Mapoly0132s0031



Description

Myb-like DNA-binding domain // Myb-like DNA-binding domain

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
OrthoMCL OG5_127030
PFAM PF00249 Myb-like DNA-binding domain
PFAM PF13921 Myb-like DNA-binding domain
PANTHER PTHR10641 MYB-LIKE DNA-BINDING PROTEIN MYB

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp3R-MYB4 transcription factor, MYB Mapoly0132s0031.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0132s0031.1 scaffold_132:250708..255468  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0132s0031.2 scaffold_132:249915..255468  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0132s0031.3 scaffold_132:250545..255468  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0132s0031.1  

Gene structure:

mRNA scaffold_132:250708..255468  ( + strand )
five_prime_UTR scaffold_132:250708..250818  ( + strand )
CDS scaffold_132:250819..250862  ( + strand )
CDS scaffold_132:252984..253050  ( + strand )
CDS scaffold_132:253515..253572  ( + strand )
CDS scaffold_132:253707..253801  ( + strand )
CDS scaffold_132:253920..254023  ( + strand )
CDS scaffold_132:254425..254553  ( + strand )
CDS scaffold_132:254681..254846  ( + strand )
three_prime_UTR scaffold_132:254847..255468  ( + strand )

Sequences:

Gene

>Mapoly0132s0031.1
TGCTGTGAATAAATTGTTCATTGGTTGAGCTCTGTTGTGATTAAGTTGTCGTCGAGAGTAGTCTTCGTTTAGTCTGCGCGAGGAATTGCTCTTTGACTGCTTGCCTGTAAAATGGAAGAGTGTAACATGGAAGTGGAGGTTTCTCATCTTGAGAGGTTTGTTGACTTCCGAACCACCGATCATGATAGGAGTATGAAGAAAGTAGAACTACGATTATCCACAAACTCACGTTGGCATTTCATCGTTGAGAGCTCTCAACTATGAAAACTTTACACTGAATAGCTGTACAAGGCAATTTGGATGTGTTGTACAACAGTTATTTTGATGTGGACGGCTGTAACGATGTAGTGTGAATCGATTCTGATTTACACTACATCGTTACTTAAAATAGGGATATGAGAGATACCACGGCTTGGTTTAAAGTTTTCACCATCGGCTTTCTTCCATGGTCCAAATAGGTGTAGTTTGTACCTTGACGTTTGTACATAGGGGATATGATTGTAAGAGATTCCAAGCAATCTCCATCACCTTGTGGTAATTTGTTGAATTGATGCTTTTTATTAAACAGCTATGTCTAACATGTAAGAACTAGGCTCTGCTCCAAATTTTGAGAATTCTCCTTTGACTTCTTCTTCATGTTTTTCCTTCTCTCTTTCATTCAATCCTTGTATTTCTGTTTACAAATATACTCTTTTTACAATGTCAGTTAATAGTCAAAAATCACAATATATGTATTTTTGAAGAAAGGATGTAAATATTATTGCTTTGAATATATATGCATTGATTTGATTGTTACTGGATAAAAGAAAAATACAAGGTTGAAATGAAAGACAGACAAGAAAAAACATATAGATAGCTTTTGAAGGAGAACTTTTGAACTTTGTAGATTCGGACCTTAAACTATCGTTTATGTATTATAAATCAAATTACGGAGATATTGTCCGTTATCGTTAAGGTACTACTAACGACAAAGAGATAAAGTAAGCTAGTGTAATAAAGTTTCTATGATGTTGCCAGTGTTGTTAAATTACGTAGGCATTCTACGTTGGTTAGAGAGATTAACTTCAATAGAATAGATAATAGTTACTGGCAAAGCCTCTTGTACTAACGCATTATTTAATCATCACAAGTGCTAAGTCTTGTGATGTACTCTTTGATAAGTTATCAAAGTCTGGTTTGATAACTTTGAGATACAGTCGTGAAGAAGATTCTTACAAGCATGAACTACTATTGATTTTAAACAAAATTTGATGTCCGTGTCATTGATTTCGGCAATTTGTCAAAACGTCAGTCATTTAGGTAATTAGTAAATTCATGAGGAGAAGAAAGATCTCAAGTACTTTCAGGAATATGTAGAGAAATTTAAGATTTTTACAAGAAGCCACCATTTGCTCTAGTTAGATGAAACATATGTGTATGAGGAGATATACTACTGTTATACAAAACTTTGCTGAAATGTAAGGGTCTGAAAAATATTGTAAACCAGGAAATATGTTCAAGGTTTATTCATTTGCATCAACTAGGCAGAAATTTTTTTTTTGTATCAGGTTTGCATTTCTCTATTGTAAAGGTAGACTAGATTTCATTATATTTTTACTAAGAAATTGTAAAATATAATGAAATCTAGCATTATACTAAGCTAGTTTTTCAATCTAATTTTTTTTAGAAAGCTAACATTATATTTTTACTAAGAAAATGTAAAAATATAATGAAATCTGGTTCACTTTTGCAATAGATAAATGCAAACCTGATACGAAAGAATATTTTACTGCCTACTTGATGCAAATGAATAAACCTTGAACATATTTGCTAGATTACATTTTATTTTTACTAAGAAATTATAAAAAAACTAGCAAGAAGAACTAGCTTTGATTTGTTGTTCTAAAAGCTAGTTCCTCTTTCATAGCAAATACCTTCATAAAGTACCACGGGAATACCCTGCTATCTTTTATTTTATGTTAGACCATATTCACCTGGATTCATAATGATCTTAATTCTGTCATCTACAAAATCCTATCGAGTCCAACTTCTGTATGCAGTATTTAAGATGAAATTTGGATTTTTTAAGATTTTATTGATATCGTATAAATCTTTTGCCTAAACTTTAAAAAGAGATGCTCCAGCGAACAATGGGCGGTAGGCAGTCTGCTTTGATCGAGATTGTTAAATTGTTTAGGCTTGTAATTGAATACATCCAAGTCAAGCACAAGGTTTGTTCTTTGAAAGCCAAGGTAATCTGAAGTCTGACATTTCTGTCATTGCAATTCATGCATCAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGTGACTATGTTACTGATCTATTTATTGTCTCGATTTGAAAATATATAATCTGAAATTTAGCTTTGGAATGCGGCGTTCTTCACTTCAAGTAAATATTGGAACGTAGCTCAGTTGGAAACAAGGTTTAAGCGAACAACCCATTAGGATTGAGGCTTGTGGAATCCTCATTATTTTTAAGTACGGGAGAGAATTGTCTGCTCATGCTTCAATTCATGTATTATAATTCAAAAGTCTCATGATCTAGGCTAAGTTGTGGGCCATCTCGCTCTGCTATAGTAGATATTCCATTGTCCTGTGGCTGGGATGCAGTCTAGCTTGTATCTCTGGAGCTTGTATTTGGATTTACTAGATAAATCTTGTCAATATCCATTCACTCTATCGGTTTCTGGGCTGAATGTCAAATTTTCTGGCTATTACTAAGTCAAAGCTTTCAACTTAATTGACTAGATTTCTTATTCTTGCAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGGTGAGTATGAATCTTATTCTGAGAAGTCTTTGAATTTATTTGTTCTCCTGTAACGTCTCGACAGTTGTGACAATCACTTGTATGTGGAGAATGTATCGGATATCTACTTTTAATAACGGCATGTGTCTGTCCAGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGTGAGTAATCCTGACCAATGTGATAATTATCTCTACCTTATACGCAGTTTCAAACTCCTGCATGCGAATTCCACATTTGCAATTCTGGATATTGACTGTCAGTTTTAAATTTTGACAGGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGGTGTGTAAATGTTCGACGCCTAGTCTCCTCCAAGCTGTTTGAGATGGCAATTCACTAAAGTTTTAAACGGCACTTTGCATTGGTAGATATATGTCCTTAATTTCTGCACTGCATTCCATTTTCATCCTATCAAAGAGCTTGTTACCCTCAGTTCTTAACAGTACCTTCATAAACAGCTCTTAGCTGACAGCGGTAAAAAATATAGCATTCATGAAACTTCAAATCCACATTCATTGACCTCGGATTTCATATACATGATACCTCGGAAATTGATCTATGCGTCGTATGGAAATTAGATAAGAAGAGCTCATTTGTTATACTATCCAGGCGTTTATGCTTCAGTTTTCTGCTTCAGTTTGTGTTGTTTTAAAAAATAATTTCTGAGCTGATTTGTTTTACAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGGTATGCTAATTTTATGTATACTGACTACCGGAAGTCACCTCAATTTTTCTGATGTTAGATGCATGATAGTAGGATGGTAAGATCCATATTTCCTTATTTTCTTGTCTGCCATTTCAACGATCTCCAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGATTCGCCTTGAACGAGCAGGACAATTTCGAGTTCCAGAAGCACGTGCCCGAGGTCGCACAACGGTAAGAACTTTGGAGCTAAGGATGGCAAATACATGAGTTTGACAGACTATGGCGATATTCCAGAGGAGTTTCTCTTCTCTCTATGATGAGGACGCCGATAAGAGTTCTTCACAGTGTGCCCGTTGCGTACGAGGCTTTCAGTTTTTTTATTGACGAGCTCAGTTTTCAAGTACAAGACTCCGATGATGATCTTGGTTAGGAGTTTGAAGCCAAGGGTCATGAGGACATTGGTCAGGAGACGAGATTGGAGTTACATAGAGACTCTCCACTCGTTAAGAGTTGGTCCTCTCTATATGATGTACATGTCGCTTCGCAAGTTAGTTTAATTCTATGTCAGTTTATCCTTTCTCGCTAAGTTTTATGACTTTTTATATTTTAGTTTTTCAACCGTGCAGAGATGGATTGTGTCCGAGAAATCAGAAAGAAGACTATATAGTTGGCTGAAAGATATAAAGTCTAGAAGAACTTGCATCTCCTTGTGAGTCACGTGAATTCAGCATTAATGAATCCGATGGATTGAGATAGAATATAATTGAATAAAATCGTTTCCATATTGATAC

