Mapoly0150s0015



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_153161
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR31945 FAMILY NOT NAMED
PANTHER PTHR31945:SF4

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH16 transcription factor, bHLH Mapoly0150s0015.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0150s0015.1 scaffold_150:285562..290487  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0150s0015.1  

Gene structure:

mRNA scaffold_150:285562..290487  ( + strand )
five_prime_UTR scaffold_150:285562..286695  ( + strand )
CDS scaffold_150:286696..286763  ( + strand )
CDS scaffold_150:287092..287185  ( + strand )
CDS scaffold_150:287295..288734  ( + strand )
CDS scaffold_150:289061..289372  ( + strand )
CDS scaffold_150:289546..289716  ( + strand )
CDS scaffold_150:289966..290052  ( + strand )
three_prime_UTR scaffold_150:290053..290487  ( + strand )

Sequences:

Gene

>Mapoly0150s0015.1
CCTCACTACCGAAACATACATGGAGGTTTCGTCCTCTCAGGTCGCTCTCATCAGCCCCCGATGAGGTGAGGTGCCTGTGCTCTTGTGTCGCCACCTGAGGAAGGGAGCAAGAGCTTCCTCCCTCCCTCCCTACCTCCCCCTCGCCCCCTTCCATGCTGCCCGTTCCCATACATCACCGCAAAAGCGCTAAAGTGCGCGATCATAGCAGCCCTCTGCTCTGCTCCTCTATTAAAGTTCAACCCAGGCGAGAAGATGACCAGAGCAAAGAAAAAGCAGCAGTGACCGGGTTAGGAATCAGCTCCGAGGCCAGCTAGATACCCCGAATTGTAGCATCTGGCCTGATACGATGATGCGCTTTTCCTCCTCCACCAACAACACCCCGGTCTTGACTTCATCCGACTTGTGATACGATCTCCCTCTTGGCACCGATATCCCCCCAGCCCAACAGAAGCATCACCCGCAGCGGCAATAGTAGTAGTAGTAGTAGAAGCAGCAGCAGCAGCAGCACAAGGCAGGCAGGCACGCAGGCAGGCAGGCAGCAAGCGAGCGTCCCATCCCTTTGCTCTTCCTGGGACTCCCTCCCTATCCCTTTCCTACACCTTCTCCTCGTCATCAACCATCCATCTCTCGGCATCGACTCCGACATTTCGCTGGAGGGGTTTTGGAGCGACTCTCCAATTTGGCCGATTCATGAGTGTGCAAAGGGTGGATGCTCGGAATACATCTGGAAAGGGAACAGGTCACAAGGAAGGACAGGAAGAGAGGGAGGAAGTTAGAAAGGAAGGAAGAAGCGGGACGGACTCTCGATGCCCAGACTGTCGTCTGCTCCTCGTCTGACGGCGTGGGTTGGTTTCGGTGATCGGATTGGAGATTGATCCGGGACGCGGAGGAGGAGACAGCACCATGACGAACCTGGGATTTTCCAGCTTTCAGGAGCAAGTCAACATGTGGAAACCCAAGCAGCAATCGTCCAACACTTCGTTCCAGCTTTCGCTGCGAGGTGGAAGCATGTGGATCTAGCAACCATGTCGGCGTACAACAGCAGCAAGAGCAGCAGCGGCAGCGGCAGCATCTTCTTCGACATCTTCTTCTTCTTCCTGGACCATTCCTGATTCTGTCCCCGAGTCGACCACAATGATGACTTCTACAACCAGACCGGCTCCTGGCGGAGTGTGGATGGCTGGCAACTCTCCTGATTTGAGGTTCGTCCGCAGATAGATTCTAATTCCTGTGCGCCTCCATTTGGTTCCGTGTGATGATGACCCGCTCATGTTGAAAAAGAACGGCCCCGACCCTCCCCTCCCCTCCCCTCCCCTTGCCAATGATGGAAAGCTCGTCGTTCCATCCGTCCGAGAGGGCGAGGGCCATAAAACCTAGTCAAAAGTGTGACACCCCTCCAAGATTCTGATTGATGAACTTTTCTGGATCTACAGCTGGACTCCTGCAGCGTCCAAAAGTGTCCAAAAATAACAGCCCTCTCTCAACTTGAACTCGTCTTCTTGCTGTCCTGATCATGATTCCGGCCCGCAGACTCGCATCCTGTATTCCGGGCATCGAGAACGATCTGAGATGGAGGCCCACAAACTGCCAGAGCCCGAGCTCGAACGATCCGACCGCCATGAAGGTACGGACTTTCTCACCTCGTCCGAATGCGGATAGGTCCAAAAAGATTCCAGCCCGTGTCGGAAGATTTGCATTTTGTCTCACATGGCGGCTTCTGGGTTGCGTTGCAGGACGATCTTCCTTCAAGCTCGGGCTTTTCGGCCAAGGGAATGCTGGACGATGAATCGTGGTACATGGGGCCCGAGAGCACGCTCTTGGATGAGATGAAGGAGCTCGTCGGCTCTCAACAGCAGCAGCAACATCAACACCAACACCATCACCAGCACCAGCATCAGCAGCAGGATAATATGTCGTCGGCGCATTTCAACACCTTGGACGCGCCGCATTTGCACGGCCTCTTCAACCGCAGCAATGTCAACAGATCTTTCGGCGGATTATCGTCGTTCCTGGACACCGGGATGCAATACGATGGAGGGATGAGCAGCATCCACTGCCAGGGAGGAGGAGGACCAGCAGGAGCAGCGGGAATGGGTGGGAATTTCCTGCAGCATCAACATCAACCCCAGGCCGATGGTCAAAGCGCCGTCGGCGGCAGCAGCAGCTCGGGGGTCATTGCGATGCCGAGTCTGGGGCCGAATGTGCACAGCGGGAATGTGCGCGGTGCGCTGCTGAGCAATTTGAGTCCGCGAGGTGGGCTGCAGGTGGAGGGCGGCGGCGGCGGTGGTGCTGCGTTCGGGCACCAAGGCGCAAACTTGAATAAATTGCTCAGCACCTGCAGTTTCACGAACGCCGTGGGAGGGTTCAACAATCATCATGCTCATGCGCATCACAGCGCCCATCATGGACTTGGCGCCGCCGGCATGGGCAGCGGTGGATTCGGCGACACCTATAACAACTCTTTGAGTAGAAATCTCATGGCCAAGGACAATCATTCCTTGCAGATGCTGAACGTCGAGCGCCCTCCGTACCTGTCCAAGCACCTGCTTTGCTCGAGCTCCAGCGCGCAGAAAGTCGCTCCTTGCAGCACCACCAGCACCAGCTCGCAGCAGCACAAGAGGGGAGGAACATTGCGGCACGCGGTGTCCGGGGGCCCAATTTCGCCCGCCCCCGTCGACAAGGCGTCGCTGCGAGTGATCACCTCGGCCTCCAATGACTCGTCCGTCAACATGCCCGGCGACGATCGCTCGAACGCGGGGGGCAAGCCGGACAAGGCTATGGTGGTCAACATGTGCGGCCCGGCCCCGGCCCCAGCCCCAGCCCCGTCGTCGGCAGGCGCCAAGGACGATGCCAAGGCCAAGCTCGGCTCGGATGACGGAGGGGCGACCGCAGGCGACACCGATATGGCGGATACGGAGCCTCGATTGGATCAAGACGAGGCGAAGGATGATGACGATATAGAGGAAAGCGGCTATGGCTCGGGGCTATACGAGGCCGACGACATGAATGGCATGGACGGTCAAGGCCCAGGCACGGCTCTGAGCTTGCATGGGGAGAAGGGCAAGGGCAAAAAGGGCCTGCCAGCTAAAAATCTCATGGCCGAGCGCAGGCGTCGCAAGAAACTCAACGATCGTCTCTACATGCTGCGCTCCGTGGTACCGAAGATCACCAAGGTGCGAGCACGGACGTCAATCCGCACCCACACCGCAACGCAGCCCAGCGCGCATGCCATGTCCGGGCCGGATTGGATTGGATTGGGTCAATGGGGTGGAACGGACATGGCATGGCGGTGCGCGAGGAGTTCAGTTGTGTAGTGAGTCAGTCAGTCATTCATTCATTCGTGTACTTTTTCTGAAGAGCGAGCTACGTTCCCGAGCTCGCTACATGTACATGTAGCTAGATCGATCGTCGAGCCGCAATCTGCCACTAGATTGCAGGCTGCGTCAGCGGCTGCTCAAGGCCTACGACTGACTAGAGGCTTTTGTTGGAACCTGTGCAGATGGACAGAGCTTCAATACTCGGAGATGCGATCGAGTACTTGAAGGAGCTTCTAGACCGCATCAATGATCTGCACAATGAGCTAGGCTCGACCACTCCCCTGGACCGACCACCTATCCAGCAGCAGCAGCAGCAAAATAACCACAACAATAACAACAGCAGCAACAACAACAACAACGTCGTTAACAGCGCTGCCCTGCAAGCCGCCATGCCGCAACCGAGCTCGTCTACGTTGACAACATGCCGAGTGAAAGAGGAGCTGCCATCGTCAATTCCGAGTCCTGATTCGCAGCAGCAACCGCAAACGCTAAGGGTGAGTCCCCTTCAGTCGCAGTGTAGGGCCACAGCGCGCGGTTTCATTTAAATAGTTGGACCGCATCTCGTCGTGAACGCTGAATTATAAGATCAAGCAGACCAAAAAGCGCAGCATTCTATCCAGAAAATATGGAGGCATACTGAATGGCAAAGGTGTCCTTCCTTTTGCAGGTGGACGTGAACATGGGCGAGAGGAGAGGCCTCAACATTCACATGTTCTGTTCGAGAAGACCGGGGCTCTTGCTGTCCACCATGCGTGCTCTGGACGGGCTGGGGCTGGAAGTGCAGCAGGCTGTCGTTTCATGCTTCAACGGCTTTGCTCTCGATGTGTTCCGTGCTGAGGTAATACAGTTTTCAGGTCTTAGACCTCATGCTGTGTAGGGTAGCACAATACTTCGTGGGCAACGAGAACAGCTTTGAGCATTCAGTCCGGCATTTGAAAAGATATGTTCTGATACTGAACTGCTGCCGATCAGTGAGAGTGTTGCAATTAGTAGTGTAGAGTCTGACCCATTTTGTTCGTTGATATGTCGTGGTTATATATCGAGTCGGCCCGGGGAGCTTACAGTGCATGGGTTTGTTTGTTGGCAGCAATTGCAAGACAATGAAATCGGCTCGGAGGAAGTACGATCGGTGCTGCTCCATGTGGCAGGGGCTAACGTCAGTGCCCTTCAGTGATCCGAAGATGAGGCCGAAAAAGAGAACGCATAATCCTTGGATACTGGGACTAGTGTAAATAGAATGGAGTTTTTCTGTACTCTATTGATTTTAGTCCGGGGTGAGTGGGAAGAAGAGGTCGTAGCTGAGCAATCCACCCGGCCAGCCAGCCAGCCAGATCTGTGACCGGGCAATGTCTACCTAAATTTCTAATCTCGGGAGCTAGATCAGATCGCTTACTCAGTGTTAGTCTGACAGCCTGCCCCACGGTCATTCGAATTGAACGCGAGGAAGGAACAGGCCCTTCGATGATTATTTCTTGTTGCCCGATCAGTCAGTGTAATGGACCCTCATTCCATCCCTGAGCTTTTCTATCCGAATTCCCCATGGTACTCATTTGTGTATACTATTAAATAACCGAGACTCGTGGAATGCAGTCTCCCAACTTTTAAGGCC

