Mapoly0138s0004



Description

H/ACA ribonucleoprotein complex subunit 4

Reference DB

Database ID Description
EC 5.4.99.- Transferring other groups.
GO GO:0003723 RNA binding
GO GO:0006396 RNA processing
KEGGORTH K11131
KOG KOG2529 Pseudouridine synthase
OrthoMCL OG5_126700
PFAM PF01472 PUA domain
PFAM PF01509 TruB family pseudouridylate synthase (N terminal domain)
PFAM PF08068 DKCLD (NUC011) domain
PANTHER PTHR23127 CENTROMERE/MICROTUBULE BINDING PROTEIN CBF5

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCBF5 transcription factor, CBF5 Mapoly0138s0004.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0138s0004.1 scaffold_138:36811..38592  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0138s0004.1  

Gene structure:

mRNA scaffold_138:36811..38592  ( - strand )
CDS scaffold_138:36811..37074  ( - strand )
CDS scaffold_138:37234..38592  ( - strand )

Sequences:

Gene

>Mapoly0138s0004.1
ATGGCGAGCGCGGAAAAGAAGAAGAAGAAGAGAGACAAGGGAGAGAAAAACGGGGTGGAGGAGGATGGGGCCATCGTGACTGCAGGTGCAGCTGGTCTTGATCAAGCGAGTATCGATTTCTTGATCAAGCCCCAGAGTTCGACCCCTGCATTGGACACCTCGCAATGGCCGATTTTGCTCAAGAATTACGACAAGCTCAACATTCGAACTGGACACTATACCCCCATTCCCACCGGGCATTCTCCGTTGAAACGGCCTCTGTTCGATTACGTACGGTACGGTGTGATCAATCTGGATAAGCCCGCCAACCCTTCTTCCCACGAGGTCGTCGCGTGGATTAGGAGAATATTGAGGGTCGACAAGACCGGACACAGTGGTACTTTGGATCCGAAGGTCACAGGTAGTCTAATCGTTTGTGTAGACAGGGCAACTCGGCTCGTGAAAGCTCAACAAGGAGCTGGGAAGGAGTACGTTTGTGTAGCTCGCCTTCACTCCGCAGTCGACAATGTTGCCAAGGTCGCTCGAGCTATCGAAACCCTGACCGGTGCTTTGTTCCAAAGACCTCCTCTGATTTCTGCCGTGAAGAGGCAGCTCAGGATTAGGACAATCTACCAAAGTAAGTTGCTGGAATATGACGCCGAGCGCCACTTGGTGGTGTTTTGGGTTTCCTGCGAGGCGGGAACTTACATTAGAACTTTGTGTGTTCACTTGGGATTGCTTCTAGGAGTCGGGGGCCATATGCAGGAGCTGAGGCGTGTGAGGTCAGGTATTCTGGGAGAGAAGGATAATCTGGTAACGATGCATGACGTTTTGGATGCTCAATGGCAATTCGATCACAACCAGGACGAAGCTTATCTCAGACGAGTTATTATGCCCCTGGAGGTTCTGCTGACAAGCTACAAAAGGCTGGTCGTGAAGGACAGTGCTGTCAATGCCATCTGCTACGGAGCCAAGCTGATGATTCCAGGTCTCTTACGATTTGAGAACGGAATTGAAAACGGCGAGGAGGTTGTGCTCATGACGACCAAGGGCGAGGCAATCGCATTGGGTGTCGCTCAGATGACCACCGCCGTAATGGCCACCTGCGACCACGGAGTCGTTGCCAAGGTCAAGAGAGTCGTCATGGAGAGGGACACATATCCCAGGAAATGGGGTTTGGGACCTCGCGCATCCACGAAGAAGAAATTGATCGCCGATGGGTTGCTGGACAAGAATGGCAGACCCAACGAGAAAACCCCCGCAGAGTGGCTGAGGAACATCCCTGAGCTCGAAACCATCACCGTCGCGGCGGGCGAGGACACAGCGATCGCGAGGGCGGCAGCCGTGGAAGAGCCTTCGACGGCGAAGCCGAAGAAAGAGGTGAAGGTGAAAGAAGAGCCTGAAGAAGCGCGAGCCGGAGAGAAGAGGAAAGTGTCGGCCGACGTCGCGACCCCAGAGCCCGCCGCGAAGAAGAAGAAGCAAAAGACGGAAGACGCCGAAGAGGTCACGGAGGCGGTGATGGAGACGACGACCCCGAAGAGCGAGAAGAAGAAAAAGAAGAAGGACAAGGAGCAGCACAAGGAGGAAGAGGAGGAGGAGAATGGTGCGGACGAGCCCAAGTCCGAGAAGAAGAAGAAGAAGAAGGATAAATCCGCCGATTTGACGGAGGAATTGACGGAGACACCGAAGAGTGAGAAGAAGAAGAAGAAAGATAAATCCGCGGGTGCGGAGGAGACGGCTGCTGAGGCCGAGGCGCCGAAGAGCGAGAAGAAGAAGAAGAAGAAGAAAGACGAGGAGTTATAG