mRNA

>Mapoly0132s0031.1
TGCTGTGAATAAATTGTTCATTGGTTGAGCTCTGTTGTGATTAAGTTGTCGTCGAGAGTAGTCTTCGTTTAGTCTGCGCGAGGAATTGCTCTTTGACTGCTTGCCTGTAAAATGGAAGAGTGTAACATGGAAGTGGAGGTTTCTCATCTTGAGAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGATTCGCCTTGAACGAGCAGGACAATTTCGAGTTCCAGAAGCACGTGCCCGAGGTCGCACAACGGTAAGAACTTTGGAGCTAAGGATGGCAAATACATGAGTTTGACAGACTATGGCGATATTCCAGAGGAGTTTCTCTTCTCTCTATGATGAGGACGCCGATAAGAGTTCTTCACAGTGTGCCCGTTGCGTACGAGGCTTTCAGTTTTTTTATTGACGAGCTCAGTTTTCAAGTACAAGACTCCGATGATGATCTTGGTTAGGAGTTTGAAGCCAAGGGTCATGAGGACATTGGTCAGGAGACGAGATTGGAGTTACATAGAGACTCTCCACTCGTTAAGAGTTGGTCCTCTCTATATGATGTACATGTCGCTTCGCAAGTTAGTTTAATTCTATGTCAGTTTATCCTTTCTCGCTAAGTTTTATGACTTTTTATATTTTAGTTTTTCAACCGTGCAGAGATGGATTGTGTCCGAGAAATCAGAAAGAAGACTATATAGTTGGCTGAAAGATATAAAGTCTAGAAGAACTTGCATCTCCTTGTGAGTCACGTGAATTCAGCATTAATGAATCCGATGGATTGAGATAGAATATAATTGAATAAAATCGTTTCCATATTGATAC

CDS

>Mapoly0132s0031.1
ATGGAAGAGTGTAACATGGAAGTGGAGGTTTCTCATCTTGAGAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGA

Protein

>Mapoly0132s0031.1
MEECNMEVEVSHLESKKQHVTGASSMRKRVERWTPEEDELLQEAVVQYKAKNWRLVAKAVPNRTEIQCLQRWQKVLNPAIVKGYWTKEEDQKMLELVGMLGTKRWAAVARSLPGRIGKQCRERWYNQLDPSIKRDPWTEVEDMRLFLAHKRFGSKWSQICSILPGRSENGVKNRWNTHIKKKAFILEEYCRMLNNQQNPSQNEELLGNEAAKKDLLSILE

Mapoly0132s0031.2  

Gene structure:

mRNA scaffold_132:249915..255468  ( + strand )
five_prime_UTR scaffold_132:249915..250197  ( + strand )
five_prime_UTR scaffold_132:250573..250669  ( + strand )
five_prime_UTR scaffold_132:252984..253014  ( + strand )
CDS scaffold_132:253015..253050  ( + strand )
CDS scaffold_132:253515..253572  ( + strand )
CDS scaffold_132:253707..253801  ( + strand )
CDS scaffold_132:253920..254023  ( + strand )
CDS scaffold_132:254425..254553  ( + strand )
CDS scaffold_132:254681..254846  ( + strand )
three_prime_UTR scaffold_132:254847..255468  ( + strand )

Sequences:

