Mapoly0130s0030



Description

CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
PFAM PF00170 BZIP transcription factor
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF114

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP14 transcription factor, bZIP Mapoly0130s0030.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0130s0030.1 scaffold_130:247810..255234  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0130s0030.2 scaffold_130:247905..255995  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0130s0030.3 scaffold_130:247905..255066  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0130s0030.1  

Gene structure:

mRNA scaffold_130:247810..255234  ( + strand )
five_prime_UTR scaffold_130:247810..248330  ( + strand )
CDS scaffold_130:248331..250407  ( + strand )
CDS scaffold_130:253688..254175  ( + strand )
three_prime_UTR scaffold_130:254176..254185  ( + strand )
three_prime_UTR scaffold_130:254486..255234  ( + strand )

Sequences:

Gene

>Mapoly0130s0030.1
GGGTCCTTCGGAGCGACGTTTCGGTCGTCGGCCGTGCCGGCTTCGAGGAAGGCATGCTACGGCAGACGTCGGATACCGAATCCGACGGCCGGGGAGAGCGGAGCCAGACGAGCCCCTTGCAGACGGGCGCGACGTTTGAGGGAGGCAATTGCGCTGGCCATCGAGAAACTCAGAGGAATCGGGGATGCATAATTGCTGGAGTGTGAATCGATCGAGAGCTTCGTGGAGTGTTGAAGTATCAACCCTCGGTGTGATTGTAGCGTGAAAGCTCAGATCGGACGGGAAGATTAAGAAGCGGACGAATCGTGTCGAGCCGGCACCCCTATGCTGATCTCGTGGTCGTGATCGTTAAGAATTTCTCCATGGCTCGGGACAATTGGCGAGATTTTCTAATCTACCTCGTGAAGTAGTCGTCGGAGGCGCGTTTCTCGGTTTCTCGTCTGGGTTTTGTGAGTGCAAGAGCGGGGAGACGGTATGAGCAGAGACTGATTTTTTCGCGGGTGCTTTTCGGTCCAGAGGTGATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGGTAATACTCACCTTTCAGGCCAAGAACACCTTGGTAATCCTTCGATAGTTACTGTTTCTCTTCATGACAAGTATTGTATTATCTGTTGGATGTCTTGGATGCCTTATTCTGCTAAATTCTCGATACGTCTTATCTACTTCTCGCAAAAACTTGGCTCCAATTCGACAACCTTTGGTCAGAATCTTATTCCTAAATTTCTGCAACGAGTTTATTTCCGTCGTTTCTGTTATTAACTTCTAGGAAGTTGAATCTTCACATCATTCACTGGTACCACATGAAAAGTCCATACACTCTACAGGTTTCTGTTGGGTTTACATCTCTGATTTTCAGTTTCGTTTGGCTTTCTTTTCCTAGTCCATCACCCTTTCTATCACACAGTGCTGTACATCATATCCCGACGTCCATGTGTGGAAGATCGCTAGGGTGCGTGTTTTACTTCGCACTCGATCGAACTTCAGTACCTTTCATCATTTATAGTTCTTTCCTGACCCTAGACTTCTACAGCATCATGCGTAATTGCGTCCCCTCCTTCCAATAGGAAAGGCCCTCTTGGAGGTACCTCAAATGGGCTCTATCAGATTGATTTAGTGTGGATGCTGATAAACGACTGTTGGAGTCTAATCACAACGAAAGTGTTTGCAAAGGAGATCGCTTTAGACCTTGTTGCCCATCTGTTTCTTAGTACGTTACAATACTGACGGTGATGGTCGTATCTGTTCTCGGAATTGGTGTCTTACATGTAAGGTCTGAAAGACCTTTCGATTGATTGGGAAACATTTGAGATAATGTGCGCAGCAATTGGCTTTGAATTTACCGATACTAGTAAGGATCAGGAATTTGTGCATAACGAAAGGACCGTATTTACGGCTAGCTCGCCTGGAAAAGGTACTATACAAGTAGGTCTGCACCCGGAAGTGGTCTTCACTATCCTTCCGCCATCGTCTGGCTGGAGATCATTTGTAGACCAGGGTGACCCCAGAAACAAGACCTGGCTAGCGCCTGATTCTTGCGAAGCTGGTCCCCATGTTCCGTATGCCTTGAACGTAACTTTCGGTTTCCATGAATTCCTGGAGAGACCTATATCTCTGGGTGAGAAATTCAAGTACAAAAGGTACGATAGATGCAGACGCTTATTACAGTGCAGTGGGACTTTCCCGAGTACAGTAGGAGGCCTCAGGTCGCGGACTTCGGAGTTTTGCTTGCTGATAGACCCAAAAGAGAACCTGCAGGGTGCTCACTTACTAGTCAACAACCAGAGTCACGTTTGCGTATGCCAGCTTCGGTGGGAAAGCACTATGCTGAACACCACCAGTGTGTCCATCCGCTTGCATCCTATACCCATTGGTACAGAAAATTCAAACAACAAAGACAAGGAAGACTCCTGGCTTTATTTACTGGACCCCCTGGTGGATATTCCTGGGTATGTAGACACTAATCATACTTGCAGACATAGACCATGGGTTAAGTACGAAGTTGTTGGTGACAGTACGAGTATGAACCTTGACATTAAGTGCTTTCAATCCCCAATCGAGTGCTAAACAACGTTGCACGGGTAGGTTGTGTTTCACCCTTTCTCCTGTACAATTTCTTTCTGAATAACTTCCTTAGTTCTCCTTGCCCACATATTAAGTGGAGTAGAAAATACTTCAATGGAAGCATCCGAACCATGTGCAGGAGGAATTTTTATCGACGTCTTTCTGCCTAGCACATTTTAGGTTCACTATGACAAGAACAAACGTGTATTGTTAACAGATATGCGAGAACATATTGGATAGGATACTGAGAGCCTTCATACAACGGACTACTTAATCAAGACATATTAGAAATTAAACCTAGCATCTTTGATTTGTCAACTACCTGCATGAGAAACTTTCGCCTCTACAGTATTTTCAGTCTGGAATTTGTTGGTGAGTGCTGAGTTGATTAAAACTTTCATATTAGAACATGGTAACATCGGAAAGAAGAGAGTGGAGTCTGCATACCTTTTACTCGTGAACTACTATAACTACTTTATCTGGTCTGCTGAAGGTTTGCGTCGTGGATCCCATTCTTTGTTATTTTACCTAGCTCTTAAGGTCAGAAAAGACAAACGCTCAATCTACAGTTGAAAAAAAGCTGTTATGTTTTGATGTCTGCGAGGAAAAGGAGATATTGATTATCTTTCCTGATAGTTATCTCAAACTGTAGATTTCCTGAATTCCCCTTTGTGTCACGTGCTAGTGCTGAAGAAGGCAAAAAGTACTCTCCAAACAGTTGTGATGGAGAGGTATGGAATACCTCTCGAAAACCAGAGAGCTTTTCGTGTCACTCAAACAACTGTACATGGTCGCAACAGACCGTCCCCCAAGCCCATGGTTGGAAACTTGCAGCAGTGGGTTCTGGATGATTACCATCCAGGTACTAATCTCTTCTGGGGCGAAGATCTCCATAGTTTTCGTTTGATCAATGAATGTTCCAATTGTTCCCATTTAACCCAGGGTCAGAAGTTTAGTCCAAGTAGAGGATGTATCGAAGTTTTCTTGCCTAATGTTCAATAAAGAAAAATTCCACGATTAAGCTGTACCTGATCTATAGACGTAAATTTATACGGAATGAATTAGACATTGCCATCAACAAGTCATAGTTTACTGCTCTAAAGTGTAGCGTTGAACCAGTGTTATCTGCAATTCTGTTGCTCATGGTACAAAAAGTTGAGGCATTGTAAAACTTCATTACTTGCATTTGATATGTACCATCCGTCAAGATCCTTCTGGACTTCTCTGTTTTAAAGTTTTAGTGGGTAGATGGGTTACTGATGCAAGAGGTTTTATAGGTCAGCGGAAGTTGAGCAAACTGACAAAGATCCTTGTGTTCTTTCTAGTAAAGAAGCTTGAATATAACTGAAATGATAAGCCAACATGACAAGAGTATGAACCCGAAGACTTGTGGATGTCTTTCAACTACTGAGTCTATTTCAATGGGCACTGTGTGTCACAATTTCCCTTCTAAACCAAGAAGAAGCACAAAATGTAAATGGGAACTTGAGCTGCAAAAGGGAGATAATGGCGCTGCCTGCTCAAGGCGAGAAAAGGTATGCACGTTTCAACGGCGGAGGGTCATGTTCATGAAGTAAATACCTATGCTATGGAACACCTCTGGTGACTTACTGCACCTACTAACGGCGTAAGCTGGTATCCAAATTGGCTTCATGCTTTTTAATAACCTGGGAGATTGAGCGTCAGACACTACTGGAGATTTAAGGTTTTCGTTACTAAATTGTGAATTCGCACTTTGTCTACAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGATTATCTGCAGGTAAGCACTGTAGCCAACATTTACTCGTTTTACTTGAGTTCCTGTTATAAAACCATCCGAGTTTCATTTCTTCCATTTCTAGCACAATCTTGTTACATCACACCACGAAAGATGTGGTCTAAATTCTACCAGTCTTGTTTAAGTTTATCACATATAAGCCCATAAGCCTTTGCATATGTGTATGACGAGATCTCTTTGATACATAGGCATCAACCTTGATACGATCATTACCTGTGGTTTGACCTCTCTCGTCGGACTACAAGAAGACTTTCTTAGTGGATGATGTGGCAGTGCACGCAGGTTCGCGAAATCGGGACGTAGAGGAACACTTTTCTTGTCTGCGTCTAGAGACGGCTCAAACTATGGGAAGAGGTAGAAGGGAACACCATCAGGGATACTGAGCCCTGATAAGGAGCGAATCTGAGCTGAGGTTTGAAATGTCGGCTGGCTTGGAGGTGATGGGTTTAGATACTTAGGTCCAAAGTTTCACATTATTTGCCAATTAGACCGTTCCTATCCTACCGTTCATTCGTCCAGGAGGAACTTTCTGAGAAATTACCCTTTGTGGGGTTTGTAAATTATCACACTTGTATATATATTTATTTAAGTCTAAAATTATTTATTCAATCTTGATTCCGATTTGAGGTCTTAGTGTGAATTGTTGTGTTTCTGATTTTTCGAAGTCAACTTGCTGGTGAAGGACCCCTTTGGCCGAGAGGTAGAGAAGTTTTTAATGCTTTTTGGTTGTTCCACGCATCAGACAATGCTTGAATACTAAGCAATTCTCTTCTATGTTGCGGAAATGTATCCCACTACAGGAGAGATACTCTTCACTGAGTCTTGTCTATCCTTCTTACCCAGCAGGCCCTCATTTTCTTGTCCTTTACAATGAGCTTGCCAGGATAGATTCTATGCGTTGAATGCAAGGATAGGCATACGGCAGTGGGGAACAGTTTTGTAATTAGATGACTTAGCTTTTTTCCTTAAAGCCAATTGGTGCATTTACGATGTTGTGTCGTGTAAACGTGAGTGTGTTCTTTCAAAGAGCT