mRNA

>Mapoly0138s0004.1
ATGGCGAGCGCGGAAAAGAAGAAGAAGAAGAGAGACAAGGGAGAGAAAAACGGGGTGGAGGAGGATGGGGCCATCGTGACTGCAGGTGCAGCTGGTCTTGATCAAGCGAGTATCGATTTCTTGATCAAGCCCCAGAGTTCGACCCCTGCATTGGACACCTCGCAATGGCCGATTTTGCTCAAGAATTACGACAAGCTCAACATTCGAACTGGACACTATACCCCCATTCCCACCGGGCATTCTCCGTTGAAACGGCCTCTGTTCGATTACGTACGGTACGGTGTGATCAATCTGGATAAGCCCGCCAACCCTTCTTCCCACGAGGTCGTCGCGTGGATTAGGAGAATATTGAGGGTCGACAAGACCGGACACAGTGGTACTTTGGATCCGAAGGTCACAGGTAGTCTAATCGTTTGTGTAGACAGGGCAACTCGGCTCGTGAAAGCTCAACAAGGAGCTGGGAAGGAGTACGTTTGTGTAGCTCGCCTTCACTCCGCAGTCGACAATGTTGCCAAGGTCGCTCGAGCTATCGAAACCCTGACCGGTGCTTTGTTCCAAAGACCTCCTCTGATTTCTGCCGTGAAGAGGCAGCTCAGGATTAGGACAATCTACCAAAGTAAGTTGCTGGAATATGACGCCGAGCGCCACTTGGTGGTGTTTTGGGTTTCCTGCGAGGCGGGAACTTACATTAGAACTTTGTGTGTTCACTTGGGATTGCTTCTAGGAGTCGGGGGCCATATGCAGGAGCTGAGGCGTGTGAGGTCAGGTATTCTGGGAGAGAAGGATAATCTGGTAACGATGCATGACGTTTTGGATGCTCAATGGCAATTCGATCACAACCAGGACGAAGCTTATCTCAGACGAGTTATTATGCCCCTGGAGGTTCTGCTGACAAGCTACAAAAGGCTGGTCGTGAAGGACAGTGCTGTCAATGCCATCTGCTACGGAGCCAAGCTGATGATTCCAGGTCTCTTACGATTTGAGAACGGAATTGAAAACGGCGAGGAGGTTGTGCTCATGACGACCAAGGGCGAGGCAATCGCATTGGGTGTCGCTCAGATGACCACCGCCGTAATGGCCACCTGCGACCACGGAGTCGTTGCCAAGGTCAAGAGAGTCGTCATGGAGAGGGACACATATCCCAGGAAATGGGGTTTGGGACCTCGCGCATCCACGAAGAAGAAATTGATCGCCGATGGGTTGCTGGACAAGAATGGCAGACCCAACGAGAAAACCCCCGCAGAGTGGCTGAGGAACATCCCTGAGCTCGAAACCATCACCGTCGCGGCGGGCGAGGACACAGCGATCGCGAGGGCGGCAGCCGTGGAAGAGCCTTCGACGGCGAAGCCGAAGAAAGAGAGCGAGAAGAAGAAAAAGAAGAAGGACAAGGAGCAGCACAAGGAGGAAGAGGAGGAGGAGAATGGTGCGGACGAGCCCAAGTCCGAGAAGAAGAAGAAGAAGAAGGATAAATCCGCCGATTTGACGGAGGAATTGACGGAGACACCGAAGAGTGAGAAGAAGAAGAAGAAAGATAAATCCGCGGGTGCGGAGGAGACGGCTGCTGAGGCCGAGGCGCCGAAGAGCGAGAAGAAGAAGAAGAAGAAGAAAGACGAGGAGTTATAG

