Mapoly0144s0031



Description

AP2 domain

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
OrthoMCL OG5_135471
PFAM PF00847 AP2 domain
PANTHER PTHR32467 FAMILY NOT NAMED
PANTHER PTHR32467:SF7

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2L4 transcription factor, AP2/ERF Mapoly0144s0031.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0144s0031.1 scaffold_144:403622..406916  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0144s0031.1  

Gene structure:

mRNA scaffold_144:403622..406916  ( - strand )
three_prime_UTR scaffold_144:403622..403792  ( - strand )
CDS scaffold_144:403793..404200  ( - strand )
CDS scaffold_144:404379..404977  ( - strand )
CDS scaffold_144:405115..405188  ( - strand )
CDS scaffold_144:405317..405361  ( - strand )
CDS scaffold_144:405503..405663  ( - strand )
CDS scaffold_144:406193..406280  ( - strand )
CDS scaffold_144:406380..406410  ( - strand )
CDS scaffold_144:406633..406658  ( - strand )
CDS scaffold_144:406816..406916  ( - strand )

Sequences:

Gene

>Mapoly0144s0031.1
ATGGGGAGAAGAGCGGGAGGACGGAAGTGTGCAAGGGTTCAGGGACCGTACAAGGGCGTCACTTTTTACAAGCGCACGGGTAAATGGGAAGCTAACCTTTGGTAAGCAACTTCAATCCCATTCCTTACGTTATATCATGAATCTGCTTCTTAGAGGAAAACAGAAGACATAGTTTCACGAGCTGAATTTGGAATTTCTTTCTCCCTGGTTTTCTGCAATTTCAGCAGTTTTTGATTCTCATCTTCTGTTTTGGTGCAGGTTTGAGAATCAGCAGCACTATCTAGGTAAAGTGTGAAAATTTGCGCATCTCATCTGCATTTGAGTTTAGCAAACAAAAGAACTTAAGTTGTGGGAGTCGCATACAACCATTACATACTAGCACTAATGTAAACGTTGTTTATGTAAGGCCCCTCCTCATGGTCAATTGACGTCTTTCCTAAATGGGTGAATTCTCTCTCTCTCTTTATATTCTCTATATTGATACTTTCATTCCTTGTTGGTAACAGGTGCCTCGTTTTCTGCTCTCGAAGCTGCTAGGTATGTACACTTCTTCAACTTCCACAATCTCTGGATAACATCGAAGTCAATCATTCAATTTTCTTATATTATCTAATTGAAAATATTCGTGTTTTGTAGAGCATACGACAAGGGTATTTTGTTTACTCGGTCTTCCACGGAGCAACTAAACTTCGATCGGAGTAACTACAAGGAAGATATCCAGAAGGTTCGCTTTGTTCCCCACATCATTGGCATCATGAATTTCGCGATGAATTACAGGGGCCCTATACCATTCCTGGTGTTTCCATGCATCCAAAGAGATTGGATGCAATAGAAATCTTGCTCCATTGTTTACTTCCGCTTAGACTTTCTAGAATCAACCCGTTCTGTAGCCCTCGAGTTCAGACCCTTTATGATTTTCACGTCGCATCAAGTAAGGTCGATGATGAAAAGGAAGTTGAATGTTTGTCCTCTGAAAACTCTTACACTGGAGAGTAGAAATTGCATCTACTTGATTAGAAGTCATGCATGCACAAAGTCTTATTTCTTAGTAGATGACGTTGGTCTTCAGACAAGACAAGACAAGACTGTACTGATCCAAAGACTCTCGGTATATTTTACTACACGATCATAATATATTCAGTAGGTACGAAACAATAACGGTAGGAATTCAATTTCAATTTTGTGTTTCCGTTGTCTTATCTCAATTTTGAGCTCATGAAGACGATATCTGTTTGATTTTTCGTGTGTGACAGATGAGAGGGATGAGCTTTCTGGCTTACAGACAGTTCTTGCGTGACACGAGTAAGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAGTAAGTCAACCGTGTGATTCGTCCATCGACTTCCAGAGTTCCGATGATATACTTTGAATCGATTTCAGCTACCTTTGAAATTCATGCTCAGCAGCATGTGCATTACTGATGCTCTCCTCTAAATCAATTGCATATGTTCAGATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTAAGGTAAGAATCGTGATTCCGTGATCGCAAATAATTTCATTTTATGTGGACAGTCAAGAGAGGGCTGGTGCACATTTACTGAGGGAATGAATATTTATTGACCGAATTTCCATCCTGTAATTCGGCTGCAGAGCATACAATGAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGTAAGTGAATCAAGTACTTTATCATGATATGAAGGTTGATTATATATTCCCATAGTTCCTATTCTGTGACTGCAGTCCGTATACTTGATACAATCATGATCAGATTTATTTTTTAACTAGCGATTTTCACCCTACAGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCAAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGTTGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCCTCTGTAAACGTTCCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGGTACACATCGAGGTACGATCCTATCATCGAATGGTAGCAAGGGACTGCTTCAGATGAATGATGCAGCAGCTGGTCCTTCAAACATACCAGAAGAAATAGATCCTCCGAATCCTTCAAATCCTGCTCCACATAAGGATGCACATCCTTCAAATCCTGATCCATGTGAGGATGCACATCGAGATGAGATGGGGTCTTTTAGCAGAAGCAGTGGAATGCTCCAGGAGAACCATTTACATAGCTCGAGACCAAATGACTTCGAACAAAGTCAGCATCATGAGGTAATGATTCTTACTTCCTTATGTTGGTCCTGACATATTTTGTGCATCACAATAATTTCCACCGGAAAAAGTAGAACTTTCAGTAGATATATAATATACCTCTGAAGAATGCATGTGAGTCTATGCATGACATTCCCAAGTTTGAAACATATTGATTTATATTTTGTTTTGTTTCCAGGATGGACGCTCCTGTACAGTCCACAGTGATGCGGTACTCCTGAACGTCTGTAGGATGCAAAATATTTGGGGTGGTTCGGTACTCATGAACATCTATAGGATGCAAACTGAAGGGGGTGATCCGGTAATCCTGAGCTTCCTGCAACATGAAGGGTACAATCATCTCCAAATACAAGAAGAATGTCAGGGTCGTTCACAGTTTACGGAATCTGATCGAGCTCTTCAATGCGTGGATGGAGAAAGCACACCATTCAATTTCTTCCCTGGAGGGACACCTCTAGACTATTCTCTGGAAGTCCGCACATTCGAATTCTTCCCTGCAGAAGCCCTCTCCTCGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGACGTTGATCTCACTCTCTGAGAGGACGTCAGAAGGTGACCATTCCGTACACAAAGTATCAGTTGTTAATATGTTGGAAGGAACGAGTTTACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAAACCCAGAAGTCAATAGTTCGATGTATTCCAACTATTGACTATTGGTTCAGATGTATATTCCCG