mRNA

>Mapoly0130s0030.1
GGGTCCTTCGGAGCGACGTTTCGGTCGTCGGCCGTGCCGGCTTCGAGGAAGGCATGCTACGGCAGACGTCGGATACCGAATCCGACGGCCGGGGAGAGCGGAGCCAGACGAGCCCCTTGCAGACGGGCGCGACGTTTGAGGGAGGCAATTGCGCTGGCCATCGAGAAACTCAGAGGAATCGGGGATGCATAATTGCTGGAGTGTGAATCGATCGAGAGCTTCGTGGAGTGTTGAAGTATCAACCCTCGGTGTGATTGTAGCGTGAAAGCTCAGATCGGACGGGAAGATTAAGAAGCGGACGAATCGTGTCGAGCCGGCACCCCTATGCTGATCTCGTGGTCGTGATCGTTAAGAATTTCTCCATGGCTCGGGACAATTGGCGAGATTTTCTAATCTACCTCGTGAAGTAGTCGTCGGAGGCGCGTTTCTCGGTTTCTCGTCTGGGTTTTGTGAGTGCAAGAGCGGGGAGACGGTATGAGCAGAGACTGATTTTTTCGCGGGTGCTTTTCGGTCCAGAGGTGATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGATTATCTGCAGGTTCGCGAAATCGGGACGTAGAGGAACACTTTTCTTGTCTGCGTCTAGAGACGGCTCAAACTATGGGAAGAGGTAGAAGGGAACACCATCAGGGATACTGAGCCCTGATAAGGAGCGAATCTGAGCTGAGGTTTGAAATGTCGGCTGGCTTGGAGGTGATGGGTTTAGATACTTAGGTCCAAAGTTTCACATTATTTGCCAATTAGACCGTTCCTATCCTACCGTTCATTCGTCCAGGAGGAACTTTCTGAGAAATTACCCTTTGTGGGGTTTGTAAATTATCACACTTGTATATATATTTATTTAAGTCTAAAATTATTTATTCAATCTTGATTCCGATTTGAGGTCTTAGTGTGAATTGTTGTGTTTCTGATTTTTCGAAGTCAACTTGCTGGTGAAGGACCCCTTTGGCCGAGAGGTAGAGAAGTTTTTAATGCTTTTTGGTTGTTCCACGCATCAGACAATGCTTGAATACTAAGCAATTCTCTTCTATGTTGCGGAAATGTATCCCACTACAGGAGAGATACTCTTCACTGAGTCTTGTCTATCCTTCTTACCCAGCAGGCCCTCATTTTCTTGTCCTTTACAATGAGCTTGCCAGGATAGATTCTATGCGTTGAATGCAAGGATAGGCATACGGCAGTGGGGAACAGTTTTGTAATTAGATGACTTAGCTTTTTTCCTTAAAGCCAATTGGTGCATTTACGATGTTGTGTCGTGTAAACGTGAGTGTGTTCTTTCAAAGAGCT

