Mapoly0126s0029



Description

MYC

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_153265
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF33

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH38 transcription factor, bHLH Mapoly0126s0029.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0126s0029.1 scaffold_126:349125..355481  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0126s0029.1  

Gene structure:

mRNA scaffold_126:349125..355481  ( + strand )
five_prime_UTR scaffold_126:349125..350189  ( + strand )
CDS scaffold_126:350190..351197  ( + strand )
CDS scaffold_126:353327..353782  ( + strand )
CDS scaffold_126:354207..354290  ( + strand )
three_prime_UTR scaffold_126:354291..355481  ( + strand )

Sequences:

Gene

>Mapoly0126s0029.1
GAAGTGCTGTTCATCACACACATCATTCTACGACTGACAAAGCGGAGAATCGTCCTGTCTTGGAGTTGTCGGGGAACCGGTTCGCGGAGGCCCAACTGCGGCATTAGTAGAGAGAGCGGAGCTGCTCTAAAAACCGGACGAGGGTGGGCCTTGGCAACTCATACACTCGCTCGCTCGCTCGCTCACACACTTGCTTTGTTTAGCTTTCTGCGACGCTGCCCGCTTCTGCTTCTCGTGATAGTCGTTAGAACCGCACCCCCGCCTCCCCTCCCTTCCAGTACCATCCCCCCACCATATCATAGTCTCTGAAATTCAGACGCCTCGTTCTTCTCCTCGCCTTTCTTCTCGCTCTCTCTCTCACTCATTGTCTCTCATTCTCTCTCTCCTCGGGCTGCCGACATCAGAGAACGGCTCAGACGGGAGCTCGAAGAGCTGCAATATCGCCGCTGGACTCCGAGTCTACAATATACACCGCACCGAATTGTTCTGCGATTCACGAGAGAGACTCTCGTGGCTGCTGCTGCTGCCTGCAGACAGAATTCTCAGATTCATCTGATGAGCAATTGGCGGTGGGCAACCTGAGCGACTCCGGGGTTAGGGACCCGGCCCAACGCAACGCGGCGGCCTTGAATTGCTAGAGATTGTAAAATTCCTGGAATTCGGAACAACGCGGGCGCATTTGTCATCTGAATCAGAGAAGTATTCAGCGCTGCTCGCAGCTCTCGGACCCATCCGCCAATGGGAAGCAGCGCGGGCGGCCCTCGGTGTTCGGCATTCTGGGATCGCCTCGCGGCCTGAATGAATGGTGCGGTGCCCCCCTGCGATTGAAATCGAGAACATGGGTCTCTCATCGGGCCTCTCTTCCTTGACTCGCCCGTCCGATAGCAGACCGGAGCTCCTCTCCGAGTCCTGAACCTCAAGGACCTCGAAGCAGATTTCTCAGACTCTCCTCCATCTCTGAGATATAGCGTCGACGCCTGCCTGCCTGTCTGCCTGCAGCTTCCCGAGAGTTGGTCCGGGCAAGAATCAGAGCTCGAGAGCTCGCGAGCGATCTGAGGAACCAAGATGATGGCTCATAATCTCGCGACTCATTCTCTAACCTCGGCGCTCAATCATAGATCCCCCGCGTACCTCTCGCAAGATCACCAGGCCGTGCGGCACATTTCCGTCATAACAATGCCGGACATCCTCGAAGCTTTCAACCATTCGCAAGCTATGTCGTCGACCACGAATCTGAGCACCTCGGTGCGAAACAGCGGCGGCGATCCATGGGAGCTTCCGGAGCTCAAGTGGCTGGATCCAGCCGACAATGTATCAGGCCCCAGCGAGAATCTGCCCGAAGCCGACAATCCGAGCCTCCCAGCGGAGAAGTTCCCCATTGACGGCGAGAGATGGCCCTTCTCGTCGCTCTATGGCGGAGATCGAGTGCCCTCCAATGCCGAGGAGGCTCAATTCTCGCTGCAGTCCATAGTCAGCGCATCCCCAGCCAGCAGCGGCTCGTCGGTTCTGATGAAGGGCCGCATGAGCTTCGTCGGCCGAGACTTCCCATCGTCGGCGCAGCAGCAGCAGCAGCAGCAGGCGCCCGAGTGGCGCAGCACCAGCGGCAACTCGGGCCACAAGCGCCCGACGTCCGAGAGGCCGGATTCGGACTTCGCGCAGGAGAAGCTGTCGAATTCCGAGCGATCGAGCTTCAAGGACAACAAATCTGTGCCGGACATTCCCGTCTCCAACAGCGAGGTCTCGGCTCTGACAACGACATATCCGCCTGAGAAGCGCAGCCGCACCGCCAGTGACACTCGCGCCACTCGCGACAGCTGCACTCAGGGTGGTGGTGGTGGTGGTGGCGCTGGTGGTAATGGTGGCTCGGGGGCCGATCAGCAGAAGCTCAGCGTCGAGAAGGGCAGCGTCTCCGTCACGAACGATCAGACCGTCAGCCCCGGCCGCGACAGCAAGAAGTCGGCCAACACTGTTTCAGATCATGAAATTCATATCTGGACCGAGCGCGAGCGTCGCAAGAAAATGAACGGAATGTTCTCCACGTTACATTCGCTCCTGCCCCATCTCAACTCCAAGGTGATTATATTCTCCCCCTTCTCGTCCCTCCGACCGACCGAATCGAACAATTCTAATTCTCGCCCGAGGAGTCAATCCCTCGCCTCGAGTTAATTAATCAGCCTTCGTCGTCTTCCTTCCTTCCTTCGTTTTGTTTCTTCTGAGGTCGCTCTTGTCTGTCTGATGCCTCCCTCGGAAATCGATAGAATGGATGAATGGATGAGTGAATGTCTGAGAAATGTCCTTTTCTGGAGCGATGGTTCGATGTTTTTTTTTGGTCGACTCTTCGAGCCCGACAGTCACGAGACGAACACTCAGAGAAGCTTGGAGCGAGCTGAGCTGAGCTGAGTTTGCCGCATCACCAGCGGCAACAGGTGCTGGGTCTTCGAATCTTATCCACACTGTGGAAAGACGACGACGAGGCACGACGGCTGCTGCTGCATCTGCACTGATCGCCTTCTGTAGGTTCACTGACTGACTGTGCGGCTCGCCCCGGTGTTAAATAATTCACCGCGCGACTTCGTTGTGATTGCTGCATTTGGCACCTCATGCAGCGGGGCCGGCAGGAGGGCAGGAAGGCAGGGAGACAAGGAGCAATAGCTCTATAGCTGAAATCATGGAGGAATTAGGCTTGTACAATTCTCTCTCGTCCAGTATTGGTTGGTGCTCACCCCAGTTCCCACTATTGATTGATCACGAAGCAGCAGCAGCAGCTGCAGCATGCATGCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTTCCTTCCTTCCTTCTGACCGACACGAGAGGCGAAACCCCGGAGGATCGCAGCAAGCCAGACAGCCCATGCACATTCATTCTCTTGTTGTAGCTCCTTGCTGTCGGCTCGCTCGCACCTGCAGGTTCCGCAACCCTTCTTCCGGGGCCCGGGGGCCCTCGTAATTACGTCCTTCTGCGAGCTGCAGAAGAAAGTGCAAATTGTGGATTCGCTGCAGCTGCCAATAATGTTAATTCCTCGCAGTCTCCTCCTCGGGCTCCCTCTCAGGCTCTCTCTCTCTCTCTCTCACACTCGAATGTCCGCTGCGAGGACGACGTCAACGCTGCGTCGCGTTGCTGGAGAGCTGGAGAGCGAGAGAGCAAGCAAGCACTGTGCAGGTGAACAGTCGTCTCGTGCATGAGAGAGCTGCCGGGATTGGATATTATCATTCTCGTCGGGCCTGCAAACATCGGAAGCGCGTCTTCTGCACTCGAGAACCTTGCCCTCGCGATGCGCCCTTGCGCGGGTGGTGGGGGATTAGGCTCCGCGGTCTCGATTGGCACAGTAGGAAGCCCAGATTCTTGCCGCCATTACTAGCCTCCCTCCCTCGCTCCGGATGTCTTGTGTCTGAATCGGTCCACGTCGCTGGGTGGGCAATCGTCCGCGGGTTGGTGATCGAATCTATCTGCGTGAGGAATCTACCGTCGCTCGCTATAATCCCGTGGGTTTGTAGATGAATGAGCGAGCCATGCGAGTGGCGGGAGCGACCGACCGAGAGCAGGCAGGGCTGCAATTCATGCTTGACCTCGAGAAGAGATCCTCGAAATCTCGAGCGCTTCAAAGCCCTCTCTGATCCGCGTCTGATCGCAGGACACATGTTCTTTTCTGCACTATGACACCTTGATTCGCTGATTCTGTCGATGGTCGCCAACCTCCATTGATGACGTTCTCAACCTCCGACAGGATATGGTTTCCCTATTTATAGCGCTTGTGCGAGAGAATATATGGCAGCCTCAATTTGATGCTCTTCCCTTCCGGGAGATGCCCAAATGCTCCATAGCCTTGTCTGCTTGCTGCTTGCAGATCCGAGATGCAAGTCAAGCCGCTGCATCCTTACCCAGAAAGTGAATCACTTCCCGCCGTGCTCAGATCCATCGAAGCTTGCATCGAGGATCGAGGCTGTTCTCTCTCTTCCTAGGAACGAGTTTCATGATTTTAATTGGTGAAGGTTTCCCTCTCGCTGGATGATTGACGAGGAGATTGGCAGGTTTCGTTTCAGTCTGGGCATGGTTGTATTGAATGTGTGGGTGGCAGTCCTGCCATTGGCCTTCGAGACGAGCTATGGTTGGAATCCAGGGTCTGATTGTTGAAGCGTTTTGGTGTTTGTGAATACAGGCCGACAAGTCAACAATCGTGGACGAAGCGATTAATTACATACAGACCTTGGAGGGGACGATGAAGGGGCTGATGAAGAGGAAGGGCGAGATGTCGAACGCCTCGAGTACGATGATGCCAACATCGCTGGCCCTTCTGCAAGCGTCGCAGCACGGAATGGCCGAGACGGACAGCGTGTGCAAAGTGTCTCCCACCATCAGCTTCGGCGGAGAGATCAAACCATCGGGAAGTGGCAGCTCGACGCCGACCAGTGAAGCCCAATTCCGAACCCAATTGTCCAAGAACGTCGTCCTCAACATGTGCGGCAACGATGCTTTTATCACCATTTGCAGCCCCCGTGGAAGACTCGGACTCCTGTGCCGTGTTCTCTTCGTCATCGAGTCTCACAATTTGCACGTACTCAATGCTCACATCTGCACCACCAACGACACTATCATGTACATGGTCCACGCGCAGGTATGGACTGATCACTGCTATGTCAGTCAGACACTCCACTCCATAGATTCTCAATATTGTCCTTGAAATTAGCTGAATTTGCTCTTTGACAATATCAGCCTGTTTGAAAATGGTCCATTATCCATAAGCACTAATTGATATTCTCCTTGAGGATTGGTACATAGTATTGGATTTTTGAACTAGTCTGATTGAGTATAGGATATCTGAACTCGGCGGCACACATTCGTGCCATGACTATGGTGGAATCCGTGTGCAAAAATGAATTCCCGAATCTGCAGTTGGATCGAGGGAGGGAGGGAGTAGGTCAGTGTGTTGAAACATTCTGCGTGTGGGCCGAGAATGAAATGTCTGAGGACATTCTATGTGAGCTTGTCAGCTGAAATCTTGTCAGTTAAAAATGCATTGTTTGACTGGGTTGGTGCAGACCACAGAGGACCAGCTGGGGAACTCAGACATGCTGAACATAGCGTTGCAAGACCTGACGAAATGTCTTACCGCACACACCTGACGGGGTTGACATTTTATCGATCTGCTCTACTGTACTCCGTATACGCGTGGTACAAGTCTCATGTGGGACCCAGAGTAGGTCTTTCATGTACAAAGAAATTACGAACCAGACGAACCTCGCATCTTGGGACCGTACATCAAATTGAGTTAAATTGCTGTTGTATTTACCATATAGAATCATACAATCACGCTCTGAAACCTTCCAACTCTCAGCTCAGAGTTTCAAGTCCGACTTCTTCATCAGTGCGAGAGTCTATGGGAGTGCACGGCCTCGACCAGAAAGCTCGAAGATGTAGTGTGTTATCGACATCATTGACTTCCCCGGGCTCTCCACTCCACGTTCATGAGGTGGAACACTCAATGATGACACTGGAAAGAATCTTCTGTTGCAAGCAGGTAGGCCCATCATCACTCCACAGATGAAGAATTCTTTGGAAGTGTATAAGACATCGATACTGGCGAGGGGTCAAGCTCATCCACACATTGCCGGCCCCGCTTTGGAGCTGACATGAGATGAGGTCAAGCCAAGATGGTGCGTGATTGGTTGCAGCCGCTAGTAGACTGAGTATGAAATTAATTTTCATAGGAACAATTAGACCGTCAACCTCACCCACCTGCGGGAGGTGTTGTCATCTCTGCTCTGATCATTTTTGTGAGCTCACATCACTGTAAATCGAGGGCTCCAGCCGTGAAAGAGGACCATGTCATGTCCTTGGCCAGCCCTCGGTCCAGATATCGGAGGATTCTCAGCACACGAGTGATACCAGCAGCAGCAGCAGGTGGTTTAGCCTTCCCAAGAGGTAGTCTGATACAGAAAATGTAGGATTCTTAAACGACTGTTTAGACAGAACGACACGACATGAAGTAGAAGAGTCGAGGATAGTCCAAATTGAGTTTGACCATCGCTGATTCTGTGCGTATGATTAGAGAAGTGCGAAGGCTTCACTTCACCTTGAGCCCAGCCCATGGCTTCGAGTTTAGCTAAGTTAGTGTACTAGTCGAGTGGGCGGGCTGATATCAATCAAAGTCACATAGTTTGAACAAGACCGACATGACATGACATGAGTGTTCTTTTCATCGATGATAGTTAAGAGTGCCGGGGCTCTGCCGACTCCCGTCAGAAAACAACCAAAAGCTTTGTACTAAATTTTCCCCCGCTGAATGTGTATTTTTAAATCGATGGGCCAGCTGC