Gene

>Mapoly0132s0031.2
GGTTCGAGAAGTATGAGCGTATTGGAGAAGAAGCTTAATGATGCATCTTGATCGATCATGGTGGTCACCATCTGACGTCTGGATTGCCCCAGCTCATTCCAGTCTAACATGTTACCTCATTCCTCTCTCTCTCTCACTGTTATCATGCCGCAGGATTCGAGAAGTATGAGCGTATTGGAGAAGAAGCGTAATACGAAGTAAGAAGTAGGAGCGTATTCCGAGAATCGTGTTGAAGGATTAGGAACACTTTGAAGTCATACTTTCACAAGCAAGACGAGTTCAGGTAACATAATGCTATGGATTTTGATTATATGTTTGATTATCTACTCGAGTTCTGGATGGATTTTGCTTGATTCTGACGACATCTGTAGGATTGCACTTGCAGTTAGAGATATGAAAAATAAAAAAAAATATCAGTACACATCGTGCCCGTGCATCTAGATCCAGAAGTAGTCCTCGCCTCGCCTTTGAATCATGTGAAATGTCAGTTGAGATCTATCTGAAGTAAGCTCGAGCCGTGGTCTTCGGATCCTAACGGAGATGGCAGCGTCGGTGTCGTGTATGCACATCGATACACGACACCGATCGTGTATCGATGTGCAGCCGTTGTTTGAAAAGAATTAAAGCGGCTGAAACTTTCGAAATGCAAACGCCTCAGCGTCCGCCGCTCCGCGCCACGCATGCAGACTGCAGTTGGCAACGGTCTGCTTGGAGCTCGAGAAGGTCCAGCGGCAGGCAACCTTCCCATACAAGAGGTGAGTGTCCTCGCCCCAAGTGTTCATTGTTTGAGCTCTGCTGTGAATAAATTGTTCATTGGTTGAGCTCTGTTGTGATTAAGTTGTCGTCGAGAGTAGTCTTCGTTTAGTCTGCGCGAGGAATTGCTCTTTGACTGCTTGCCTGTAAAATGGAAGAGTGTAACATGGAAGTGGAGGTTTCTCATCTTGAGAGGTTTGTTGACTTCCGAACCACCGATCATGATAGGAGTATGAAGAAAGTAGAACTACGATTATCCACAAACTCACGTTGGCATTTCATCGTTGAGAGCTCTCAACTATGAAAACTTTACACTGAATAGCTGTACAAGGCAATTTGGATGTGTTGTACAACAGTTATTTTGATGTGGACGGCTGTAACGATGTAGTGTGAATCGATTCTGATTTACACTACATCGTTACTTAAAATAGGGATATGAGAGATACCACGGCTTGGTTTAAAGTTTTCACCATCGGCTTTCTTCCATGGTCCAAATAGGTGTAGTTTGTACCTTGACGTTTGTACATAGGGGATATGATTGTAAGAGATTCCAAGCAATCTCCATCACCTTGTGGTAATTTGTTGAATTGATGCTTTTTATTAAACAGCTATGTCTAACATGTAAGAACTAGGCTCTGCTCCAAATTTTGAGAATTCTCCTTTGACTTCTTCTTCATGTTTTTCCTTCTCTCTTTCATTCAATCCTTGTATTTCTGTTTACAAATATACTCTTTTTACAATGTCAGTTAATAGTCAAAAATCACAATATATGTATTTTTGAAGAAAGGATGTAAATATTATTGCTTTGAATATATATGCATTGATTTGATTGTTACTGGATAAAAGAAAAATACAAGGTTGAAATGAAAGACAGACAAGAAAAAACATATAGATAGCTTTTGAAGGAGAACTTTTGAACTTTGTAGATTCGGACCTTAAACTATCGTTTATGTATTATAAATCAAATTACGGAGATATTGTCCGTTATCGTTAAGGTACTACTAACGACAAAGAGATAAAGTAAGCTAGTGTAATAAAGTTTCTATGATGTTGCCAGTGTTGTTAAATTACGTAGGCATTCTACGTTGGTTAGAGAGATTAACTTCAATAGAATAGATAATAGTTACTGGCAAAGCCTCTTGTACTAACGCATTATTTAATCATCACAAGTGCTAAGTCTTGTGATGTACTCTTTGATAAGTTATCAAAGTCTGGTTTGATAACTTTGAGATACAGTCGTGAAGAAGATTCTTACAAGCATGAACTACTATTGATTTTAAACAAAATTTGATGTCCGTGTCATTGATTTCGGCAATTTGTCAAAACGTCAGTCATTTAGGTAATTAGTAAATTCATGAGGAGAAGAAAGATCTCAAGTACTTTCAGGAATATGTAGAGAAATTTAAGATTTTTACAAGAAGCCACCATTTGCTCTAGTTAGATGAAACATATGTGTATGAGGAGATATACTACTGTTATACAAAACTTTGCTGAAATGTAAGGGTCTGAAAAATATTGTAAACCAGGAAATATGTTCAAGGTTTATTCATTTGCATCAACTAGGCAGAAATTTTTTTTTTGTATCAGGTTTGCATTTCTCTATTGTAAAGGTAGACTAGATTTCATTATATTTTTACTAAGAAATTGTAAAATATAATGAAATCTAGCATTATACTAAGCTAGTTTTTCAATCTAATTTTTTTTAGAAAGCTAACATTATATTTTTACTAAGAAAATGTAAAAATATAATGAAATCTGGTTCACTTTTGCAATAGATAAATGCAAACCTGATACGAAAGAATATTTTACTGCCTACTTGATGCAAATGAATAAACCTTGAACATATTTGCTAGATTACATTTTATTTTTACTAAGAAATTATAAAAAAACTAGCAAGAAGAACTAGCTTTGATTTGTTGTTCTAAAAGCTAGTTCCTCTTTCATAGCAAATACCTTCATAAAGTACCACGGGAATACCCTGCTATCTTTTATTTTATGTTAGACCATATTCACCTGGATTCATAATGATCTTAATTCTGTCATCTACAAAATCCTATCGAGTCCAACTTCTGTATGCAGTATTTAAGATGAAATTTGGATTTTTTAAGATTTTATTGATATCGTATAAATCTTTTGCCTAAACTTTAAAAAGAGATGCTCCAGCGAACAATGGGCGGTAGGCAGTCTGCTTTGATCGAGATTGTTAAATTGTTTAGGCTTGTAATTGAATACATCCAAGTCAAGCACAAGGTTTGTTCTTTGAAAGCCAAGGTAATCTGAAGTCTGACATTTCTGTCATTGCAATTCATGCATCAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGTGACTATGTTACTGATCTATTTATTGTCTCGATTTGAAAATATATAATCTGAAATTTAGCTTTGGAATGCGGCGTTCTTCACTTCAAGTAAATATTGGAACGTAGCTCAGTTGGAAACAAGGTTTAAGCGAACAACCCATTAGGATTGAGGCTTGTGGAATCCTCATTATTTTTAAGTACGGGAGAGAATTGTCTGCTCATGCTTCAATTCATGTATTATAATTCAAAAGTCTCATGATCTAGGCTAAGTTGTGGGCCATCTCGCTCTGCTATAGTAGATATTCCATTGTCCTGTGGCTGGGATGCAGTCTAGCTTGTATCTCTGGAGCTTGTATTTGGATTTACTAGATAAATCTTGTCAATATCCATTCACTCTATCGGTTTCTGGGCTGAATGTCAAATTTTCTGGCTATTACTAAGTCAAAGCTTTCAACTTAATTGACTAGATTTCTTATTCTTGCAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGGTGAGTATGAATCTTATTCTGAGAAGTCTTTGAATTTATTTGTTCTCCTGTAACGTCTCGACAGTTGTGACAATCACTTGTATGTGGAGAATGTATCGGATATCTACTTTTAATAACGGCATGTGTCTGTCCAGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGTGAGTAATCCTGACCAATGTGATAATTATCTCTACCTTATACGCAGTTTCAAACTCCTGCATGCGAATTCCACATTTGCAATTCTGGATATTGACTGTCAGTTTTAAATTTTGACAGGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGGTGTGTAAATGTTCGACGCCTAGTCTCCTCCAAGCTGTTTGAGATGGCAATTCACTAAAGTTTTAAACGGCACTTTGCATTGGTAGATATATGTCCTTAATTTCTGCACTGCATTCCATTTTCATCCTATCAAAGAGCTTGTTACCCTCAGTTCTTAACAGTACCTTCATAAACAGCTCTTAGCTGACAGCGGTAAAAAATATAGCATTCATGAAACTTCAAATCCACATTCATTGACCTCGGATTTCATATACATGATACCTCGGAAATTGATCTATGCGTCGTATGGAAATTAGATAAGAAGAGCTCATTTGTTATACTATCCAGGCGTTTATGCTTCAGTTTTCTGCTTCAGTTTGTGTTGTTTTAAAAAATAATTTCTGAGCTGATTTGTTTTACAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGGTATGCTAATTTTATGTATACTGACTACCGGAAGTCACCTCAATTTTTCTGATGTTAGATGCATGATAGTAGGATGGTAAGATCCATATTTCCTTATTTTCTTGTCTGCCATTTCAACGATCTCCAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGATTCGCCTTGAACGAGCAGGACAATTTCGAGTTCCAGAAGCACGTGCCCGAGGTCGCACAACGGTAAGAACTTTGGAGCTAAGGATGGCAAATACATGAGTTTGACAGACTATGGCGATATTCCAGAGGAGTTTCTCTTCTCTCTATGATGAGGACGCCGATAAGAGTTCTTCACAGTGTGCCCGTTGCGTACGAGGCTTTCAGTTTTTTTATTGACGAGCTCAGTTTTCAAGTACAAGACTCCGATGATGATCTTGGTTAGGAGTTTGAAGCCAAGGGTCATGAGGACATTGGTCAGGAGACGAGATTGGAGTTACATAGAGACTCTCCACTCGTTAAGAGTTGGTCCTCTCTATATGATGTACATGTCGCTTCGCAAGTTAGTTTAATTCTATGTCAGTTTATCCTTTCTCGCTAAGTTTTATGACTTTTTATATTTTAGTTTTTCAACCGTGCAGAGATGGATTGTGTCCGAGAAATCAGAAAGAAGACTATATAGTTGGCTGAAAGATATAAAGTCTAGAAGAACTTGCATCTCCTTGTGAGTCACGTGAATTCAGCATTAATGAATCCGATGGATTGAGATAGAATATAATTGAATAAAATCGTTTCCATATTGATAC