CDS

>Mapoly0130s0030.1
ATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGA

Protein

>Mapoly0130s0030.1
MEVEVVEADNGVNPNNDSSMAIDMAIPGGFEDENALMMDSSVETADLGEDWVSLFFDESYLNAMTTSGEVEQQFLPGSDAPAAAPGSIGNGIQISNRAVSPSTMILSSSPASASSGCPFSANVDIYPENHNATDKTPLPTAAAISPPPHPAGSPESTLSQASGASSCAVQPCWWGNEDLEEDGVHGSEEESSTSNYGATDPSAVAPDASKAPIQAQEVKGGAEPASSVGKIATGARGSVERSDRKRRSWEREEAENGQQQSQCAQSEIDRKGSESGDGLGGEEDDEKRQARLMRNRESAQLSRQRKKVYVDELEGRLRTMAATIAELTATITHLTAENVNLRRQLGFFYQPARPAGGMPIMQYPGLVRPVYPGAPMPPVPIPRLKPQQSLTKTPKRAKSTREPGEKKKVKKVASLATAGVMGLLCITMLLGPFDWGSSTVSSGTTHIHVGNAQIRVGGRVLTSWNEEGVEDLRNMTPREPWADGGGGNIGHVNSAGAGGRNGVGGRARSRIDRRNGNILRRNFSAGTERVWQSCSECYSRRDEPRTAPNLVEKLVATNVSEQVSLIVPRNNRLIKVDGNLIIRAVMAGDKAAEDSGKEEHSSQEGENGRGQVKQDLSRSSRSPPTPADHRLIKAISTQAQEGGGIVVGERQSRNVGAIREDKNVQKPAYKSDALASVSATPTFSQLVLGSLAGPVLSTGMCTEVFRFDTSPTRTAPNTETSRGSSSVAEDQVSGVREEKTSAKTTEEPSTRKKRDPYAVPLPPIRRQDGNGTEPVVDKVFKGQQSDTEGHDASTMVVSVFTGPQDVSAEDSRTGGGPAKGLSQIFVVVLVDSVKYITYSCMLPPTGSQVHVVAS

Mapoly0130s0030.2  

Gene structure:

mRNA scaffold_130:247905..255995  ( + strand )
five_prime_UTR scaffold_130:247905..248330  ( + strand )
CDS scaffold_130:248331..250407  ( + strand )
CDS scaffold_130:253688..254175  ( + strand )
three_prime_UTR scaffold_130:254176..254185  ( + strand )
three_prime_UTR scaffold_130:254486..254640  ( + strand )
three_prime_UTR scaffold_130:255344..255995  ( + strand )

Sequences:

