAAACGGCGAGTAGATAATTCCCCCGCGATCGAGCTCGAGGCCAGCAACAGCAGCGGCGCGAGACGCCCGAAGAGGAATCGCTGCAGATTCAGCGAGCGCTCGAGATCCGTACTCGGGCTCATGACATCGCTCGAGGCCATGACCGCTCGGCTCTTGAAGCTCTAGCCAGCCCCCCCCCCCCCCCCCCCTCCCCCCGGCCCTCCGCCCCTCCATGGACTCCTTCACCGCCGCCGATCCCAACTTGCACGAGATTCTCGAGCGTGGTGCTGCTGCTGCTGCCCCACAGTCCGGTACTGGTCCCGATTTTCTGACCGCGCTCGGCGACGGGGTGGGAGTGGGAGGGGGAGTGTTGGGGCCGCACAGCAGCAGCAGCGCCGGCAGCGACTCCTTTCTGCGCCAGGCCGAGGTGCCCAAGCCCAAGTGGCCTGCTGCCCCGCGCTGGATGATTCAACAACATATCGGGCCTCCCCCGAGCTTCCCTCTCGCTGCTGCTGCTGCTGCTGCTGCTCCTGTTCCTGCTGCCGTCGTCGTCGTGCCCTCTGCTGCTGCGAGTGGCGGTTCCAAGTTCTCCAAGCCTGCGTCGCTAGCGAGCCCCGTCTCCGGCCCTGGCCCGGGCTCGAGCGACGACAGGCCTGTGAAAGTGTGGTGTGACAGAAACAGCAAGCAAGCGCTTCTCAAGAGCGAGGGCGAGAATGCACCGCCTTCCAAACTTATAGCGATGGCGAAATGCGACAGCCACAACACCAACATCATCATCAACAACAACAACAATATCACCAACACCAGCAAATCTTCGATGGTCCTTGACACTCTTCCGGCTGCTGCTGCTGCTGCTGCCGCCGATTCGCCACGAGGAAATGTGATCGCCAAAGATGGCGTCGATGTGGATTTGAAGCAGATAGACTCGTCGGATTGCAGCGACCACATGGAAGAGCAGGAAGACAAGGCCACGAACCGGACCGTGTCCAAGAACCTGGTTTCCGAGCGCAAGCGCCGCAAGAAGTTGAACGAGGGCCTGTACACATTGCGGGCCCTTGTGCCGAGAATAAGCAAGATGGATAAAGCATCCATTATCGGCGATGCCATCGACTACGTTCGTGAACTTCAGAAGGAAGTGGACGATCTGCAAACGGCTATCTCAGAGGTCGAAGCCTCGAGGAAAAGCGGCAATCTAGACACAGAGGAAATGTCTCAAAATGCCCAGATTATGGAAAATAGTATGGTAACAGAGGATTTCGAAAAAGCAAGCCGAAACAACACTCCAGGATCCAACGACGACACAACCACAGAACAGAAAATCTTGAAATTGGACGTAGCGAAAATGGAGGAGAAGAGTTACCACCTCCGGATATTTTGCACCAAAGGCCCAGGGGTGTTCGTGCTACTCATGCGATCGCTTGAAGCGCTAGGCATGGAGGTTTTGAGTGCTAATTTGACATCCTTCGAAGAAAACATTCTCAACACGTTCATCGCCGAGATCAAGGACTTGGAAGCGATGAAGACCGAAGAAGTGAAGGCAGCAATTTTGGACGTCTGTGCACGGTTTGGCTTACAAACGACATGAAGTGGTGTTTCTCGATGCCAGGCGTCGGTCCATGTTGTACAGGTGATCATGATGGATCAGTTAGATAGTCAGAATCATAGAAACCCTTGTACATATCTGAATGAATCAAACGAAACTAAACGTGTACAAAAGCAGGCGAGGCTCTTAGTATATACTTCGCGAAAGTAGTTGGAAAGATCGCATCTCGAAATTCAATAAAGGTTTTGCAGGACTGCAGCTATC