CDS

>Mapoly0138s0004.1
ATGGCGAGCGCGGAAAAGAAGAAGAAGAAGAGAGACAAGGGAGAGAAAAACGGGGTGGAGGAGGATGGGGCCATCGTGACTGCAGGTGCAGCTGGTCTTGATCAAGCGAGTATCGATTTCTTGATCAAGCCCCAGAGTTCGACCCCTGCATTGGACACCTCGCAATGGCCGATTTTGCTCAAGAATTACGACAAGCTCAACATTCGAACTGGACACTATACCCCCATTCCCACCGGGCATTCTCCGTTGAAACGGCCTCTGTTCGATTACGTACGGTACGGTGTGATCAATCTGGATAAGCCCGCCAACCCTTCTTCCCACGAGGTCGTCGCGTGGATTAGGAGAATATTGAGGGTCGACAAGACCGGACACAGTGGTACTTTGGATCCGAAGGTCACAGGTAGTCTAATCGTTTGTGTAGACAGGGCAACTCGGCTCGTGAAAGCTCAACAAGGAGCTGGGAAGGAGTACGTTTGTGTAGCTCGCCTTCACTCCGCAGTCGACAATGTTGCCAAGGTCGCTCGAGCTATCGAAACCCTGACCGGTGCTTTGTTCCAAAGACCTCCTCTGATTTCTGCCGTGAAGAGGCAGCTCAGGATTAGGACAATCTACCAAAGTAAGTTGCTGGAATATGACGCCGAGCGCCACTTGGTGGTGTTTTGGGTTTCCTGCGAGGCGGGAACTTACATTAGAACTTTGTGTGTTCACTTGGGATTGCTTCTAGGAGTCGGGGGCCATATGCAGGAGCTGAGGCGTGTGAGGTCAGGTATTCTGGGAGAGAAGGATAATCTGGTAACGATGCATGACGTTTTGGATGCTCAATGGCAATTCGATCACAACCAGGACGAAGCTTATCTCAGACGAGTTATTATGCCCCTGGAGGTTCTGCTGACAAGCTACAAAAGGCTGGTCGTGAAGGACAGTGCTGTCAATGCCATCTGCTACGGAGCCAAGCTGATGATTCCAGGTCTCTTACGATTTGAGAACGGAATTGAAAACGGCGAGGAGGTTGTGCTCATGACGACCAAGGGCGAGGCAATCGCATTGGGTGTCGCTCAGATGACCACCGCCGTAATGGCCACCTGCGACCACGGAGTCGTTGCCAAGGTCAAGAGAGTCGTCATGGAGAGGGACACATATCCCAGGAAATGGGGTTTGGGACCTCGCGCATCCACGAAGAAGAAATTGATCGCCGATGGGTTGCTGGACAAGAATGGCAGACCCAACGAGAAAACCCCCGCAGAGTGGCTGAGGAACATCCCTGAGCTCGAAACCATCACCGTCGCGGCGGGCGAGGACACAGCGATCGCGAGGGCGGCAGCCGTGGAAGAGCCTTCGACGGCGAAGCCGAAGAAAGAGAGCGAGAAGAAGAAAAAGAAGAAGGACAAGGAGCAGCACAAGGAGGAAGAGGAGGAGGAGAATGGTGCGGACGAGCCCAAGTCCGAGAAGAAGAAGAAGAAGAAGGATAAATCCGCCGATTTGACGGAGGAATTGACGGAGACACCGAAGAGTGAGAAGAAGAAGAAGAAAGATAAATCCGCGGGTGCGGAGGAGACGGCTGCTGAGGCCGAGGCGCCGAAGAGCGAGAAGAAGAAGAAGAAGAAGAAAGACGAGGAGTTATAG

Protein

>Mapoly0138s0004.1
MASAEKKKKKRDKGEKNGVEEDGAIVTAGAAGLDQASIDFLIKPQSSTPALDTSQWPILLKNYDKLNIRTGHYTPIPTGHSPLKRPLFDYVRYGVINLDKPANPSSHEVVAWIRRILRVDKTGHSGTLDPKVTGSLIVCVDRATRLVKAQQGAGKEYVCVARLHSAVDNVAKVARAIETLTGALFQRPPLISAVKRQLRIRTIYQSKLLEYDAERHLVVFWVSCEAGTYIRTLCVHLGLLLGVGGHMQELRRVRSGILGEKDNLVTMHDVLDAQWQFDHNQDEAYLRRVIMPLEVLLTSYKRLVVKDSAVNAICYGAKLMIPGLLRFENGIENGEEVVLMTTKGEAIALGVAQMTTAVMATCDHGVVAKVKRVVMERDTYPRKWGLGPRASTKKKLIADGLLDKNGRPNEKTPAEWLRNIPELETITVAAGEDTAIARAAAVEEPSTAKPKKESEKKKKKKDKEQHKEEEEEENGADEPKSEKKKKKKDKSADLTEELTETPKSEKKKKKDKSAGAEETAAEAEAPKSEKKKKKKKDEEL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>