Gene

>Mapoly0130s0030.2
GAGCGGAGCCAGACGAGCCCCTTGCAGACGGGCGCGACGTTTGAGGGAGGCAATTGCGCTGGCCATCGAGAAACTCAGAGGAATCGGGGATGCATAATTGCTGGAGTGTGAATCGATCGAGAGCTTCGTGGAGTGTTGAAGTATCAACCCTCGGTGTGATTGTAGCGTGAAAGCTCAGATCGGACGGGAAGATTAAGAAGCGGACGAATCGTGTCGAGCCGGCACCCCTATGCTGATCTCGTGGTCGTGATCGTTAAGAATTTCTCCATGGCTCGGGACAATTGGCGAGATTTTCTAATCTACCTCGTGAAGTAGTCGTCGGAGGCGCGTTTCTCGGTTTCTCGTCTGGGTTTTGTGAGTGCAAGAGCGGGGAGACGGTATGAGCAGAGACTGATTTTTTCGCGGGTGCTTTTCGGTCCAGAGGTGATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGGTAATACTCACCTTTCAGGCCAAGAACACCTTGGTAATCCTTCGATAGTTACTGTTTCTCTTCATGACAAGTATTGTATTATCTGTTGGATGTCTTGGATGCCTTATTCTGCTAAATTCTCGATACGTCTTATCTACTTCTCGCAAAAACTTGGCTCCAATTCGACAACCTTTGGTCAGAATCTTATTCCTAAATTTCTGCAACGAGTTTATTTCCGTCGTTTCTGTTATTAACTTCTAGGAAGTTGAATCTTCACATCATTCACTGGTACCACATGAAAAGTCCATACACTCTACAGGTTTCTGTTGGGTTTACATCTCTGATTTTCAGTTTCGTTTGGCTTTCTTTTCCTAGTCCATCACCCTTTCTATCACACAGTGCTGTACATCATATCCCGACGTCCATGTGTGGAAGATCGCTAGGGTGCGTGTTTTACTTCGCACTCGATCGAACTTCAGTACCTTTCATCATTTATAGTTCTTTCCTGACCCTAGACTTCTACAGCATCATGCGTAATTGCGTCCCCTCCTTCCAATAGGAAAGGCCCTCTTGGAGGTACCTCAAATGGGCTCTATCAGATTGATTTAGTGTGGATGCTGATAAACGACTGTTGGAGTCTAATCACAACGAAAGTGTTTGCAAAGGAGATCGCTTTAGACCTTGTTGCCCATCTGTTTCTTAGTACGTTACAATACTGACGGTGATGGTCGTATCTGTTCTCGGAATTGGTGTCTTACATGTAAGGTCTGAAAGACCTTTCGATTGATTGGGAAACATTTGAGATAATGTGCGCAGCAATTGGCTTTGAATTTACCGATACTAGTAAGGATCAGGAATTTGTGCATAACGAAAGGACCGTATTTACGGCTAGCTCGCCTGGAAAAGGTACTATACAAGTAGGTCTGCACCCGGAAGTGGTCTTCACTATCCTTCCGCCATCGTCTGGCTGGAGATCATTTGTAGACCAGGGTGACCCCAGAAACAAGACCTGGCTAGCGCCTGATTCTTGCGAAGCTGGTCCCCATGTTCCGTATGCCTTGAACGTAACTTTCGGTTTCCATGAATTCCTGGAGAGACCTATATCTCTGGGTGAGAAATTCAAGTACAAAAGGTACGATAGATGCAGACGCTTATTACAGTGCAGTGGGACTTTCCCGAGTACAGTAGGAGGCCTCAGGTCGCGGACTTCGGAGTTTTGCTTGCTGATAGACCCAAAAGAGAACCTGCAGGGTGCTCACTTACTAGTCAACAACCAGAGTCACGTTTGCGTATGCCAGCTTCGGTGGGAAAGCACTATGCTGAACACCACCAGTGTGTCCATCCGCTTGCATCCTATACCCATTGGTACAGAAAATTCAAACAACAAAGACAAGGAAGACTCCTGGCTTTATTTACTGGACCCCCTGGTGGATATTCCTGGGTATGTAGACACTAATCATACTTGCAGACATAGACCATGGGTTAAGTACGAAGTTGTTGGTGACAGTACGAGTATGAACCTTGACATTAAGTGCTTTCAATCCCCAATCGAGTGCTAAACAACGTTGCACGGGTAGGTTGTGTTTCACCCTTTCTCCTGTACAATTTCTTTCTGAATAACTTCCTTAGTTCTCCTTGCCCACATATTAAGTGGAGTAGAAAATACTTCAATGGAAGCATCCGAACCATGTGCAGGAGGAATTTTTATCGACGTCTTTCTGCCTAGCACATTTTAGGTTCACTATGACAAGAACAAACGTGTATTGTTAACAGATATGCGAGAACATATTGGATAGGATACTGAGAGCCTTCATACAACGGACTACTTAATCAAGACATATTAGAAATTAAACCTAGCATCTTTGATTTGTCAACTACCTGCATGAGAAACTTTCGCCTCTACAGTATTTTCAGTCTGGAATTTGTTGGTGAGTGCTGAGTTGATTAAAACTTTCATATTAGAACATGGTAACATCGGAAAGAAGAGAGTGGAGTCTGCATACCTTTTACTCGTGAACTACTATAACTACTTTATCTGGTCTGCTGAAGGTTTGCGTCGTGGATCCCATTCTTTGTTATTTTACCTAGCTCTTAAGGTCAGAAAAGACAAACGCTCAATCTACAGTTGAAAAAAAGCTGTTATGTTTTGATGTCTGCGAGGAAAAGGAGATATTGATTATCTTTCCTGATAGTTATCTCAAACTGTAGATTTCCTGAATTCCCCTTTGTGTCACGTGCTAGTGCTGAAGAAGGCAAAAAGTACTCTCCAAACAGTTGTGATGGAGAGGTATGGAATACCTCTCGAAAACCAGAGAGCTTTTCGTGTCACTCAAACAACTGTACATGGTCGCAACAGACCGTCCCCCAAGCCCATGGTTGGAAACTTGCAGCAGTGGGTTCTGGATGATTACCATCCAGGTACTAATCTCTTCTGGGGCGAAGATCTCCATAGTTTTCGTTTGATCAATGAATGTTCCAATTGTTCCCATTTAACCCAGGGTCAGAAGTTTAGTCCAAGTAGAGGATGTATCGAAGTTTTCTTGCCTAATGTTCAATAAAGAAAAATTCCACGATTAAGCTGTACCTGATCTATAGACGTAAATTTATACGGAATGAATTAGACATTGCCATCAACAAGTCATAGTTTACTGCTCTAAAGTGTAGCGTTGAACCAGTGTTATCTGCAATTCTGTTGCTCATGGTACAAAAAGTTGAGGCATTGTAAAACTTCATTACTTGCATTTGATATGTACCATCCGTCAAGATCCTTCTGGACTTCTCTGTTTTAAAGTTTTAGTGGGTAGATGGGTTACTGATGCAAGAGGTTTTATAGGTCAGCGGAAGTTGAGCAAACTGACAAAGATCCTTGTGTTCTTTCTAGTAAAGAAGCTTGAATATAACTGAAATGATAAGCCAACATGACAAGAGTATGAACCCGAAGACTTGTGGATGTCTTTCAACTACTGAGTCTATTTCAATGGGCACTGTGTGTCACAATTTCCCTTCTAAACCAAGAAGAAGCACAAAATGTAAATGGGAACTTGAGCTGCAAAAGGGAGATAATGGCGCTGCCTGCTCAAGGCGAGAAAAGGTATGCACGTTTCAACGGCGGAGGGTCATGTTCATGAAGTAAATACCTATGCTATGGAACACCTCTGGTGACTTACTGCACCTACTAACGGCGTAAGCTGGTATCCAAATTGGCTTCATGCTTTTTAATAACCTGGGAGATTGAGCGTCAGACACTACTGGAGATTTAAGGTTTTCGTTACTAAATTGTGAATTCGCACTTTGTCTACAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGATTATCTGCAGGTAAGCACTGTAGCCAACATTTACTCGTTTTACTTGAGTTCCTGTTATAAAACCATCCGAGTTTCATTTCTTCCATTTCTAGCACAATCTTGTTACATCACACCACGAAAGATGTGGTCTAAATTCTACCAGTCTTGTTTAAGTTTATCACATATAAGCCCATAAGCCTTTGCATATGTGTATGACGAGATCTCTTTGATACATAGGCATCAACCTTGATACGATCATTACCTGTGGTTTGACCTCTCTCGTCGGACTACAAGAAGACTTTCTTAGTGGATGATGTGGCAGTGCACGCAGGTTCGCGAAATCGGGACGTAGAGGAACACTTTTCTTGTCTGCGTCTAGAGACGGCTCAAACTATGGGAAGAGGTAGAAGGGAACACCATCAGGGATACTGAGCCCTGATAAGGAGCGAATCTGAGCTGAGGTTTGAAATGTCGGCTGGCTTGGAGGTGATGGGTTTAGATACTTAGGTCCAAAGTTTCACATTATTTGCCAATTAGACCGTTCCTATCCTACCGTTCATTCGTCCAGGAGGAACTTTCTGAGAAATTACCCTTTGTGGGGTTTGTAAATTATCACACTTGTATATATATTTATTTAAGTCTAAAATTATTTATTCAATCTTGATTCCGATTTGAGGTCTTAGTGTGAATTGTTGTGTTTCTGATTTTTCGAAGTCAACTTGCTGGTGAAGGACCCCTTTGGCCGAGAGGTAGAGAAGTTTTTAATGCTTTTTGGTTGTTCCACGCATCAGACAATGCTTGAATACTAAGCAATTCTCTTCTATGTTGCGGAAATGTATCCCACTACAGGAGAGATACTCTTCACTGAGTCTTGTCTATCCTTCTTACCCAGCAGGCCCTCATTTTCTTGTCCTTTACAATGAGCTTGCCAGGATAGATTCTATGCGTTGAATGCAAGGATAGGCATACGGCAGTGGGGAACAGTTTTGTAATTAGATGACTTAGCTTTTTTCCTTAAAGCCAATTGGTGCATTTACGATGTTGTGTCGTGTAAACGTGAGTGTGTTCTTTCAAAGAGCTCTGAATTTCTTTCTTTCTGTTACATATTCCTTGTCATGTTCAGTCTCAGAGCTAATCAACATAGAGAGATTTCTGAAATCGTTTCTATTACATATTGATGTTAATGCAGATATCTTACGATCAGTAAAAGATATTTCGCACTGTAATGCCACTAGCCCCATCCTAACCCATTTTTTTCATCGGTGAAGGATCCTGTTTGCTATTGTACTGGCATGATTGCCTTTGAATGCTAGAAGTTCCTACAAATTTATGCAAATATTTTTATACCATATATTACATAGTATACAAATGCAACATCTAGAAGATTAAGAAACTTGGTACTGATGAAGCTATAATGCGAACGATGTGGGAAAGACATATCCATGGAGCATGTGTCTACCGGAGTGCGAAATACTGAAGTGGACCCAGAGGAGAGGAATCAAGAGAGGGGTGGAACGGAACGACGAACAGACCCGAGCTCTCCAAGAGGAAATTCTGGGTGTATTGAAAGAAAGAAAGAATAACAGAGTCCCAATTGCTTGCAACAACGTCTGCAAGAAATATGAAATTATCTAATAATAGGAGGGAGAGTAGTATGTGAAAAGAGATAGAAAACTAAGACGGTAGGATGTAATCAAAGTGTGGCAAGCCAGACTTACCGAAGAGCTAGGACTACAAGTAAATGCAGGTACGGCAATGATGGAGCTATTCAATGAGATACCAGCTCTGCACTTTAAGACTTTAGCTAGAGAAAATATAGGAGACCAAAACGATAAACAGAA