mRNA

>Mapoly0150s0015.1
CCTCACTACCGAAACATACATGGAGGTTTCGTCCTCTCAGGTCGCTCTCATCAGCCCCCGATGAGGTGAGGTGCCTGTGCTCTTGTGTCGCCACCTGAGGAAGGGAGCAAGAGCTTCCTCCCTCCCTCCCTACCTCCCCCTCGCCCCCTTCCATGCTGCCCGTTCCCATACATCACCGCAAAAGCGCTAAAGTGCGCGATCATAGCAGCCCTCTGCTCTGCTCCTCTATTAAAGTTCAACCCAGGCGAGAAGATGACCAGAGCAAAGAAAAAGCAGCAGTGACCGGGTTAGGAATCAGCTCCGAGGCCAGCTAGATACCCCGAATTGTAGCATCTGGCCTGATACGATGATGCGCTTTTCCTCCTCCACCAACAACACCCCGGTCTTGACTTCATCCGACTTGTGATACGATCTCCCTCTTGGCACCGATATCCCCCCAGCCCAACAGAAGCATCACCCGCAGCGGCAATAGTAGTAGTAGTAGTAGAAGCAGCAGCAGCAGCAGCACAAGGCAGGCAGGCACGCAGGCAGGCAGGCAGCAAGCGAGCGTCCCATCCCTTTGCTCTTCCTGGGACTCCCTCCCTATCCCTTTCCTACACCTTCTCCTCGTCATCAACCATCCATCTCTCGGCATCGACTCCGACATTTCGCTGGAGGGGTTTTGGAGCGACTCTCCAATTTGGCCGATTCATGAGTGTGCAAAGGGTGGATGCTCGGAATACATCTGGAAAGGGAACAGGTCACAAGGAAGGACAGGAAGAGAGGGAGGAAGTTAGAAAGGAAGGAAGAAGCGGGACGGACTCTCGATGCCCAGACTGTCGTCTGCTCCTCGTCTGACGGCGTGGGTTGGTTTCGGTGATCGGATTGGAGATTGATCCGGGACGCGGAGGAGGAGACAGCACCATGACGAACCTGGGATTTTCCAGCTTTCAGGAGCAAGTCAACATGTGGAAACCCAAGCAGCAATCGTCCAACACTTCGTTCCAGCTTTCGCTGCGAGGTGGAAGCATGTGGATCTAGCAACCATGTCGGCGTACAACAGCAGCAAGAGCAGCAGCGGCAGCGGCAGCATCTTCTTCGACATCTTCTTCTTCTTCCTGGACCATTCCTGATTCTGTCCCCGAGTCGACCACAATGATGACTTCTACAACCAGACCGGCTCCTGGCGGAGTGTGGATGGCTGGCAACTCTCCTGATTTGAGACTCGCATCCTGTATTCCGGGCATCGAGAACGATCTGAGATGGAGGCCCACAAACTGCCAGAGCCCGAGCTCGAACGATCCGACCGCCATGAAGGACGATCTTCCTTCAAGCTCGGGCTTTTCGGCCAAGGGAATGCTGGACGATGAATCGTGGTACATGGGGCCCGAGAGCACGCTCTTGGATGAGATGAAGGAGCTCGTCGGCTCTCAACAGCAGCAGCAACATCAACACCAACACCATCACCAGCACCAGCATCAGCAGCAGGATAATATGTCGTCGGCGCATTTCAACACCTTGGACGCGCCGCATTTGCACGGCCTCTTCAACCGCAGCAATGTCAACAGATCTTTCGGCGGATTATCGTCGTTCCTGGACACCGGGATGCAATACGATGGAGGGATGAGCAGCATCCACTGCCAGGGAGGAGGAGGACCAGCAGGAGCAGCGGGAATGGGTGGGAATTTCCTGCAGCATCAACATCAACCCCAGGCCGATGGTCAAAGCGCCGTCGGCGGCAGCAGCAGCTCGGGGGTCATTGCGATGCCGAGTCTGGGGCCGAATGTGCACAGCGGGAATGTGCGCGGTGCGCTGCTGAGCAATTTGAGTCCGCGAGGTGGGCTGCAGGTGGAGGGCGGCGGCGGCGGTGGTGCTGCGTTCGGGCACCAAGGCGCAAACTTGAATAAATTGCTCAGCACCTGCAGTTTCACGAACGCCGTGGGAGGGTTCAACAATCATCATGCTCATGCGCATCACAGCGCCCATCATGGACTTGGCGCCGCCGGCATGGGCAGCGGTGGATTCGGCGACACCTATAACAACTCTTTGAGTAGAAATCTCATGGCCAAGGACAATCATTCCTTGCAGATGCTGAACGTCGAGCGCCCTCCGTACCTGTCCAAGCACCTGCTTTGCTCGAGCTCCAGCGCGCAGAAAGTCGCTCCTTGCAGCACCACCAGCACCAGCTCGCAGCAGCACAAGAGGGGAGGAACATTGCGGCACGCGGTGTCCGGGGGCCCAATTTCGCCCGCCCCCGTCGACAAGGCGTCGCTGCGAGTGATCACCTCGGCCTCCAATGACTCGTCCGTCAACATGCCCGGCGACGATCGCTCGAACGCGGGGGGCAAGCCGGACAAGGCTATGGTGGTCAACATGTGCGGCCCGGCCCCGGCCCCAGCCCCAGCCCCGTCGTCGGCAGGCGCCAAGGACGATGCCAAGGCCAAGCTCGGCTCGGATGACGGAGGGGCGACCGCAGGCGACACCGATATGGCGGATACGGAGCCTCGATTGGATCAAGACGAGGCGAAGGATGATGACGATATAGAGGAAAGCGGCTATGGCTCGGGGCTATACGAGGCCGACGACATGAATGGCATGGACGGTCAAGGCCCAGGCACGGCTCTGAGCTTGCATGGGGAGAAGGGCAAGGGCAAAAAGGGCCTGCCAGCTAAAAATCTCATGGCCGAGCGCAGGCGTCGCAAGAAACTCAACGATCGTCTCTACATGCTGCGCTCCGTGGTACCGAAGATCACCAAGATGGACAGAGCTTCAATACTCGGAGATGCGATCGAGTACTTGAAGGAGCTTCTAGACCGCATCAATGATCTGCACAATGAGCTAGGCTCGACCACTCCCCTGGACCGACCACCTATCCAGCAGCAGCAGCAGCAAAATAACCACAACAATAACAACAGCAGCAACAACAACAACAACGTCGTTAACAGCGCTGCCCTGCAAGCCGCCATGCCGCAACCGAGCTCGTCTACGTTGACAACATGCCGAGTGAAAGAGGAGCTGCCATCGTCAATTCCGAGTCCTGATTCGCAGCAGCAACCGCAAACGCTAAGGGTGGACGTGAACATGGGCGAGAGGAGAGGCCTCAACATTCACATGTTCTGTTCGAGAAGACCGGGGCTCTTGCTGTCCACCATGCGTGCTCTGGACGGGCTGGGGCTGGAAGTGCAGCAGGCTGTCGTTTCATGCTTCAACGGCTTTGCTCTCGATGTGTTCCGTGCTGAGCAATTGCAAGACAATGAAATCGGCTCGGAGGAAGTACGATCGGTGCTGCTCCATGTGGCAGGGGCTAACGTCAGTGCCCTTCAGTGATCCGAAGATGAGGCCGAAAAAGAGAACGCATAATCCTTGGATACTGGGACTAGTGTAAATAGAATGGAGTTTTTCTGTACTCTATTGATTTTAGTCCGGGGTGAGTGGGAAGAAGAGGTCGTAGCTGAGCAATCCACCCGGCCAGCCAGCCAGCCAGATCTGTGACCGGGCAATGTCTACCTAAATTTCTAATCTCGGGAGCTAGATCAGATCGCTTACTCAGTGTTAGTCTGACAGCCTGCCCCACGGTCATTCGAATTGAACGCGAGGAAGGAACAGGCCCTTCGATGATTATTTCTTGTTGCCCGATCAGTCAGTGTAATGGACCCTCATTCCATCCCTGAGCTTTTCTATCCGAATTCCCCATGGTACTCATTTGTGTATACTATTAAATAACCGAGACTCGTGGAATGCAGTCTCCCAACTTTTAAGGCC