mRNA

>Mapoly0144s0031.1
ATGGGGAGAAGAGCGGGAGGACGGAAGTGTGCAAGGGTTCAGGGACCGTACAAGGGCGTCACTTTTTACAAGCGCACGGGTAAATGGGAAGCTAACCTTTGGTTTGAGAATCAGCAGCACTATCTAGGTGCCTCGTTTTCTGCTCTCGAAGCTGCTAGAGCATACGACAAGGGTATTTTGTTTACTCGGTCTTCCACGGAGCAACTAAACTTCGATCGGAGTAACTACAAGGAAGATATCCAGAAGATGAGAGGGATGAGCTTTCTGGCTTACAGACAGTTCTTGCGTGACACGAGTAAGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTAAGAGCATACAATGAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCAAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGTTGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCCTCTGTAAACGTTCCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGGTACACATCGAGGTACGATCCTATCATCGAATGGTAGCAAGGGACTGCTTCAGATGAATGATGCAGCAGCTGGTCCTTCAAACATACCAGAAGAAATAGATCCTCCGAATCCTTCAAATCCTGCTCCACATAAGGATGCACATCCTTCAAATCCTGATCCATGTGAGGATGCACATCGAGATGAGATGGGGTCTTTTAGCAGAAGCAGTGGAATGCTCCAGGAGAACCATTTACATAGCTCGAGACCAAATGACTTCGAACAAAGTCAGCATCATGAGGATGGACGCTCCTGTACAGTCCACAGTGATGCGGTACTCCTGAACGTCTGTAGGATGCAAAATATTTGGGGTGGTTCGGTACTCATGAACATCTATAGGATGCAAACTGAAGGGGGTGATCCGGTAATCCTGAGCTTCCTGCAACATGAAGGGTACAATCATCTCCAAATACAAGAAGAATGTCAGGGTCGTTCACAGTTTACGGAATCTGATCGAGCTCTTCAATGCGTGGATGGAGAAAGCACACCATTCAATTTCTTCCCTGGAGGGACACCTCTAGACTATTCTCTGGAAGTCCGCACATTCGAATTCTTCCCTGCAGAAGCCCTCTCCTCGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGACGTTGATCTCACTCTCTGAGAGGACGTCAGAAGGTGACCATTCCGTACACAAAGTATCAGTTGTTAATATGTTGGAAGGAACGAGTTTACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAAACCCAGAAGTCAATAGTTCGATGTATTCCAACTATTGACTATTGGTTCAGATGTATATTCCCG