mRNA

>Mapoly0130s0030.2
GAGCGGAGCCAGACGAGCCCCTTGCAGACGGGCGCGACGTTTGAGGGAGGCAATTGCGCTGGCCATCGAGAAACTCAGAGGAATCGGGGATGCATAATTGCTGGAGTGTGAATCGATCGAGAGCTTCGTGGAGTGTTGAAGTATCAACCCTCGGTGTGATTGTAGCGTGAAAGCTCAGATCGGACGGGAAGATTAAGAAGCGGACGAATCGTGTCGAGCCGGCACCCCTATGCTGATCTCGTGGTCGTGATCGTTAAGAATTTCTCCATGGCTCGGGACAATTGGCGAGATTTTCTAATCTACCTCGTGAAGTAGTCGTCGGAGGCGCGTTTCTCGGTTTCTCGTCTGGGTTTTGTGAGTGCAAGAGCGGGGAGACGGTATGAGCAGAGACTGATTTTTTCGCGGGTGCTTTTCGGTCCAGAGGTGATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGATTATCTGCAGGTTCGCGAAATCGGGACGTAGAGGAACACTTTTCTTGTCTGCGTCTAGAGACGGCTCAAACTATGGGAAGAGGTAGAAGGGAACACCATCAGGGATACTGAGCCCTGATAAGGAGCGAATCTGAGCTGAGGTTTGAAATGTCGGCTGGCTTGGAGATATCTTACGATCAGTAAAAGATATTTCGCACTGTAATGCCACTAGCCCCATCCTAACCCATTTTTTTCATCGGTGAAGGATCCTGTTTGCTATTGTACTGGCATGATTGCCTTTGAATGCTAGAAGTTCCTACAAATTTATGCAAATATTTTTATACCATATATTACATAGTATACAAATGCAACATCTAGAAGATTAAGAAACTTGGTACTGATGAAGCTATAATGCGAACGATGTGGGAAAGACATATCCATGGAGCATGTGTCTACCGGAGTGCGAAATACTGAAGTGGACCCAGAGGAGAGGAATCAAGAGAGGGGTGGAACGGAACGACGAACAGACCCGAGCTCTCCAAGAGGAAATTCTGGGTGTATTGAAAGAAAGAAAGAATAACAGAGTCCCAATTGCTTGCAACAACGTCTGCAAGAAATATGAAATTATCTAATAATAGGAGGGAGAGTAGTATGTGAAAAGAGATAGAAAACTAAGACGGTAGGATGTAATCAAAGTGTGGCAAGCCAGACTTACCGAAGAGCTAGGACTACAAGTAAATGCAGGTACGGCAATGATGGAGCTATTCAATGAGATACCAGCTCTGCACTTTAAGACTTTAGCTAGAGAAAATATAGGAGACCAAAACGATAAACAGAA

CDS

>Mapoly0130s0030.2
ATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGA

Protein

>Mapoly0130s0030.2
MEVEVVEADNGVNPNNDSSMAIDMAIPGGFEDENALMMDSSVETADLGEDWVSLFFDESYLNAMTTSGEVEQQFLPGSDAPAAAPGSIGNGIQISNRAVSPSTMILSSSPASASSGCPFSANVDIYPENHNATDKTPLPTAAAISPPPHPAGSPESTLSQASGASSCAVQPCWWGNEDLEEDGVHGSEEESSTSNYGATDPSAVAPDASKAPIQAQEVKGGAEPASSVGKIATGARGSVERSDRKRRSWEREEAENGQQQSQCAQSEIDRKGSESGDGLGGEEDDEKRQARLMRNRESAQLSRQRKKVYVDELEGRLRTMAATIAELTATITHLTAENVNLRRQLGFFYQPARPAGGMPIMQYPGLVRPVYPGAPMPPVPIPRLKPQQSLTKTPKRAKSTREPGEKKKVKKVASLATAGVMGLLCITMLLGPFDWGSSTVSSGTTHIHVGNAQIRVGGRVLTSWNEEGVEDLRNMTPREPWADGGGGNIGHVNSAGAGGRNGVGGRARSRIDRRNGNILRRNFSAGTERVWQSCSECYSRRDEPRTAPNLVEKLVATNVSEQVSLIVPRNNRLIKVDGNLIIRAVMAGDKAAEDSGKEEHSSQEGENGRGQVKQDLSRSSRSPPTPADHRLIKAISTQAQEGGGIVVGERQSRNVGAIREDKNVQKPAYKSDALASVSATPTFSQLVLGSLAGPVLSTGMCTEVFRFDTSPTRTAPNTETSRGSSSVAEDQVSGVREEKTSAKTTEEPSTRKKRDPYAVPLPPIRRQDGNGTEPVVDKVFKGQQSDTEGHDASTMVVSVFTGPQDVSAEDSRTGGGPAKGLSQIFVVVLVDSVKYITYSCMLPPTGSQVHVVAS

Mapoly0130s0030.3  

Gene structure:

mRNA scaffold_130:247905..255066  ( + strand )
five_prime_UTR scaffold_130:247905..248330  ( + strand )
CDS scaffold_130:248331..250407  ( + strand )
CDS scaffold_130:252628..252804  ( + strand )
CDS scaffold_130:253268..253290  ( + strand )
three_prime_UTR scaffold_130:253291..253477  ( + strand )
three_prime_UTR scaffold_130:253688..254185  ( + strand )
three_prime_UTR scaffold_130:254486..255066  ( + strand )

Sequences:

