Mapoly0144s0032



Description

(UnKnown)

Reference DB

Database ID Description

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2L5 transcription factor, AP2/ERF Mapoly0144s0032.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0144s0032.1 scaffold_144:418906..420935  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0144s0032.1  

Gene structure:

mRNA scaffold_144:418906..420935  ( - strand )
three_prime_UTR scaffold_144:418906..419077  ( - strand )
CDS scaffold_144:419078..419485  ( - strand )
CDS scaffold_144:419662..420260  ( - strand )
CDS scaffold_144:420398..420471  ( - strand )
CDS scaffold_144:420600..420644  ( - strand )
CDS scaffold_144:420786..420874  ( - strand )
five_prime_UTR scaffold_144:420875..420935  ( - strand )

Sequences:

Gene

>Mapoly0144s0032.1
GAGCTTTCTGGCTTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAGTAAGTCAACCGTGTGATTTGTCCATCGACTTCCAGAGTTCCGATGATATACTTTGAATCGATTTCAGCTACCTTTGAAATTCATGCTCAGCAGCATCTGCATTACTGATGCTCTCCTCTAAATCAATTTCATATTTTCAGATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTAAGGTAAGAATCGTGATTCCGTGATCGCAAATAATTTCATTTTATGTGGACAGTCTAGACAGGGCTGGTGCACAATTACTGAGGGAATGAATATTTATTGACCGAATTTCCATCCTGTAATTCGGCTGCAGAGCATACAATGAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGTAAGTGAATCAAGTACTTTATCATGATATGAAGGTTGATTATATATTCCCATAGTTCCTATTCTGTGACTGCAGTCCGTATACTTGATACAATCATGATCAGATTTATTTTTTAACTAGCGATTTTCACCCTACAGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTCCCTTTAGCCCATCCAGCGTCCAACAATTCCCAATCTTCAAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCCTCTGTAAACGTTCCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGGTACACATCGAGGTACGATCCTATCATCGAATGGTAGCAAGGGACTGCTTCAGATGAATGATGCAGCAGCTGGTCCTTCAAACATACCAGAAGAAATAGATCCTCCGAATCCTTCAAATCCTGCTCCACATAAGGATGCACATCCTTCAAATCCTGATCCATGTGAGGATGCACATCGAGATGAGATGGGGTCTTTTGGCAGAAGCAGTGGAATGCTCCAGGAGAACCATTTACATAGCTCGAGACCAAATGACTTCGAACAAAGTCAGCATCATGAGGTAATGATTCTTACTTCCTTATGTTGGTCCTGACATATTTTGTGCATCACAATAATTTCCACCGGAAAAAGTAGAACTTTCAGTAGATATAATATACCTCTGAAGAATGCATGTGAGTCTATGCATGACATTCCCAAGTTTGAAACATATTGATTTATATTTTGTTTTGTTTCCAGGATGGACGCTCCTGTACAGTCCACAGTGATGCGGTACTCCTGAACGACTGTAGGATGCAAAACATTTGGGGTGGTTCGGTACTCATGAACATCTATAGGATGCAAACTGAAGGGGGTGATCCGGTAATCCTGAGCTTCCTGCAACATGAAGGGTACAATCATCTCCAAATACAAGAAGAATGTCAGGGTCGTTCACAGATTACGGAATCTGATCGAGCTCTTCAATGCGTGGATGGAGAAAGCACACCATTCAATTTCTTCCCTGGAGGGACACCTCTAGACTATTCTCTGGAAGTCCGCACATTCGAATTCTTCCCTGCAGAGGCCCTCTCCTCGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGACGTTGATCTCACTCTCTGAGAGGACGTCAGAAGGTGACCATTCCGTACACAAAGTATCAGTTGTTAATATGTTGGAAGGAACGAGTTTACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAAAACCAGAAGTCAATAGTTCGATGTATTCCAACTATTGACTATTGGTTCAGATGTATATTCCCGC

mRNA

>Mapoly0144s0032.1
GAGCTTTCTGGCTTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTAAGAGCATACAATGAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTCCCTTTAGCCCATCCAGCGTCCAACAATTCCCAATCTTCAAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCCTCTGTAAACGTTCCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGGTACACATCGAGGTACGATCCTATCATCGAATGGTAGCAAGGGACTGCTTCAGATGAATGATGCAGCAGCTGGTCCTTCAAACATACCAGAAGAAATAGATCCTCCGAATCCTTCAAATCCTGCTCCACATAAGGATGCACATCCTTCAAATCCTGATCCATGTGAGGATGCACATCGAGATGAGATGGGGTCTTTTGGCAGAAGCAGTGGAATGCTCCAGGAGAACCATTTACATAGCTCGAGACCAAATGACTTCGAACAAAGTCAGCATCATGAGGATGGACGCTCCTGTACAGTCCACAGTGATGCGGTACTCCTGAACGACTGTAGGATGCAAAACATTTGGGGTGGTTCGGTACTCATGAACATCTATAGGATGCAAACTGAAGGGGGTGATCCGGTAATCCTGAGCTTCCTGCAACATGAAGGGTACAATCATCTCCAAATACAAGAAGAATGTCAGGGTCGTTCACAGATTACGGAATCTGATCGAGCTCTTCAATGCGTGGATGGAGAAAGCACACCATTCAATTTCTTCCCTGGAGGGACACCTCTAGACTATTCTCTGGAAGTCCGCACATTCGAATTCTTCCCTGCAGAGGCCCTCTCCTCGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGACGTTGATCTCACTCTCTGAGAGGACGTCAGAAGGTGACCATTCCGTACACAAAGTATCAGTTGTTAATATGTTGGAAGGAACGAGTTTACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAAAACCAGAAGTCAATAGTTCGATGTATTCCAACTATTGACTATTGGTTCAGATGTATATTCCCGC

CDS

>Mapoly0144s0032.1
ATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTAAGAGCATACAATGAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTCCCTTTAGCCCATCCAGCGTCCAACAATTCCCAATCTTCAAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCCTCTGTAAACGTTCCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGGTACACATCGAGGTACGATCCTATCATCGAATGGTAGCAAGGGACTGCTTCAGATGAATGATGCAGCAGCTGGTCCTTCAAACATACCAGAAGAAATAGATCCTCCGAATCCTTCAAATCCTGCTCCACATAAGGATGCACATCCTTCAAATCCTGATCCATGTGAGGATGCACATCGAGATGAGATGGGGTCTTTTGGCAGAAGCAGTGGAATGCTCCAGGAGAACCATTTACATAGCTCGAGACCAAATGACTTCGAACAAAGTCAGCATCATGAGGATGGACGCTCCTGTACAGTCCACAGTGATGCGGTACTCCTGAACGACTGTAGGATGCAAAACATTTGGGGTGGTTCGGTACTCATGAACATCTATAGGATGCAAACTGAAGGGGGTGATCCGGTAATCCTGAGCTTCCTGCAACATGAAGGGTACAATCATCTCCAAATACAAGAAGAATGTCAGGGTCGTTCACAGATTACGGAATCTGATCGAGCTCTTCAATGCGTGGATGGAGAAAGCACACCATTCAATTTCTTCCCTGGAGGGACACCTCTAGACTATTCTCTGGAAGTCCGCACATTCGAATTCTTCCCTGCAGAGGCCCTCTCCTCGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGACGTTGATCTCACTCTCTGA

Protein

>Mapoly0144s0032.1
MCKSSKGILIDANGKWEVKYCSKNHQHKSQYTLVGWFDTEEEAVRAYNETALQHGDERAIVRSFFKKKTGYARVASPTRDDSGTTIENTERTFPLAHPASNNSQSSKEEVTSASHPRASCWERATDASKRDASGSMEACARDDKNDDTEMHDASVNVPVLPQQTDGSSLSDPDELEGTHRGTILSSNGSKGLLQMNDAAAGPSNIPEEIDPPNPSNPAPHKDAHPSNPDPCEDAHRDEMGSFGRSSGMLQENHLHSSRPNDFEQSQHHEDGRSCTVHSDAVLLNDCRMQNIWGGSVLMNIYRMQTEGGDPVILSFLQHEGYNHLQIQEECQGRSQITESDRALQCVDGESTPFNFFPGGTPLDYSLEVRTFEFFPAEALSSDNQDVSGLTHLKREGPFDVDLTL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>