CDS

>Mapoly0144s0031.1
ATGGGGAGAAGAGCGGGAGGACGGAAGTGTGCAAGGGTTCAGGGACCGTACAAGGGCGTCACTTTTTACAAGCGCACGGGTAAATGGGAAGCTAACCTTTGGTTTGAGAATCAGCAGCACTATCTAGGTGCCTCGTTTTCTGCTCTCGAAGCTGCTAGAGCATACGACAAGGGTATTTTGTTTACTCGGTCTTCCACGGAGCAACTAAACTTCGATCGGAGTAACTACAAGGAAGATATCCAGAAGATGAGAGGGATGAGCTTTCTGGCTTACAGACAGTTCTTGCGTGACACGAGTAAGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTAAGAGCATACAATGAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCAAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGTTGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCCTCTGTAAACGTTCCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGGTACACATCGAGGTACGATCCTATCATCGAATGGTAGCAAGGGACTGCTTCAGATGAATGATGCAGCAGCTGGTCCTTCAAACATACCAGAAGAAATAGATCCTCCGAATCCTTCAAATCCTGCTCCACATAAGGATGCACATCCTTCAAATCCTGATCCATGTGAGGATGCACATCGAGATGAGATGGGGTCTTTTAGCAGAAGCAGTGGAATGCTCCAGGAGAACCATTTACATAGCTCGAGACCAAATGACTTCGAACAAAGTCAGCATCATGAGGATGGACGCTCCTGTACAGTCCACAGTGATGCGGTACTCCTGAACGTCTGTAGGATGCAAAATATTTGGGGTGGTTCGGTACTCATGAACATCTATAGGATGCAAACTGAAGGGGGTGATCCGGTAATCCTGAGCTTCCTGCAACATGAAGGGTACAATCATCTCCAAATACAAGAAGAATGTCAGGGTCGTTCACAGTTTACGGAATCTGATCGAGCTCTTCAATGCGTGGATGGAGAAAGCACACCATTCAATTTCTTCCCTGGAGGGACACCTCTAGACTATTCTCTGGAAGTCCGCACATTCGAATTCTTCCCTGCAGAAGCCCTCTCCTCGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGACGTTGATCTCACTCTCTGA

Protein

>Mapoly0144s0031.1
MGRRAGGRKCARVQGPYKGVTFYKRTGKWEANLWFENQQHYLGASFSALEAARAYDKGILFTRSSTEQLNFDRSNYKEDIQKMRGMSFLAYRQFLRDTSKKADCILMCKSSKGILIDANGKWEVKYCSKNHQHKSQYTLVGWFDTEEEAVRAYNETALQHGDERAIVRSFFKKKTGYARVASPTRDDSGTTIENTERTLTLAHPASNNSHSSKEEVTSASHPRASCWERATDASKRVASGSMEACARDDKNDDTEMHDASVNVPVLPQQTDGSSLSDPDELEGTHRGTILSSNGSKGLLQMNDAAAGPSNIPEEIDPPNPSNPAPHKDAHPSNPDPCEDAHRDEMGSFSRSSGMLQENHLHSSRPNDFEQSQHHEDGRSCTVHSDAVLLNVCRMQNIWGGSVLMNIYRMQTEGGDPVILSFLQHEGYNHLQIQEECQGRSQFTESDRALQCVDGESTPFNFFPGGTPLDYSLEVRTFEFFPAEALSSDNQDVSGLTHLKREGPFDVDLTL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>