Gene

>Mapoly0130s0030.3
GAGCGGAGCCAGACGAGCCCCTTGCAGACGGGCGCGACGTTTGAGGGAGGCAATTGCGCTGGCCATCGAGAAACTCAGAGGAATCGGGGATGCATAATTGCTGGAGTGTGAATCGATCGAGAGCTTCGTGGAGTGTTGAAGTATCAACCCTCGGTGTGATTGTAGCGTGAAAGCTCAGATCGGACGGGAAGATTAAGAAGCGGACGAATCGTGTCGAGCCGGCACCCCTATGCTGATCTCGTGGTCGTGATCGTTAAGAATTTCTCCATGGCTCGGGACAATTGGCGAGATTTTCTAATCTACCTCGTGAAGTAGTCGTCGGAGGCGCGTTTCTCGGTTTCTCGTCTGGGTTTTGTGAGTGCAAGAGCGGGGAGACGGTATGAGCAGAGACTGATTTTTTCGCGGGTGCTTTTCGGTCCAGAGGTGATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGGTAATACTCACCTTTCAGGCCAAGAACACCTTGGTAATCCTTCGATAGTTACTGTTTCTCTTCATGACAAGTATTGTATTATCTGTTGGATGTCTTGGATGCCTTATTCTGCTAAATTCTCGATACGTCTTATCTACTTCTCGCAAAAACTTGGCTCCAATTCGACAACCTTTGGTCAGAATCTTATTCCTAAATTTCTGCAACGAGTTTATTTCCGTCGTTTCTGTTATTAACTTCTAGGAAGTTGAATCTTCACATCATTCACTGGTACCACATGAAAAGTCCATACACTCTACAGGTTTCTGTTGGGTTTACATCTCTGATTTTCAGTTTCGTTTGGCTTTCTTTTCCTAGTCCATCACCCTTTCTATCACACAGTGCTGTACATCATATCCCGACGTCCATGTGTGGAAGATCGCTAGGGTGCGTGTTTTACTTCGCACTCGATCGAACTTCAGTACCTTTCATCATTTATAGTTCTTTCCTGACCCTAGACTTCTACAGCATCATGCGTAATTGCGTCCCCTCCTTCCAATAGGAAAGGCCCTCTTGGAGGTACCTCAAATGGGCTCTATCAGATTGATTTAGTGTGGATGCTGATAAACGACTGTTGGAGTCTAATCACAACGAAAGTGTTTGCAAAGGAGATCGCTTTAGACCTTGTTGCCCATCTGTTTCTTAGTACGTTACAATACTGACGGTGATGGTCGTATCTGTTCTCGGAATTGGTGTCTTACATGTAAGGTCTGAAAGACCTTTCGATTGATTGGGAAACATTTGAGATAATGTGCGCAGCAATTGGCTTTGAATTTACCGATACTAGTAAGGATCAGGAATTTGTGCATAACGAAAGGACCGTATTTACGGCTAGCTCGCCTGGAAAAGGTACTATACAAGTAGGTCTGCACCCGGAAGTGGTCTTCACTATCCTTCCGCCATCGTCTGGCTGGAGATCATTTGTAGACCAGGGTGACCCCAGAAACAAGACCTGGCTAGCGCCTGATTCTTGCGAAGCTGGTCCCCATGTTCCGTATGCCTTGAACGTAACTTTCGGTTTCCATGAATTCCTGGAGAGACCTATATCTCTGGGTGAGAAATTCAAGTACAAAAGGTACGATAGATGCAGACGCTTATTACAGTGCAGTGGGACTTTCCCGAGTACAGTAGGAGGCCTCAGGTCGCGGACTTCGGAGTTTTGCTTGCTGATAGACCCAAAAGAGAACCTGCAGGGTGCTCACTTACTAGTCAACAACCAGAGTCACGTTTGCGTATGCCAGCTTCGGTGGGAAAGCACTATGCTGAACACCACCAGTGTGTCCATCCGCTTGCATCCTATACCCATTGGTACAGAAAATTCAAACAACAAAGACAAGGAAGACTCCTGGCTTTATTTACTGGACCCCCTGGTGGATATTCCTGGGTATGTAGACACTAATCATACTTGCAGACATAGACCATGGGTTAAGTACGAAGTTGTTGGTGACAGTACGAGTATGAACCTTGACATTAAGTGCTTTCAATCCCCAATCGAGTGCTAAACAACGTTGCACGGGTAGGTTGTGTTTCACCCTTTCTCCTGTACAATTTCTTTCTGAATAACTTCCTTAGTTCTCCTTGCCCACATATTAAGTGGAGTAGAAAATACTTCAATGGAAGCATCCGAACCATGTGCAGGAGGAATTTTTATCGACGTCTTTCTGCCTAGCACATTTTAGGTTCACTATGACAAGAACAAACGTGTATTGTTAACAGATATGCGAGAACATATTGGATAGGATACTGAGAGCCTTCATACAACGGACTACTTAATCAAGACATATTAGAAATTAAACCTAGCATCTTTGATTTGTCAACTACCTGCATGAGAAACTTTCGCCTCTACAGTATTTTCAGTCTGGAATTTGTTGGTGAGTGCTGAGTTGATTAAAACTTTCATATTAGAACATGGTAACATCGGAAAGAAGAGAGTGGAGTCTGCATACCTTTTACTCGTGAACTACTATAACTACTTTATCTGGTCTGCTGAAGGTTTGCGTCGTGGATCCCATTCTTTGTTATTTTACCTAGCTCTTAAGGTCAGAAAAGACAAACGCTCAATCTACAGTTGAAAAAAAGCTGTTATGTTTTGATGTCTGCGAGGAAAAGGAGATATTGATTATCTTTCCTGATAGTTATCTCAAACTGTAGATTTCCTGAATTCCCCTTTGTGTCACGTGCTAGTGCTGAAGAAGGCAAAAAGTACTCTCCAAACAGTTGTGATGGAGAGGTATGGAATACCTCTCGAAAACCAGAGAGCTTTTCGTGTCACTCAAACAACTGTACATGGTCGCAACAGACCGTCCCCCAAGCCCATGGTTGGAAACTTGCAGCAGTGGGTTCTGGATGATTACCATCCAGGTACTAATCTCTTCTGGGGCGAAGATCTCCATAGTTTTCGTTTGATCAATGAATGTTCCAATTGTTCCCATTTAACCCAGGGTCAGAAGTTTAGTCCAAGTAGAGGATGTATCGAAGTTTTCTTGCCTAATGTTCAATAAAGAAAAATTCCACGATTAAGCTGTACCTGATCTATAGACGTAAATTTATACGGAATGAATTAGACATTGCCATCAACAAGTCATAGTTTACTGCTCTAAAGTGTAGCGTTGAACCAGTGTTATCTGCAATTCTGTTGCTCATGGTACAAAAAGTTGAGGCATTGTAAAACTTCATTACTTGCATTTGATATGTACCATCCGTCAAGATCCTTCTGGACTTCTCTGTTTTAAAGTTTTAGTGGGTAGATGGGTTACTGATGCAAGAGGTTTTATAGGTCAGCGGAAGTTGAGCAAACTGACAAAGATCCTTGTGTTCTTTCTAGTAAAGAAGCTTGAATATAACTGAAATGATAAGCCAACATGACAAGAGTATGAACCCGAAGACTTGTGGATGTCTTTCAACTACTGAGTCTATTTCAATGGGCACTGTGTGTCACAATTTCCCTTCTAAACCAAGAAGAAGCACAAAATGTAAATGGGAACTTGAGCTGCAAAAGGGAGATAATGGCGCTGCCTGCTCAAGGCGAGAAAAGGTATGCACGTTTCAACGGCGGAGGGTCATGTTCATGAAGTAAATACCTATGCTATGGAACACCTCTGGTGACTTACTGCACCTACTAACGGCGTAAGCTGGTATCCAAATTGGCTTCATGCTTTTTAATAACCTGGGAGATTGAGCGTCAGACACTACTGGAGATTTAAGGTTTTCGTTACTAAATTGTGAATTCGCACTTTGTCTACAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGATTATCTGCAGGTAAGCACTGTAGCCAACATTTACTCGTTTTACTTGAGTTCCTGTTATAAAACCATCCGAGTTTCATTTCTTCCATTTCTAGCACAATCTTGTTACATCACACCACGAAAGATGTGGTCTAAATTCTACCAGTCTTGTTTAAGTTTATCACATATAAGCCCATAAGCCTTTGCATATGTGTATGACGAGATCTCTTTGATACATAGGCATCAACCTTGATACGATCATTACCTGTGGTTTGACCTCTCTCGTCGGACTACAAGAAGACTTTCTTAGTGGATGATGTGGCAGTGCACGCAGGTTCGCGAAATCGGGACGTAGAGGAACACTTTTCTTGTCTGCGTCTAGAGACGGCTCAAACTATGGGAAGAGGTAGAAGGGAACACCATCAGGGATACTGAGCCCTGATAAGGAGCGAATCTGAGCTGAGGTTTGAAATGTCGGCTGGCTTGGAGGTGATGGGTTTAGATACTTAGGTCCAAAGTTTCACATTATTTGCCAATTAGACCGTTCCTATCCTACCGTTCATTCGTCCAGGAGGAACTTTCTGAGAAATTACCCTTTGTGGGGTTTGTAAATTATCACACTTGTATATATATTTATTTAAGTCTAAAATTATTTATTCAATCTTGATTCCGATTTGAGGTCTTAGTGTGAATTGTTGTGTTTCTGATTTTTCGAAGTCAACTTGCTGGTGAAGGACCCCTTTGGCCGAGAGGTAGAGAAGTTTTTAATGCTTTTTGGTTGTTCCACGCATCAGACAATGCTTGAATACTAAGCAATTCTCTTCTATGTTGCGGAAATGTATCCCACTACAGGAGAGATACTCTTCACTGAGTCTTGTCTATCCTTCTTACCCAGCAGGCCCTCATTTTCTTGTC