mRNA

>Mapoly0126s0029.1
GAAGTGCTGTTCATCACACACATCATTCTACGACTGACAAAGCGGAGAATCGTCCTGTCTTGGAGTTGTCGGGGAACCGGTTCGCGGAGGCCCAACTGCGGCATTAGTAGAGAGAGCGGAGCTGCTCTAAAAACCGGACGAGGGTGGGCCTTGGCAACTCATACACTCGCTCGCTCGCTCGCTCACACACTTGCTTTGTTTAGCTTTCTGCGACGCTGCCCGCTTCTGCTTCTCGTGATAGTCGTTAGAACCGCACCCCCGCCTCCCCTCCCTTCCAGTACCATCCCCCCACCATATCATAGTCTCTGAAATTCAGACGCCTCGTTCTTCTCCTCGCCTTTCTTCTCGCTCTCTCTCTCACTCATTGTCTCTCATTCTCTCTCTCCTCGGGCTGCCGACATCAGAGAACGGCTCAGACGGGAGCTCGAAGAGCTGCAATATCGCCGCTGGACTCCGAGTCTACAATATACACCGCACCGAATTGTTCTGCGATTCACGAGAGAGACTCTCGTGGCTGCTGCTGCTGCCTGCAGACAGAATTCTCAGATTCATCTGATGAGCAATTGGCGGTGGGCAACCTGAGCGACTCCGGGGTTAGGGACCCGGCCCAACGCAACGCGGCGGCCTTGAATTGCTAGAGATTGTAAAATTCCTGGAATTCGGAACAACGCGGGCGCATTTGTCATCTGAATCAGAGAAGTATTCAGCGCTGCTCGCAGCTCTCGGACCCATCCGCCAATGGGAAGCAGCGCGGGCGGCCCTCGGTGTTCGGCATTCTGGGATCGCCTCGCGGCCTGAATGAATGGTGCGGTGCCCCCCTGCGATTGAAATCGAGAACATGGGTCTCTCATCGGGCCTCTCTTCCTTGACTCGCCCGTCCGATAGCAGACCGGAGCTCCTCTCCGAGTCCTGAACCTCAAGGACCTCGAAGCAGATTTCTCAGACTCTCCTCCATCTCTGAGATATAGCGTCGACGCCTGCCTGCCTGTCTGCCTGCAGCTTCCCGAGAGTTGGTCCGGGCAAGAATCAGAGCTCGAGAGCTCGCGAGCGATCTGAGGAACCAAGATGATGGCTCATAATCTCGCGACTCATTCTCTAACCTCGGCGCTCAATCATAGATCCCCCGCGTACCTCTCGCAAGATCACCAGGCCGTGCGGCACATTTCCGTCATAACAATGCCGGACATCCTCGAAGCTTTCAACCATTCGCAAGCTATGTCGTCGACCACGAATCTGAGCACCTCGGTGCGAAACAGCGGCGGCGATCCATGGGAGCTTCCGGAGCTCAAGTGGCTGGATCCAGCCGACAATGTATCAGGCCCCAGCGAGAATCTGCCCGAAGCCGACAATCCGAGCCTCCCAGCGGAGAAGTTCCCCATTGACGGCGAGAGATGGCCCTTCTCGTCGCTCTATGGCGGAGATCGAGTGCCCTCCAATGCCGAGGAGGCTCAATTCTCGCTGCAGTCCATAGTCAGCGCATCCCCAGCCAGCAGCGGCTCGTCGGTTCTGATGAAGGGCCGCATGAGCTTCGTCGGCCGAGACTTCCCATCGTCGGCGCAGCAGCAGCAGCAGCAGCAGGCGCCCGAGTGGCGCAGCACCAGCGGCAACTCGGGCCACAAGCGCCCGACGTCCGAGAGGCCGGATTCGGACTTCGCGCAGGAGAAGCTGTCGAATTCCGAGCGATCGAGCTTCAAGGACAACAAATCTGTGCCGGACATTCCCGTCTCCAACAGCGAGGTCTCGGCTCTGACAACGACATATCCGCCTGAGAAGCGCAGCCGCACCGCCAGTGACACTCGCGCCACTCGCGACAGCTGCACTCAGGGTGGTGGTGGTGGTGGTGGCGCTGGTGGTAATGGTGGCTCGGGGGCCGATCAGCAGAAGCTCAGCGTCGAGAAGGGCAGCGTCTCCGTCACGAACGATCAGACCGTCAGCCCCGGCCGCGACAGCAAGAAGTCGGCCAACACTGTTTCAGATCATGAAATTCATATCTGGACCGAGCGCGAGCGTCGCAAGAAAATGAACGGAATGTTCTCCACGTTACATTCGCTCCTGCCCCATCTCAACTCCAAGGCCGACAAGTCAACAATCGTGGACGAAGCGATTAATTACATACAGACCTTGGAGGGGACGATGAAGGGGCTGATGAAGAGGAAGGGCGAGATGTCGAACGCCTCGAGTACGATGATGCCAACATCGCTGGCCCTTCTGCAAGCGTCGCAGCACGGAATGGCCGAGACGGACAGCGTGTGCAAAGTGTCTCCCACCATCAGCTTCGGCGGAGAGATCAAACCATCGGGAAGTGGCAGCTCGACGCCGACCAGTGAAGCCCAATTCCGAACCCAATTGTCCAAGAACGTCGTCCTCAACATGTGCGGCAACGATGCTTTTATCACCATTTGCAGCCCCCGTGGAAGACTCGGACTCCTGTGCCGTGTTCTCTTCGTCATCGAGTCTCACAATTTGCACGTACTCAATGCTCACATCTGCACCACCAACGACACTATCATGTACATGGTCCACGCGCAGACCACAGAGGACCAGCTGGGGAACTCAGACATGCTGAACATAGCGTTGCAAGACCTGACGAAATGTCTTACCGCACACACCTGACGGGGTTGACATTTTATCGATCTGCTCTACTGTACTCCGTATACGCGTGGTACAAGTCTCATGTGGGACCCAGAGTAGGTCTTTCATGTACAAAGAAATTACGAACCAGACGAACCTCGCATCTTGGGACCGTACATCAAATTGAGTTAAATTGCTGTTGTATTTACCATATAGAATCATACAATCACGCTCTGAAACCTTCCAACTCTCAGCTCAGAGTTTCAAGTCCGACTTCTTCATCAGTGCGAGAGTCTATGGGAGTGCACGGCCTCGACCAGAAAGCTCGAAGATGTAGTGTGTTATCGACATCATTGACTTCCCCGGGCTCTCCACTCCACGTTCATGAGGTGGAACACTCAATGATGACACTGGAAAGAATCTTCTGTTGCAAGCAGGTAGGCCCATCATCACTCCACAGATGAAGAATTCTTTGGAAGTGTATAAGACATCGATACTGGCGAGGGGTCAAGCTCATCCACACATTGCCGGCCCCGCTTTGGAGCTGACATGAGATGAGGTCAAGCCAAGATGGTGCGTGATTGGTTGCAGCCGCTAGTAGACTGAGTATGAAATTAATTTTCATAGGAACAATTAGACCGTCAACCTCACCCACCTGCGGGAGGTGTTGTCATCTCTGCTCTGATCATTTTTGTGAGCTCACATCACTGTAAATCGAGGGCTCCAGCCGTGAAAGAGGACCATGTCATGTCCTTGGCCAGCCCTCGGTCCAGATATCGGAGGATTCTCAGCACACGAGTGATACCAGCAGCAGCAGCAGGTGGTTTAGCCTTCCCAAGAGGTAGTCTGATACAGAAAATGTAGGATTCTTAAACGACTGTTTAGACAGAACGACACGACATGAAGTAGAAGAGTCGAGGATAGTCCAAATTGAGTTTGACCATCGCTGATTCTGTGCGTATGATTAGAGAAGTGCGAAGGCTTCACTTCACCTTGAGCCCAGCCCATGGCTTCGAGTTTAGCTAAGTTAGTGTACTAGTCGAGTGGGCGGGCTGATATCAATCAAAGTCACATAGTTTGAACAAGACCGACATGACATGACATGAGTGTTCTTTTCATCGATGATAGTTAAGAGTGCCGGGGCTCTGCCGACTCCCGTCAGAAAACAACCAAAAGCTTTGTACTAAATTTTCCCCCGCTGAATGTGTATTTTTAAATCGATGGGCCAGCTGC

