Mapoly0132s0029



Description

MYB-LIKE DNA-BINDING PROTEIN MYB

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
OrthoMCL OG5_127030
PFAM PF00249 Myb-like DNA-binding domain
PANTHER PTHR10641 MYB-LIKE DNA-BINDING PROTEIN MYB

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp3R-MYB3 transcription factor, MYB Mapoly0132s0029.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0132s0029.1 scaffold_132:234705..239097  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0132s0029.1  

Gene structure:

mRNA scaffold_132:234705..239097  ( + strand )
CDS scaffold_132:234705..234733  ( + strand )
CDS scaffold_132:237232..237301  ( + strand )
CDS scaffold_132:237765..237818  ( + strand )
CDS scaffold_132:237998..238051  ( + strand )
CDS scaffold_132:238170..238273  ( + strand )
CDS scaffold_132:238676..238804  ( + strand )
CDS scaffold_132:238932..239097  ( + strand )

Sequences:

Gene

>Mapoly0132s0029.1
ATGGAAGTGGAGGTTTCTCATCTTGAGAGGTTTGTTGACTTCCGAACCACCGATCATGATAGGAGTATGAAGAAAGTAGAACTACGATTATCCACAAACTCACGTTGGCATTTCATCGTTGAGAGCTCTCAACGATGAAAACTTTACACTGAATAGCTGTACAAGGCAATTTGGATGTGTTGTACAACAGTTATTTTGATGTGGACGGCTGTAACGATGTAGTGTGAATCGATTCTGATTTACACTACATCGTTACTTAAAATAGGGATATGAGAGACACCACGGCTTGGTTTAAAGTTTTCACCATCGGCTTTCTTCCATGGTTCAAATAGGTGTAGTTTGTACCTTGACGTTTGTACATAGGGGATATGATTGTAAGAGATTCCAAGCAATCTCCATCACCTTGTAGTAATTTGTTGAATTGATGCTTTTTATTAAACAGCTATGTCTAACATGTAAGAACTAGGCTCTGCTCCAAATTTTGAGAATTCTCCTTTGACTTCTTCTTCATGCTTTTACTTCTCTCTTTCATTCAATCCTTGTATTTCTGTTTACAAATATACTCTATATACAATGTCAATTAACAGTTAAAATCACAATATAAGTATTTTTGAAGAAAGAATGTAAATATTCTTGCTTTGAATATATATGCATTGATTTGATTTTTACTTGATAAAAGAAAAATACAAGGTTAAAATGAAAGACAAACAAGGAAAAACATAAAGATAGCTTTTGAAAGAGAATTCTTGAACTTTGTAGATTCGGTCCTTAAACTATCGTATATGTATTATAAATTAATTTACGGAGATATTGTCCGTTATCGTTAAGGTACTACTAACGACAAAGAGATAAAGTAAGCTAGTGTAATAAAGTTTTTATGATATTGCCAGTGTTGTTAGATACGTAAGCATTCTACGTTTGCTAGAGAGATGAACTACAATAGACTAGATAATAGTCACTGGCAAAGCCTTTTGTAGTAACGCATTAATTAATCATCACAAGTGCTAAGTCTTGTGATGGACTCTTTGATAAGTTATCAAAGTCTGGTTTGATAACTTTGAGATACAGTTGTGAAGAAGATTCTTACAAGCATGAACTACTATTGATTTTAGACAAAATTTGATGTCCGTGTCATTGATTTCGTCAATTTGTCATAACGTCAATCATTTAGGTAATTAGTAAATTCCTGAGGAGTAGAAAGATCTCAAGTACTTGAAAGAATATGTAGAAAACTTTAAGATTTTTACAAGAAGCCACCATTTGCTCTAGTTAGATGAAACATATGTGTGTGAGGAGATATTCTACGGTTATACAAAACTTTGCTGAAATGCAAAGGTTTGAACAATATTGTAATCTAGCAAATATGTTCAAGGTTTATTCATTTGAATCAACTAGGTAGTAAAATATATTTTTTTTAATCAGATTTCAATTCATCAGTTGAAAAGTTAAATTAGATTTTATTCTATTTTTACAATTCTCATTTCTTTAGAAAAAATTACCATGTTAAAGTTTTGCAATTGCAACGAACATTTTAGGCGCCCATTATGAAGTTGTTTGAGGTTCTAGAATACAATCCCTTTTGTACTTACAAGGAGTTTTACCCTCTTTGGTATTGAATGCTGTAAGATCCTTCCTCTTGTATTTTCTGCAATATAATATTTCATCTACGATAATATATGCTTGAGTTGAGATCTAAGAAGAATCAAATGCAGTATTAAAGAATGAGTTGATACTAACATCTAACATTTTTCAATACCAAAGAGTGTAAAACTTCTTATAAGTACAAAAGAGATTGTACTCTAGAATCTCAAACAACTCCATAACGGGGTCTAAGGAGTTTTTTCAATTGCAAAACTTTAATATGGTAATTAAGAAAAAAAAGTGCAAATTGTAAAAATATAATGAAATCTAGTTCACCTTTGCAACAGATAAATGAAAACCTGATAAGAAAAAAAATTTAGTTAATGGGGATTGCTTCCCTTTGATTTGTTGTTTTAAAAGCTAGTTCCTCTTGCATAGCAAATACCTTCATAAAGTACCACGGGAATAGGCGGTTATCAATGATAAGTATCTTGGTGGTGCCCTATAAGAATTGCACTTGTCCATTGTTGGCATTGTTTTGTTAAGGAAAATTTGAAAGACGACTTTCTAAGCCACAGGTCTCTTTCACAGATGGACGCTGATGAGAATACCCTGCTATCTTTTATTTTATGTTAGACCATATTCACCTGGATTCATAATGATCTTAATTCTGTCATCTACAAAATCCTATCGAGTTCAACTTCTGTATGCAGTATTAAGATGAAATTTGGATTTTTTAAGATTTTATTGATATCGTATAATACTTTTGCCTAAACTTTAAAATGAGATGCTCCAGCGAACAACGGGAGGTAGGCAGTCTGCTTTGATCGAGATTGTTAAATTGTTTAGGCTTGTAATTGAATACATCCAAGTCAAGCACAAGGGTTGTTCTTTCAAAGCTAAGGTAATCTGAAGTCTGACATTTCTGTCATTGCAATTCGTGCAGCAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAATCGTGTAGAAAGATGGACTCCTGAAGAGGTGACTATGTTACTGATCAATTTATTGTCTCGATTTGTAAATATATAATCTGAAATTTAGCTTTGGAATGCGGCGTTCTTCACTTCAAGTAAATATTGGAACGTAGCTCAGCTGGATACAAGGTTTAAGCGAACAACCCTTTATGATTGAGGCTTGTGAAATCCTCATTATTTTTAAGTACGGGAGAGAATTGTTTGCTCATGCGTCAATTAATGTATTATAATTCAAAAGTCTCATGAACTAGGCTAAGTTGTGGGCCATCTCGCTCTGCTATAGTAATTATTACATAGTACTCTGGCTGCGATGCAGTCTAGCTTGTATCTCTGGAGCTTGTATTTGGATTTACTAGATAAATCTTGTCATTATCCATTCATTCTATCGGTTTCGAGCTGAATGTCAAATGGTTTGGCTATTACTAAGTCAAAGCTTTGAACTAAGTTGACTAGATTTCTTATTCTTGCAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAATACAAGGCAAAAAACTGGCGACTGGTCGGTGAGTATGAATCTTATTCTGAGAAGTCTTTGAATTTATTTGTTCTCCTGTAACATCTCGACAGTTGTGACAATCACTTGTATGTGGAGAATGTATCGGATATCTACTTTTAATAACGGCATGTGTCTGTCCAGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTATAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGTGAGTAATCCTGACCAATGTGATGATTATCTCTACCTTATACGCAGTTTCAAACTCTTACATGTGAATTCCACATTTGCAATTCTGGATATTGATTGTCAGTTTTATATTTTGACAGGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTGTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGGTGTGTATATGTTAGACGCCTAGTCTCCTCCAAGCTGTTTGAGATGACAATTCACTAAAGTTTTAAACGGCAGTTTGCATTGGTAGATTTATGTCCTTAATTTCTGCAAAGCATTCCATTTTCATCCTATAAAAAGAGCTTGTTACCCTCAGTTCTTAACAGTACCTTCATAAACAGCTCTTAGCTGACAGCGGTAAAAAATATAGCATTCATGAAACTTCAAATCCTCATTCATTGACCTCGGATTTCATATACATAATACCTCGGAAATTGATCTATGCGTCGTATGGAAATTAGAATAGAAGAGCTCATTTGTTATACTATCCATGAGTTTATGCTTCAGTTTTCTGCTTCAGTTTGTGTTGTTTTAAAAAATAATTTCTGAGCTGCTTTGTTTTACAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGGTATGCTAATTTTATGTATACTGACTACCGGAAGTCACCTGAATTTTTCTGAGGTTAGATGCATGATAGTAGGATGGTAAGATCCATATTTCCTTATTTTCTTGTCTGCCATTTAAACGATCTCCAGATCAGAGAACGGGGTGAAGAACCGGTGGAATACTCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTGGAATAATCAACAAAACTCGTCTCAGAACGAGGAGCTTCTGGGCAACGAGGCGGCCATAAAAGATTTGCTGTCAATTTCAGAGTGA