mRNA

>Mapoly0130s0030.3
GAGCGGAGCCAGACGAGCCCCTTGCAGACGGGCGCGACGTTTGAGGGAGGCAATTGCGCTGGCCATCGAGAAACTCAGAGGAATCGGGGATGCATAATTGCTGGAGTGTGAATCGATCGAGAGCTTCGTGGAGTGTTGAAGTATCAACCCTCGGTGTGATTGTAGCGTGAAAGCTCAGATCGGACGGGAAGATTAAGAAGCGGACGAATCGTGTCGAGCCGGCACCCCTATGCTGATCTCGTGGTCGTGATCGTTAAGAATTTCTCCATGGCTCGGGACAATTGGCGAGATTTTCTAATCTACCTCGTGAAGTAGTCGTCGGAGGCGCGTTTCTCGGTTTCTCGTCTGGGTTTTGTGAGTGCAAGAGCGGGGAGACGGTATGAGCAGAGACTGATTTTTTCGCGGGTGCTTTTCGGTCCAGAGGTGATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGTGCTGAAGAAGGCAAAAAGTACTCTCCAAACAGTTGTGATGGAGAGGTATGGAATACCTCTCGAAAACCAGAGAGCTTTTCGTGTCACTCAAACAACTGTACATGGTCGCAACAGACCGTCCCCCAAGCCCATGGTTGGAAACTTGCAGCAGTGGGTTCTGGATGATTACCATCCAGTAAAGAAGCTTGAATATAACTGAAATGATAAGCCAACATGACAAGAGTATGAACCCGAAGACTTGTGGATGTCTTTCAACTACTGAGTCTATTTCAATGGGCACTGTGTGTCACAATTTCCCTTCTAAACCAAGAAGAAGCACAAAATGTAAATGGGAACTTGAGCTGCAAAAGGGAGATAATGGCGCTGCCTGCTCAAGGCGAGAAAAGGGCCTGTTCTGAGCACAGGGATGTGCACAGAAGTTTTCCGCTTTGATACTTCACCAACAAGGACTGCACCAAATACAGAGACCTCTAGAGGTTCAAGCTCTGTAGCAGAAGATCAAGTCAGCGGTGTTCGTGAAGAAAAGACTTCTGCAAAGACTACTGAGGAGCCTTCTACCCGTAAGAAGAGAGATCCTTATGCTGTCCCTCTACCTCCTATTCGGAGACAAGACGGGAATGGAACAGAGCCAGTCGTGGACAAAGTTTTCAAAGGACAACAGTCTGACACGGAAGGTCATGATGCCTCAACGATGGTAGTGTCCGTCTTCACGGGACCTCAAGATGTTTCTGCAGAAGACAGCAGGACTGGGGGAGGGCCAGCAAAAGGCTTGTCTCAAATCTTTGTGGTTGTTCTGGTGGATAGTGTGAAGTATATAACGTACTCGTGTATGCTTCCTCCAACGGGCTCTCAGGTTCATGTGGTGGCGAGCTGATTATCTGCAGGTTCGCGAAATCGGGACGTAGAGGAACACTTTTCTTGTCTGCGTCTAGAGACGGCTCAAACTATGGGAAGAGGTAGAAGGGAACACCATCAGGGATACTGAGCCCTGATAAGGAGCGAATCTGAGCTGAGGTTTGAAATGTCGGCTGGCTTGGAGGTGATGGGTTTAGATACTTAGGTCCAAAGTTTCACATTATTTGCCAATTAGACCGTTCCTATCCTACCGTTCATTCGTCCAGGAGGAACTTTCTGAGAAATTACCCTTTGTGGGGTTTGTAAATTATCACACTTGTATATATATTTATTTAAGTCTAAAATTATTTATTCAATCTTGATTCCGATTTGAGGTCTTAGTGTGAATTGTTGTGTTTCTGATTTTTCGAAGTCAACTTGCTGGTGAAGGACCCCTTTGGCCGAGAGGTAGAGAAGTTTTTAATGCTTTTTGGTTGTTCCACGCATCAGACAATGCTTGAATACTAAGCAATTCTCTTCTATGTTGCGGAAATGTATCCCACTACAGGAGAGATACTCTTCACTGAGTCTTGTCTATCCTTCTTACCCAGCAGGCCCTCATTTTCTTGTC