CDS

>Mapoly0124s0021.1
ATGGACTCCTTCACCGCCGCCGATCCCAACTTGCACGAGATTCTCGAGCGTGGTGCTGCTGCTGCTGCCCCACAGTCCGGTACTGGTCCCGATTTTCTGACCGCGCTCGGCGACGGGGTGGGAGTGGGAGGGGGAGTGTTGGGGCCGCACAGCAGCAGCAGCGCCGGCAGCGACTCCTTTCTGCGCCAGGCCGAGGTGCCCAAGCCCAAGTGGCCTGCTGCCCCGCGCTGGATGATTCAACAACATATCGGGCCTCCCCCGAGCTTCCCTCTCGCTGCTGCTGCTGCTGCTGCTGCTCCTGTTCCTGCTGCCGTCGTCGTCGTGCCCTCTGCTGCTGCGAGTGGCGGTTCCAAGTTCTCCAAGCCTGCGTCGCTAGCGAGCCCCGTCTCCGGCCCTGGCCCGGGCTCGAGCGACGACAGGCCTGTGAAAGTGTGGTGTGACAGAAACAGCAAGCAAGCGCTTCTCAAGAGCGAGGGCGAGAATGCACCGCCTTCCAAACTTATAGCGATGGCGAAATGCGACAGCCACAACACCAACATCATCATCAACAACAACAACAATATCACCAACACCAGCAAATCTTCGATGGTCCTTGACACTCTTCCGGCTGCTGCTGCTGCTGCTGCCGCCGATTCGCCACGAGGAAATGTGATCGCCAAAGATGGCGTCGATGTGGATTTGAAGCAGATAGACTCGTCGGATTGCAGCGACCACATGGAAGAGCAGGAAGACAAGGCCACGAACCGGACCGTGTCCAAGAACCTGGTTTCCGAGCGCAAGCGCCGCAAGAAGTTGAACGAGGGCCTGTACACATTGCGGGCCCTTGTGCCGAGAATAAGCAAGATGGATAAAGCATCCATTATCGGCGATGCCATCGACTACGTTCGTGAACTTCAGAAGGAAGTGGACGATCTGCAAACGGCTATCTCAGAGGTCGAAGCCTCGAGGAAAAGCGGCAATCTAGACACAGAGGAAATGTCTCAAAATGCCCAGATTATGGAAAATAGTATGGTAACAGAGGATTTCGAAAAAGCAAGCCGAAACAACACTCCAGGATCCAACGACGACACAACCACAGAACAGAAAATCTTGAAATTGGACGTAGCGAAAATGGAGGAGAAGAGTTACCACCTCCGGATATTTTGCACCAAAGGCCCAGGGGTGTTCGTGCTACTCATGCGATCGCTTGAAGCGCTAGGCATGGAGGTTTTGAGTGCTAATTTGACATCCTTCGAAGAAAACATTCTCAACACGTTCATCGCCGAGATCAAGGACTTGGAAGCGATGAAGACCGAAGAAGTGAAGGCAGCAATTTTGGACGTCTGTGCACGGTTTGGCTTACAAACGACATGA

Protein

>Mapoly0124s0021.1
MDSFTAADPNLHEILERGAAAAAPQSGTGPDFLTALGDGVGVGGGVLGPHSSSSAGSDSFLRQAEVPKPKWPAAPRWMIQQHIGPPPSFPLAAAAAAAAPVPAAVVVVPSAAASGGSKFSKPASLASPVSGPGPGSSDDRPVKVWCDRNSKQALLKSEGENAPPSKLIAMAKCDSHNTNIIINNNNNITNTSKSSMVLDTLPAAAAAAAADSPRGNVIAKDGVDVDLKQIDSSDCSDHMEEQEDKATNRTVSKNLVSERKRRKKLNEGLYTLRALVPRISKMDKASIIGDAIDYVRELQKEVDDLQTAISEVEASRKSGNLDTEEMSQNAQIMENSMVTEDFEKASRNNTPGSNDDTTTEQKILKLDVAKMEEKSYHLRIFCTKGPGVFVLLMRSLEALGMEVLSANLTSFEENILNTFIAEIKDLEAMKTEEVKAAILDVCARFGLQTT

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>