mRNA

>Mapoly0132s0029.1
ATGGAAGTGGAGGTTTCTCATCTTGAGAGCAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAATCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAATACAAGGCAAAAAACTGGCGACTGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTGTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGGGTGAAGAACCGGTGGAATACTCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTGGAATAATCAACAAAACTCGTCTCAGAACGAGGAGCTTCTGGGCAACGAGGCGGCCATAAAAGATTTGCTGTCAATTTCAGAGTGA

CDS

>Mapoly0132s0029.1
ATGGAAGTGGAGGTTTCTCATCTTGAGAGCAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAATCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAATACAAGGCAAAAAACTGGCGACTGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTGTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGGGTGAAGAACCGGTGGAATACTCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTGGAATAATCAACAAAACTCGTCTCAGAACGAGGAGCTTCTGGGCAACGAGGCGGCCATAAAAGATTTGCTGTCAATTTCAGAGTGA

Protein

>Mapoly0132s0029.1
MEVEVSHLESSKKQHVTGASSMRNRVERWTPEEDELLQEAVVQYKAKNWRLRWQKVLNPAIVKGYWTKEEDQKMLELVGMLGTKRWAAVARCLPGRIGKQCRERWYNQLDPSIKRDPWTEVEDMRLFLAHKRFGSKWSQICSILPGRSENGVKNRWNTHIKKKAFILEEYCRMWNNQQNSSQNEELLGNEAAIKDLLSISE

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>