CDS

>Mapoly0130s0030.3
ATGGAGGTCGAGGTGGTGGAAGCTGACAATGGGGTCAATCCGAACAATGACAGTTCGATGGCCATAGACATGGCGATTCCGGGAGGATTTGAGGACGAGAACGCGCTGATGATGGACAGCAGCGTGGAAACTGCCGATCTTGGAGAGGATTGGGTGTCCCTTTTCTTCGATGAGAGTTATCTGAACGCCATGACGACGAGCGGGGAGGTTGAGCAGCAGTTTCTTCCAGGTAGTGACGCGCCGGCGGCCGCTCCCGGTTCGATTGGGAATGGGATCCAAATCTCCAATCGAGCGGTATCTCCTTCCACGATGATCCTCTCGAGCTCCCCGGCCAGTGCCAGTTCAGGGTGCCCCTTCTCTGCCAACGTCGACATTTACCCTGAAAACCATAACGCCACTGACAAAACTCCTCTGCCTACGGCTGCCGCAATTTCTCCACCCCCGCATCCCGCAGGGTCCCCGGAGAGCACTCTTTCGCAGGCCAGCGGCGCTTCCAGCTGTGCCGTGCAGCCTTGCTGGTGGGGGAACGAAGATCTGGAGGAGGATGGGGTTCATGGCTCGGAGGAGGAGAGTTCGACGTCCAATTACGGTGCGACCGACCCTTCAGCAGTTGCGCCGGACGCGTCTAAAGCTCCGATCCAAGCTCAGGAGGTGAAGGGTGGGGCAGAACCGGCATCCAGTGTGGGGAAGATTGCCACCGGTGCGAGAGGCAGCGTAGAAAGAAGCGATCGTAAGCGGAGATCGTGGGAGAGGGAGGAGGCAGAGAATGGGCAGCAGCAGTCGCAATGTGCGCAGAGTGAAATTGACAGGAAAGGGAGTGAGTCTGGGGATGGGTTGGGGGGAGAGGAGGATGACGAGAAACGGCAAGCCCGGCTGATGAGGAACCGGGAGAGTGCCCAACTTTCTCGACAGAGGAAGAAGGTGTATGTCGACGAGCTGGAGGGGAGATTGAGAACCATGGCTGCCACTATTGCGGAGCTGACTGCCACCATCACTCACTTGACGGCCGAGAACGTCAATTTGCGGAGGCAATTAGGTTTTTTCTATCAGCCTGCGAGACCCGCAGGTGGCATGCCGATCATGCAATATCCAGGACTTGTTAGGCCTGTTTATCCCGGCGCTCCTATGCCTCCTGTCCCGATTCCGAGGTTGAAGCCTCAACAGTCTTTGACAAAAACTCCGAAACGAGCCAAAAGTACGAGGGAGCCTGGTGAGAAGAAGAAGGTTAAGAAAGTGGCCAGTCTTGCAACCGCTGGAGTCATGGGACTGCTCTGCATTACCATGCTGTTAGGACCCTTCGACTGGGGATCCAGTACTGTAAGTTCAGGCACTACTCACATCCACGTTGGTAATGCTCAGATTAGGGTAGGAGGTAGAGTGCTCACAAGCTGGAACGAGGAGGGTGTAGAAGACTTGAGGAACATGACCCCCAGGGAACCCTGGGCCGACGGTGGGGGAGGGAACATAGGGCATGTGAACTCTGCGGGTGCTGGTGGTAGGAATGGCGTGGGTGGTAGAGCGAGGAGTAGGATTGATAGGCGGAATGGGAACATTTTGAGGAGGAATTTCTCGGCCGGCACAGAAAGGGTTTGGCAATCCTGCTCAGAGTGCTACAGTCGTCGTGATGAGCCACGAACTGCTCCAAATCTCGTAGAGAAACTTGTGGCTACGAATGTGAGCGAGCAAGTCTCCTTGATTGTTCCGAGGAATAACAGGCTTATCAAGGTCGATGGTAATCTTATTATCAGAGCTGTGATGGCTGGGGACAAGGCCGCAGAGGACTCTGGAAAGGAGGAACATTCAAGTCAGGAGGGAGAGAATGGGAGAGGTCAGGTCAAACAAGATCTGTCCAGGAGTAGCCGTTCACCTCCTACACCTGCTGATCACAGGCTCATCAAAGCCATATCGACTCAAGCTCAGGAAGGAGGAGGAATCGTTGTCGGGGAAAGACAGAGCAGAAACGTTGGTGCTATTCGCGAGGACAAAAATGTTCAGAAACCTGCGTACAAGAGCGATGCCTTGGCCTCTGTTTCTGCAACTCCGACTTTTTCTCAGCTTGTGTTGGGAAGCCTTGCAGTGCTGAAGAAGGCAAAAAGTACTCTCCAAACAGTTGTGATGGAGAGGTATGGAATACCTCTCGAAAACCAGAGAGCTTTTCGTGTCACTCAAACAACTGTACATGGTCGCAACAGACCGTCCCCCAAGCCCATGGTTGGAAACTTGCAGCAGTGGGTTCTGGATGATTACCATCCAGTAAAGAAGCTTGAATATAACTGA

Protein

>Mapoly0130s0030.3
MEVEVVEADNGVNPNNDSSMAIDMAIPGGFEDENALMMDSSVETADLGEDWVSLFFDESYLNAMTTSGEVEQQFLPGSDAPAAAPGSIGNGIQISNRAVSPSTMILSSSPASASSGCPFSANVDIYPENHNATDKTPLPTAAAISPPPHPAGSPESTLSQASGASSCAVQPCWWGNEDLEEDGVHGSEEESSTSNYGATDPSAVAPDASKAPIQAQEVKGGAEPASSVGKIATGARGSVERSDRKRRSWEREEAENGQQQSQCAQSEIDRKGSESGDGLGGEEDDEKRQARLMRNRESAQLSRQRKKVYVDELEGRLRTMAATIAELTATITHLTAENVNLRRQLGFFYQPARPAGGMPIMQYPGLVRPVYPGAPMPPVPIPRLKPQQSLTKTPKRAKSTREPGEKKKVKKVASLATAGVMGLLCITMLLGPFDWGSSTVSSGTTHIHVGNAQIRVGGRVLTSWNEEGVEDLRNMTPREPWADGGGGNIGHVNSAGAGGRNGVGGRARSRIDRRNGNILRRNFSAGTERVWQSCSECYSRRDEPRTAPNLVEKLVATNVSEQVSLIVPRNNRLIKVDGNLIIRAVMAGDKAAEDSGKEEHSSQEGENGRGQVKQDLSRSSRSPPTPADHRLIKAISTQAQEGGGIVVGERQSRNVGAIREDKNVQKPAYKSDALASVSATPTFSQLVLGSLAVLKKAKSTLQTVVMERYGIPLENQRAFRVTQTTVHGRNRPSPKPMVGNLQQWVLDDYHPVKKLEYN

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>