mRNA

>Mapoly0132s0031.2
GGTTCGAGAAGTATGAGCGTATTGGAGAAGAAGCTTAATGATGCATCTTGATCGATCATGGTGGTCACCATCTGACGTCTGGATTGCCCCAGCTCATTCCAGTCTAACATGTTACCTCATTCCTCTCTCTCTCTCACTGTTATCATGCCGCAGGATTCGAGAAGTATGAGCGTATTGGAGAAGAAGCGTAATACGAAGTAAGAAGTAGGAGCGTATTCCGAGAATCGTGTTGAAGGATTAGGAACACTTTGAAGTCATACTTTCACAAGCAAGACGAGTTCAGCGTCCGCCGCTCCGCGCCACGCATGCAGACTGCAGTTGGCAACGGTCTGCTTGGAGCTCGAGAAGGTCCAGCGGCAGGCAACCTTCCCATACAAGAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGATTCGCCTTGAACGAGCAGGACAATTTCGAGTTCCAGAAGCACGTGCCCGAGGTCGCACAACGGTAAGAACTTTGGAGCTAAGGATGGCAAATACATGAGTTTGACAGACTATGGCGATATTCCAGAGGAGTTTCTCTTCTCTCTATGATGAGGACGCCGATAAGAGTTCTTCACAGTGTGCCCGTTGCGTACGAGGCTTTCAGTTTTTTTATTGACGAGCTCAGTTTTCAAGTACAAGACTCCGATGATGATCTTGGTTAGGAGTTTGAAGCCAAGGGTCATGAGGACATTGGTCAGGAGACGAGATTGGAGTTACATAGAGACTCTCCACTCGTTAAGAGTTGGTCCTCTCTATATGATGTACATGTCGCTTCGCAAGTTAGTTTAATTCTATGTCAGTTTATCCTTTCTCGCTAAGTTTTATGACTTTTTATATTTTAGTTTTTCAACCGTGCAGAGATGGATTGTGTCCGAGAAATCAGAAAGAAGACTATATAGTTGGCTGAAAGATATAAAGTCTAGAAGAACTTGCATCTCCTTGTGAGTCACGTGAATTCAGCATTAATGAATCCGATGGATTGAGATAGAATATAATTGAATAAAATCGTTTCCATATTGATAC

