Mapoly0132s0008



Description

HOMEOBOX PROTEIN TRANSCRIPTION FACTORS

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0006355 Regulation of transcription, DNA-dependent
OrthoMCL OG5_188795
PFAM PF05920 Homeobox KN domain
PANTHER PTHR11850 HOMEOBOX PROTEIN TRANSCRIPTION FACTORS
PANTHER PTHR11850:SF76

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBELL2 Homeodomain protein Public
MpHD17 transcription factor, HD Mapoly0132s0008.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0132s0008.1 scaffold_132:52601..54394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0132s0008.1  

Gene structure:

mRNA scaffold_132:52601..54394  ( - strand )
three_prime_UTR scaffold_132:52601..52602  ( - strand )
CDS scaffold_132:52603..52680  ( - strand )
CDS scaffold_132:53014..53104  ( - strand )
CDS scaffold_132:53323..53423  ( - strand )
CDS scaffold_132:53552..53642  ( - strand )
CDS scaffold_132:53796..54154  ( - strand )
five_prime_UTR scaffold_132:54155..54394  ( - strand )

Sequences:

Gene

>Mapoly0132s0008.1
GATTATGAAGCTCGTCACTCACAAGAGGTGCTTTCGCCTGTTCCATATCCTCAAACATACGTGGAAGAGGTGTTGGCCACCCTTGCGTGCTGCTCTCAACGACCAGAATTGCCTCTCGTCCCATCAGGAGATAATGACAATCTTAATGCAGTCAGGGGCTGTGAAGCTGAAGACCCACAAGAAGTCTGTGTTAGTGCTTCTTCTCCTCCAGGATGTGTGGAGGAGGTGCTGGACAAGGACATGGACATGGATAGCTCCTCCGACCAATTGGCATGGGCTCCTGTACCATCACCAGATGATGAAATCGTTACTGAAATGAGGGCTTGTGAGCCTTGTAACAGAGGAGAGGAATTTGCAAGTGCTCCTATTTCTCAGGGCAGTATGCGAGAGGTGCTGGAATCTAACCACCCCACTTGCTCTCAACAATTGGAGTTTACTCCCAGGCCAGCACCAGTTGATGACCATGTTAAAGCAACCAACAGCATTCTCGATACAAATGATGACTCTTCCACTGGATCTTTAACTTCATCGAGACGTAAAGAGCTGGAAGGCACCGGATCCAGGTCGGTCCACACACCGGAATCGCTCCAAATCTTGAGGTCAGTACATTTCGAAACGTTTGCTTCCCTCCTTGCTTGAATTTAGATGACCAGGGCACGCCTAAGCTATTAATCAAGTACATTGCTCAAAAGACAAGGCCGAAGTACCGAATTTTTATTCATTTAACCACCACTCTCTCCCCTTTGCCACAGAACCTGGTGGGAGAAGAATGAGCTCATTCCATATCCGAGTCAACGAGAAGTCTATGAAATGTCACGGAGGACCAACCTTACATTGCAACAGGTTACTGCCAGCATCCTCACATCTATTACAGTGGAATAGCTGCCATCTATAGAGAAAGGTTGCATGTTTCCTCCATCGCGAAAGCGGAAGGATTGTTTAAATGAGCATCACTTGAAATTGTGCTCTAGATCTCGGACTGGTTCAAGAACGAAAGGAGCAGAAAATGGAGAGACGATCCTCGAAAGAAGAAGGCGAATAGACTGCCACCACGGGCAACACGACTCTTGAGGTGACATAACTCTTTGCTTCGCCTTTTTCCATGAATATCTCATTTCTCGGCGTTATCCAAACAATATGATATCCTCTTCATATTTGACCTCTGTTTCTTGAAGCCATTTGTGCCTGGACTATTGTGGGAAATTTGATTTGTACTTACATGTACTTTGCTGTAAATCTTTCCATGAAGTTCTCATTCTTACTTTTCAACTTGCATTCTGAAACTCGTAGTACATGGGCATCCGAACATCTGAGTCATCCAAACCCCTCTCGGGAGCAAAGGGAAGATTTAGCAAAGGAATCTGGAGTTACCTATGTGCAGGTAAGTGCATTTTGCTATAGATATTCTAGGGTGACACTACCTTGCTTATAGCAACACATAACGCTTCACTCTTCAAAAGGTTCCAAATGCATAGTATGCAACATCCGAAAAGTAATCAGTTGATGGAATAAGAGCTTACAAGTGACATTCTAACGCTGCATTTAGTTTGAAGATCCGAGAAAAAGACGGACTTGTATCAGTGAAAAGATAAAGATGAAGCATTGCAAATTTACTAATTTTATACTTGTGACTGTAACTTGCCCCTCTATTATCACTTTCTTATCACTATTAATGGATGAAAGATAAGAGAACTATTTTCTCAATTTTTTGCAGGTTTCGAATTGGTTCATGAACTTCCGAAAGAGGAGCAAGGCTCGAATAAGGAAAGCTAAAGCCTCGAATATTCCATGAAC

