Mapoly0144s0033



Description

(UnKnown)

Reference DB

Database ID Description
OrthoMCL OG5_153389

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2L6 transcription factor, AP2/ERF Mapoly0144s0033.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0144s0033.1 scaffold_144:426847..428290  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0144s0033.1  

Gene structure:

mRNA scaffold_144:426847..428290  ( - strand )
three_prime_UTR scaffold_144:426847..427056  ( - strand )
CDS scaffold_144:427057..427604  ( - strand )
CDS scaffold_144:427742..427815  ( - strand )
CDS scaffold_144:427944..427988  ( - strand )
CDS scaffold_144:428130..428290  ( - strand )

Sequences:

Gene

>Mapoly0144s0033.1
ATGAGAGGGATGAGCTTTCTGGATTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCTAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAGTAAGTCAACCGTGTGATTTGTCCATCGACTTCCAGAGTTCCGATGATATACTTTGAATCGAATTCAGCTACCTTTGAAATTCATGCTCAGCAGCATGTGCATTACTGATGCTCTCCACTAAATCAATTGCATATGTTCAGATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCTGTAAGGTAAGAATCGTGATTCCGTGATAGCAAATAATTTCATTTTATGTGGACAGTCAAGAGAGGGCTGGTGCACAATTACTGAGCGAATGAATATTTATTGACCGGATTTCCATCCTGTAATTCGGCTGCAGAGCATACAATAAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGTAAGTGAATCAAGTACTTTATCATCATATGAAGGTTCATTATATATTCCCATAGTTGCTATTCTGTGACTGCAGTCTGTATAATTGATACAATCATGATCAGATTTATTTTTTAACTAGCGATTTTCACCCTACAGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCGAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTCAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCTTCTGTAAACGTTTCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGATGCACATCTCCAAATGCAAGAAGAATGTCAGGGTCGTTCACAGTTCACGGATGCTGAAATCAAATTATTCAATCTCTTCCCTGGAGGCACACCTCTGGATTATTCTCTGGAAGTCCCCACATTCGATTTCTTCCCTGCAGAGCCCCTCTCCACGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGAAATTGATCTCACTCTCTGAGAGGACTTCAGAAGATGACCATTCGATACACAAAGTATCAGTTGTTATTATCTTGGAAGGAACGAGTTCACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAACCACGGTATAATAATTTAGTTTAGTTTATAATAGTTTAGTTTAGTTTATAATTTAGTACCAATTACTTTTTTAAAAATAAACATTTGTGTAAAAAATAATTT

mRNA

>Mapoly0144s0033.1
ATGAGAGGGATGAGCTTTCTGGATTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCTAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCTGTAAGAGCATACAATAAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCGAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTCAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCTTCTGTAAACGTTTCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGATGCACATCTCCAAATGCAAGAAGAATGTCAGGGTCGTTCACAGTTCACGGATGCTGAAATCAAATTATTCAATCTCTTCCCTGGAGGCACACCTCTGGATTATTCTCTGGAAGTCCCCACATTCGATTTCTTCCCTGCAGAGCCCCTCTCCACGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGAAATTGATCTCACTCTCTGAGAGGACTTCAGAAGATGACCATTCGATACACAAAGTATCAGTTGTTATTATCTTGGAAGGAACGAGTTCACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAACCACGGTATAATAATTTAGTTTAGTTTATAATAGTTTAGTTTAGTTTATAATTTAGTACCAATTACTTTTTTAAAAATAAACATTTGTGTAAAAAATAATTT

CDS

>Mapoly0144s0033.1
ATGAGAGGGATGAGCTTTCTGGATTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCTAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCTGTAAGAGCATACAATAAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATGCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCGAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTCAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCTTCTGTAAACGTTTCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGATGCACATCTCCAAATGCAAGAAGAATGTCAGGGTCGTTCACAGTTCACGGATGCTGAAATCAAATTATTCAATCTCTTCCCTGGAGGCACACCTCTGGATTATTCTCTGGAAGTCCCCACATTCGATTTCTTCCCTGCAGAGCCCCTCTCCACGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGAAATTGATCTCACTCTCTGA

Protein

>Mapoly0144s0033.1
MRGMSFLDYRQFLRDTSRKADCILMCKSSKGILIDANGKWEVKYCSKNHQHKSQYTLVGWFDTEEEAVRAYNKTALQHGDERAIVRSFFKKKTGYARVASPTRDDSGTTIENTERTLTLAHPASNNSHSSKEEVTSASHPRASCWERATDASQRDASGSMEACARDDKNDDTEMHDASVNVSVLPQQTDGSSLSDPDELEDAHLQMQEECQGRSQFTDAEIKLFNLFPGGTPLDYSLEVPTFDFFPAEPLSTDNQDVSGLTHLKREGPFEIDLTL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>