CDS

>Mapoly0132s0031.2
ATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGA

Protein

>Mapoly0132s0031.2
MRKRVERWTPEEDELLQEAVVQYKAKNWRLVAKAVPNRTEIQCLQRWQKVLNPAIVKGYWTKEEDQKMLELVGMLGTKRWAAVARSLPGRIGKQCRERWYNQLDPSIKRDPWTEVEDMRLFLAHKRFGSKWSQICSILPGRSENGVKNRWNTHIKKKAFILEEYCRMLNNQQNPSQNEELLGNEAAKKDLLSILE

Mapoly0132s0031.3  

Gene structure:

mRNA scaffold_132:250545..255468  ( + strand )
five_prime_UTR scaffold_132:250545..250669  ( + strand )
five_prime_UTR scaffold_132:252984..253014  ( + strand )
CDS scaffold_132:253015..253050  ( + strand )
CDS scaffold_132:253515..253572  ( + strand )
CDS scaffold_132:253707..253801  ( + strand )
CDS scaffold_132:253920..254023  ( + strand )
CDS scaffold_132:254425..254553  ( + strand )
CDS scaffold_132:254681..254846  ( + strand )
three_prime_UTR scaffold_132:254847..255468  ( + strand )

Sequences:

Gene

>Mapoly0132s0031.3
TGAAACTTTCGAAATGCAAACGCCTCAGCGTCCGCCGCTCCGCGCCACGCATGCAGACTGCAGTTGGCAACGGTCTGCTTGGAGCTCGAGAAGGTCCAGCGGCAGGCAACCTTCCCATACAAGAGGTGAGTGTCCTCGCCCCAAGTGTTCATTGTTTGAGCTCTGCTGTGAATAAATTGTTCATTGGTTGAGCTCTGTTGTGATTAAGTTGTCGTCGAGAGTAGTCTTCGTTTAGTCTGCGCGAGGAATTGCTCTTTGACTGCTTGCCTGTAAAATGGAAGAGTGTAACATGGAAGTGGAGGTTTCTCATCTTGAGAGGTTTGTTGACTTCCGAACCACCGATCATGATAGGAGTATGAAGAAAGTAGAACTACGATTATCCACAAACTCACGTTGGCATTTCATCGTTGAGAGCTCTCAACTATGAAAACTTTACACTGAATAGCTGTACAAGGCAATTTGGATGTGTTGTACAACAGTTATTTTGATGTGGACGGCTGTAACGATGTAGTGTGAATCGATTCTGATTTACACTACATCGTTACTTAAAATAGGGATATGAGAGATACCACGGCTTGGTTTAAAGTTTTCACCATCGGCTTTCTTCCATGGTCCAAATAGGTGTAGTTTGTACCTTGACGTTTGTACATAGGGGATATGATTGTAAGAGATTCCAAGCAATCTCCATCACCTTGTGGTAATTTGTTGAATTGATGCTTTTTATTAAACAGCTATGTCTAACATGTAAGAACTAGGCTCTGCTCCAAATTTTGAGAATTCTCCTTTGACTTCTTCTTCATGTTTTTCCTTCTCTCTTTCATTCAATCCTTGTATTTCTGTTTACAAATATACTCTTTTTACAATGTCAGTTAATAGTCAAAAATCACAATATATGTATTTTTGAAGAAAGGATGTAAATATTATTGCTTTGAATATATATGCATTGATTTGATTGTTACTGGATAAAAGAAAAATACAAGGTTGAAATGAAAGACAGACAAGAAAAAACATATAGATAGCTTTTGAAGGAGAACTTTTGAACTTTGTAGATTCGGACCTTAAACTATCGTTTATGTATTATAAATCAAATTACGGAGATATTGTCCGTTATCGTTAAGGTACTACTAACGACAAAGAGATAAAGTAAGCTAGTGTAATAAAGTTTCTATGATGTTGCCAGTGTTGTTAAATTACGTAGGCATTCTACGTTGGTTAGAGAGATTAACTTCAATAGAATAGATAATAGTTACTGGCAAAGCCTCTTGTACTAACGCATTATTTAATCATCACAAGTGCTAAGTCTTGTGATGTACTCTTTGATAAGTTATCAAAGTCTGGTTTGATAACTTTGAGATACAGTCGTGAAGAAGATTCTTACAAGCATGAACTACTATTGATTTTAAACAAAATTTGATGTCCGTGTCATTGATTTCGGCAATTTGTCAAAACGTCAGTCATTTAGGTAATTAGTAAATTCATGAGGAGAAGAAAGATCTCAAGTACTTTCAGGAATATGTAGAGAAATTTAAGATTTTTACAAGAAGCCACCATTTGCTCTAGTTAGATGAAACATATGTGTATGAGGAGATATACTACTGTTATACAAAACTTTGCTGAAATGTAAGGGTCTGAAAAATATTGTAAACCAGGAAATATGTTCAAGGTTTATTCATTTGCATCAACTAGGCAGAAATTTTTTTTTTGTATCAGGTTTGCATTTCTCTATTGTAAAGGTAGACTAGATTTCATTATATTTTTACTAAGAAATTGTAAAATATAATGAAATCTAGCATTATACTAAGCTAGTTTTTCAATCTAATTTTTTTTAGAAAGCTAACATTATATTTTTACTAAGAAAATGTAAAAATATAATGAAATCTGGTTCACTTTTGCAATAGATAAATGCAAACCTGATACGAAAGAATATTTTACTGCCTACTTGATGCAAATGAATAAACCTTGAACATATTTGCTAGATTACATTTTATTTTTACTAAGAAATTATAAAAAAACTAGCAAGAAGAACTAGCTTTGATTTGTTGTTCTAAAAGCTAGTTCCTCTTTCATAGCAAATACCTTCATAAAGTACCACGGGAATACCCTGCTATCTTTTATTTTATGTTAGACCATATTCACCTGGATTCATAATGATCTTAATTCTGTCATCTACAAAATCCTATCGAGTCCAACTTCTGTATGCAGTATTTAAGATGAAATTTGGATTTTTTAAGATTTTATTGATATCGTATAAATCTTTTGCCTAAACTTTAAAAAGAGATGCTCCAGCGAACAATGGGCGGTAGGCAGTCTGCTTTGATCGAGATTGTTAAATTGTTTAGGCTTGTAATTGAATACATCCAAGTCAAGCACAAGGTTTGTTCTTTGAAAGCCAAGGTAATCTGAAGTCTGACATTTCTGTCATTGCAATTCATGCATCAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGTGACTATGTTACTGATCTATTTATTGTCTCGATTTGAAAATATATAATCTGAAATTTAGCTTTGGAATGCGGCGTTCTTCACTTCAAGTAAATATTGGAACGTAGCTCAGTTGGAAACAAGGTTTAAGCGAACAACCCATTAGGATTGAGGCTTGTGGAATCCTCATTATTTTTAAGTACGGGAGAGAATTGTCTGCTCATGCTTCAATTCATGTATTATAATTCAAAAGTCTCATGATCTAGGCTAAGTTGTGGGCCATCTCGCTCTGCTATAGTAGATATTCCATTGTCCTGTGGCTGGGATGCAGTCTAGCTTGTATCTCTGGAGCTTGTATTTGGATTTACTAGATAAATCTTGTCAATATCCATTCACTCTATCGGTTTCTGGGCTGAATGTCAAATTTTCTGGCTATTACTAAGTCAAAGCTTTCAACTTAATTGACTAGATTTCTTATTCTTGCAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGGTGAGTATGAATCTTATTCTGAGAAGTCTTTGAATTTATTTGTTCTCCTGTAACGTCTCGACAGTTGTGACAATCACTTGTATGTGGAGAATGTATCGGATATCTACTTTTAATAACGGCATGTGTCTGTCCAGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGTGAGTAATCCTGACCAATGTGATAATTATCTCTACCTTATACGCAGTTTCAAACTCCTGCATGCGAATTCCACATTTGCAATTCTGGATATTGACTGTCAGTTTTAAATTTTGACAGGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGGTGTGTAAATGTTCGACGCCTAGTCTCCTCCAAGCTGTTTGAGATGGCAATTCACTAAAGTTTTAAACGGCACTTTGCATTGGTAGATATATGTCCTTAATTTCTGCACTGCATTCCATTTTCATCCTATCAAAGAGCTTGTTACCCTCAGTTCTTAACAGTACCTTCATAAACAGCTCTTAGCTGACAGCGGTAAAAAATATAGCATTCATGAAACTTCAAATCCACATTCATTGACCTCGGATTTCATATACATGATACCTCGGAAATTGATCTATGCGTCGTATGGAAATTAGATAAGAAGAGCTCATTTGTTATACTATCCAGGCGTTTATGCTTCAGTTTTCTGCTTCAGTTTGTGTTGTTTTAAAAAATAATTTCTGAGCTGATTTGTTTTACAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGGTATGCTAATTTTATGTATACTGACTACCGGAAGTCACCTCAATTTTTCTGATGTTAGATGCATGATAGTAGGATGGTAAGATCCATATTTCCTTATTTTCTTGTCTGCCATTTCAACGATCTCCAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGATTCGCCTTGAACGAGCAGGACAATTTCGAGTTCCAGAAGCACGTGCCCGAGGTCGCACAACGGTAAGAACTTTGGAGCTAAGGATGGCAAATACATGAGTTTGACAGACTATGGCGATATTCCAGAGGAGTTTCTCTTCTCTCTATGATGAGGACGCCGATAAGAGTTCTTCACAGTGTGCCCGTTGCGTACGAGGCTTTCAGTTTTTTTATTGACGAGCTCAGTTTTCAAGTACAAGACTCCGATGATGATCTTGGTTAGGAGTTTGAAGCCAAGGGTCATGAGGACATTGGTCAGGAGACGAGATTGGAGTTACATAGAGACTCTCCACTCGTTAAGAGTTGGTCCTCTCTATATGATGTACATGTCGCTTCGCAAGTTAGTTTAATTCTATGTCAGTTTATCCTTTCTCGCTAAGTTTTATGACTTTTTATATTTTAGTTTTTCAACCGTGCAGAGATGGATTGTGTCCGAGAAATCAGAAAGAAGACTATATAGTTGGCTGAAAGATATAAAGTCTAGAAGAACTTGCATCTCCTTGTGAGTCACGTGAATTCAGCATTAATGAATCCGATGGATTGAGATAGAATATAATTGAATAAAATCGTTTCCATATTGATAC