CDS

>Mapoly0126s0029.1
ATGATGGCTCATAATCTCGCGACTCATTCTCTAACCTCGGCGCTCAATCATAGATCCCCCGCGTACCTCTCGCAAGATCACCAGGCCGTGCGGCACATTTCCGTCATAACAATGCCGGACATCCTCGAAGCTTTCAACCATTCGCAAGCTATGTCGTCGACCACGAATCTGAGCACCTCGGTGCGAAACAGCGGCGGCGATCCATGGGAGCTTCCGGAGCTCAAGTGGCTGGATCCAGCCGACAATGTATCAGGCCCCAGCGAGAATCTGCCCGAAGCCGACAATCCGAGCCTCCCAGCGGAGAAGTTCCCCATTGACGGCGAGAGATGGCCCTTCTCGTCGCTCTATGGCGGAGATCGAGTGCCCTCCAATGCCGAGGAGGCTCAATTCTCGCTGCAGTCCATAGTCAGCGCATCCCCAGCCAGCAGCGGCTCGTCGGTTCTGATGAAGGGCCGCATGAGCTTCGTCGGCCGAGACTTCCCATCGTCGGCGCAGCAGCAGCAGCAGCAGCAGGCGCCCGAGTGGCGCAGCACCAGCGGCAACTCGGGCCACAAGCGCCCGACGTCCGAGAGGCCGGATTCGGACTTCGCGCAGGAGAAGCTGTCGAATTCCGAGCGATCGAGCTTCAAGGACAACAAATCTGTGCCGGACATTCCCGTCTCCAACAGCGAGGTCTCGGCTCTGACAACGACATATCCGCCTGAGAAGCGCAGCCGCACCGCCAGTGACACTCGCGCCACTCGCGACAGCTGCACTCAGGGTGGTGGTGGTGGTGGTGGCGCTGGTGGTAATGGTGGCTCGGGGGCCGATCAGCAGAAGCTCAGCGTCGAGAAGGGCAGCGTCTCCGTCACGAACGATCAGACCGTCAGCCCCGGCCGCGACAGCAAGAAGTCGGCCAACACTGTTTCAGATCATGAAATTCATATCTGGACCGAGCGCGAGCGTCGCAAGAAAATGAACGGAATGTTCTCCACGTTACATTCGCTCCTGCCCCATCTCAACTCCAAGGCCGACAAGTCAACAATCGTGGACGAAGCGATTAATTACATACAGACCTTGGAGGGGACGATGAAGGGGCTGATGAAGAGGAAGGGCGAGATGTCGAACGCCTCGAGTACGATGATGCCAACATCGCTGGCCCTTCTGCAAGCGTCGCAGCACGGAATGGCCGAGACGGACAGCGTGTGCAAAGTGTCTCCCACCATCAGCTTCGGCGGAGAGATCAAACCATCGGGAAGTGGCAGCTCGACGCCGACCAGTGAAGCCCAATTCCGAACCCAATTGTCCAAGAACGTCGTCCTCAACATGTGCGGCAACGATGCTTTTATCACCATTTGCAGCCCCCGTGGAAGACTCGGACTCCTGTGCCGTGTTCTCTTCGTCATCGAGTCTCACAATTTGCACGTACTCAATGCTCACATCTGCACCACCAACGACACTATCATGTACATGGTCCACGCGCAGACCACAGAGGACCAGCTGGGGAACTCAGACATGCTGAACATAGCGTTGCAAGACCTGACGAAATGTCTTACCGCACACACCTGA

Protein

>Mapoly0126s0029.1
MMAHNLATHSLTSALNHRSPAYLSQDHQAVRHISVITMPDILEAFNHSQAMSSTTNLSTSVRNSGGDPWELPELKWLDPADNVSGPSENLPEADNPSLPAEKFPIDGERWPFSSLYGGDRVPSNAEEAQFSLQSIVSASPASSGSSVLMKGRMSFVGRDFPSSAQQQQQQQAPEWRSTSGNSGHKRPTSERPDSDFAQEKLSNSERSSFKDNKSVPDIPVSNSEVSALTTTYPPEKRSRTASDTRATRDSCTQGGGGGGGAGGNGGSGADQQKLSVEKGSVSVTNDQTVSPGRDSKKSANTVSDHEIHIWTERERRKKMNGMFSTLHSLLPHLNSKADKSTIVDEAINYIQTLEGTMKGLMKRKGEMSNASSTMMPTSLALLQASQHGMAETDSVCKVSPTISFGGEIKPSGSGSSTPTSEAQFRTQLSKNVVLNMCGNDAFITICSPRGRLGLLCRVLFVIESHNLHVLNAHICTTNDTIMYMVHAQTTEDQLGNSDMLNIALQDLTKCLTAHT

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>