mRNA

>Mapoly0132s0008.1
GATTATGAAGCTCGTCACTCACAAGAGGTGCTTTCGCCTGTTCCATATCCTCAAACATACGTGGAAGAGGTGTTGGCCACCCTTGCGTGCTGCTCTCAACGACCAGAATTGCCTCTCGTCCCATCAGGAGATAATGACAATCTTAATGCAGTCAGGGGCTGTGAAGCTGAAGACCCACAAGAAGTCTGTGTTAGTGCTTCTTCTCCTCCAGGATGTGTGGAGGAGGTGCTGGACAAGGACATGGACATGGATAGCTCCTCCGACCAATTGGCATGGGCTCCTGTACCATCACCAGATGATGAAATCGTTACTGAAATGAGGGCTTGTGAGCCTTGTAACAGAGGAGAGGAATTTGCAAGTGCTCCTATTTCTCAGGGCAGTATGCGAGAGGTGCTGGAATCTAACCACCCCACTTGCTCTCAACAATTGGAGTTTACTCCCAGGCCAGCACCAGTTGATGACCATGTTAAAGCAACCAACAGCATTCTCGATACAAATGATGACTCTTCCACTGGATCTTTAACTTCATCGAGACGTAAAGAGCTGGAAGGCACCGGATCCAGGTCGGTCCACACACCGGAATCGCTCCAAATCTTGAGAACCTGGTGGGAGAAGAATGAGCTCATTCCATATCCGAGTCAACGAGAAGTCTATGAAATGTCACGGAGGACCAACCTTACATTGCAACAGATCTCGGACTGGTTCAAGAACGAAAGGAGCAGAAAATGGAGAGACGATCCTCGAAAGAAGAAGGCGAATAGACTGCCACCACGGGCAACACGACTCTTGAGTACATGGGCATCCGAACATCTGAGTCATCCAAACCCCTCTCGGGAGCAAAGGGAAGATTTAGCAAAGGAATCTGGAGTTACCTATGTGCAGGTTTCGAATTGGTTCATGAACTTCCGAAAGAGGAGCAAGGCTCGAATAAGGAAAGCTAAAGCCTCGAATATTCCATGAAC

CDS

>Mapoly0132s0008.1
ATGGACATGGATAGCTCCTCCGACCAATTGGCATGGGCTCCTGTACCATCACCAGATGATGAAATCGTTACTGAAATGAGGGCTTGTGAGCCTTGTAACAGAGGAGAGGAATTTGCAAGTGCTCCTATTTCTCAGGGCAGTATGCGAGAGGTGCTGGAATCTAACCACCCCACTTGCTCTCAACAATTGGAGTTTACTCCCAGGCCAGCACCAGTTGATGACCATGTTAAAGCAACCAACAGCATTCTCGATACAAATGATGACTCTTCCACTGGATCTTTAACTTCATCGAGACGTAAAGAGCTGGAAGGCACCGGATCCAGGTCGGTCCACACACCGGAATCGCTCCAAATCTTGAGAACCTGGTGGGAGAAGAATGAGCTCATTCCATATCCGAGTCAACGAGAAGTCTATGAAATGTCACGGAGGACCAACCTTACATTGCAACAGATCTCGGACTGGTTCAAGAACGAAAGGAGCAGAAAATGGAGAGACGATCCTCGAAAGAAGAAGGCGAATAGACTGCCACCACGGGCAACACGACTCTTGAGTACATGGGCATCCGAACATCTGAGTCATCCAAACCCCTCTCGGGAGCAAAGGGAAGATTTAGCAAAGGAATCTGGAGTTACCTATGTGCAGGTTTCGAATTGGTTCATGAACTTCCGAAAGAGGAGCAAGGCTCGAATAAGGAAAGCTAAAGCCTCGAATATTCCATGA

Protein

>Mapoly0132s0008.1
MDMDSSSDQLAWAPVPSPDDEIVTEMRACEPCNRGEEFASAPISQGSMREVLESNHPTCSQQLEFTPRPAPVDDHVKATNSILDTNDDSSTGSLTSSRRKELEGTGSRSVHTPESLQILRTWWEKNELIPYPSQREVYEMSRRTNLTLQQISDWFKNERSRKWRDDPRKKKANRLPPRATRLLSTWASEHLSHPNPSREQREDLAKESGVTYVQVSNWFMNFRKRSKARIRKAKASNIP

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>