mRNA

>Mapoly0132s0031.3
TGAAACTTTCGAAATGCAAACGCCTCAGCGTCCGCCGCTCCGCGCCACGCATGCAGACTGCAGTTGGCAACGGTCTGCTTGGAGCTCGAGAAGGTCCAGCGGCAGGCAACCTTCCCATACAAGAGTAAGAAGCAGCATGTTACGGGAGCGTCTTCAATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGATTCGCCTTGAACGAGCAGGACAATTTCGAGTTCCAGAAGCACGTGCCCGAGGTCGCACAACGGTAAGAACTTTGGAGCTAAGGATGGCAAATACATGAGTTTGACAGACTATGGCGATATTCCAGAGGAGTTTCTCTTCTCTCTATGATGAGGACGCCGATAAGAGTTCTTCACAGTGTGCCCGTTGCGTACGAGGCTTTCAGTTTTTTTATTGACGAGCTCAGTTTTCAAGTACAAGACTCCGATGATGATCTTGGTTAGGAGTTTGAAGCCAAGGGTCATGAGGACATTGGTCAGGAGACGAGATTGGAGTTACATAGAGACTCTCCACTCGTTAAGAGTTGGTCCTCTCTATATGATGTACATGTCGCTTCGCAAGTTAGTTTAATTCTATGTCAGTTTATCCTTTCTCGCTAAGTTTTATGACTTTTTATATTTTAGTTTTTCAACCGTGCAGAGATGGATTGTGTCCGAGAAATCAGAAAGAAGACTATATAGTTGGCTGAAAGATATAAAGTCTAGAAGAACTTGCATCTCCTTGTGAGTCACGTGAATTCAGCATTAATGAATCCGATGGATTGAGATAGAATATAATTGAATAAAATCGTTTCCATATTGATAC

CDS

>Mapoly0132s0031.3
ATGCGTAAGCGTGTAGAAAGATGGACTCCTGAAGAGGATGAGCTTTTGCAAGAGGCAGTCGTCCAGTACAAGGCAAAAAACTGGCGACTGGTCGCTAAAGCAGTACCGAATCGAACAGAAATTCAATGTCTACAGAGGTGGCAGAAAGTGTTGAATCCAGCCATTGTCAAAGGATACTGGACCAAAGAAGAAGATCAGAAGATGTTAGAATTGGTGGGAATGCTTGGCACGAAGCGATGGGCTGCGGTCGCTCGCTCTCTACCTGGCAGAATCGGCAAGCAGTGTAGGGAAAGATGGTACAATCAGCTTGATCCCAGTATCAAGCGCGATCCGTGGACCGAGGTAGAAGACATGAGGCTCTTCTTAGCGCACAAGCGGTTTGGGAGTAAATGGTCTCAAATCTGTTCAATACTTCCTGGAAGATCAGAGAACGGAGTGAAGAACCGGTGGAATACGCATATCAAGAAGAAGGCCTTCATTTTGGAGGAATACTGCAGAATGTTGAATAATCAACAAAACCCGTCTCAGAACGAGGAACTTCTGGGCAACGAGGCGGCCAAAAAAGATTTGCTGTCAATTTTAGAGTGA

Protein

>Mapoly0132s0031.3
MRKRVERWTPEEDELLQEAVVQYKAKNWRLVAKAVPNRTEIQCLQRWQKVLNPAIVKGYWTKEEDQKMLELVGMLGTKRWAAVARSLPGRIGKQCRERWYNQLDPSIKRDPWTEVEDMRLFLAHKRFGSKWSQICSILPGRSENGVKNRWNTHIKKKAFILEEYCRMLNNQQNPSQNEELLGNEAAKKDLLSILE

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>