CDS

>Mapoly0150s0015.1
ATGATGACTTCTACAACCAGACCGGCTCCTGGCGGAGTGTGGATGGCTGGCAACTCTCCTGATTTGAGACTCGCATCCTGTATTCCGGGCATCGAGAACGATCTGAGATGGAGGCCCACAAACTGCCAGAGCCCGAGCTCGAACGATCCGACCGCCATGAAGGACGATCTTCCTTCAAGCTCGGGCTTTTCGGCCAAGGGAATGCTGGACGATGAATCGTGGTACATGGGGCCCGAGAGCACGCTCTTGGATGAGATGAAGGAGCTCGTCGGCTCTCAACAGCAGCAGCAACATCAACACCAACACCATCACCAGCACCAGCATCAGCAGCAGGATAATATGTCGTCGGCGCATTTCAACACCTTGGACGCGCCGCATTTGCACGGCCTCTTCAACCGCAGCAATGTCAACAGATCTTTCGGCGGATTATCGTCGTTCCTGGACACCGGGATGCAATACGATGGAGGGATGAGCAGCATCCACTGCCAGGGAGGAGGAGGACCAGCAGGAGCAGCGGGAATGGGTGGGAATTTCCTGCAGCATCAACATCAACCCCAGGCCGATGGTCAAAGCGCCGTCGGCGGCAGCAGCAGCTCGGGGGTCATTGCGATGCCGAGTCTGGGGCCGAATGTGCACAGCGGGAATGTGCGCGGTGCGCTGCTGAGCAATTTGAGTCCGCGAGGTGGGCTGCAGGTGGAGGGCGGCGGCGGCGGTGGTGCTGCGTTCGGGCACCAAGGCGCAAACTTGAATAAATTGCTCAGCACCTGCAGTTTCACGAACGCCGTGGGAGGGTTCAACAATCATCATGCTCATGCGCATCACAGCGCCCATCATGGACTTGGCGCCGCCGGCATGGGCAGCGGTGGATTCGGCGACACCTATAACAACTCTTTGAGTAGAAATCTCATGGCCAAGGACAATCATTCCTTGCAGATGCTGAACGTCGAGCGCCCTCCGTACCTGTCCAAGCACCTGCTTTGCTCGAGCTCCAGCGCGCAGAAAGTCGCTCCTTGCAGCACCACCAGCACCAGCTCGCAGCAGCACAAGAGGGGAGGAACATTGCGGCACGCGGTGTCCGGGGGCCCAATTTCGCCCGCCCCCGTCGACAAGGCGTCGCTGCGAGTGATCACCTCGGCCTCCAATGACTCGTCCGTCAACATGCCCGGCGACGATCGCTCGAACGCGGGGGGCAAGCCGGACAAGGCTATGGTGGTCAACATGTGCGGCCCGGCCCCGGCCCCAGCCCCAGCCCCGTCGTCGGCAGGCGCCAAGGACGATGCCAAGGCCAAGCTCGGCTCGGATGACGGAGGGGCGACCGCAGGCGACACCGATATGGCGGATACGGAGCCTCGATTGGATCAAGACGAGGCGAAGGATGATGACGATATAGAGGAAAGCGGCTATGGCTCGGGGCTATACGAGGCCGACGACATGAATGGCATGGACGGTCAAGGCCCAGGCACGGCTCTGAGCTTGCATGGGGAGAAGGGCAAGGGCAAAAAGGGCCTGCCAGCTAAAAATCTCATGGCCGAGCGCAGGCGTCGCAAGAAACTCAACGATCGTCTCTACATGCTGCGCTCCGTGGTACCGAAGATCACCAAGATGGACAGAGCTTCAATACTCGGAGATGCGATCGAGTACTTGAAGGAGCTTCTAGACCGCATCAATGATCTGCACAATGAGCTAGGCTCGACCACTCCCCTGGACCGACCACCTATCCAGCAGCAGCAGCAGCAAAATAACCACAACAATAACAACAGCAGCAACAACAACAACAACGTCGTTAACAGCGCTGCCCTGCAAGCCGCCATGCCGCAACCGAGCTCGTCTACGTTGACAACATGCCGAGTGAAAGAGGAGCTGCCATCGTCAATTCCGAGTCCTGATTCGCAGCAGCAACCGCAAACGCTAAGGGTGGACGTGAACATGGGCGAGAGGAGAGGCCTCAACATTCACATGTTCTGTTCGAGAAGACCGGGGCTCTTGCTGTCCACCATGCGTGCTCTGGACGGGCTGGGGCTGGAAGTGCAGCAGGCTGTCGTTTCATGCTTCAACGGCTTTGCTCTCGATGTGTTCCGTGCTGAGCAATTGCAAGACAATGAAATCGGCTCGGAGGAAGTACGATCGGTGCTGCTCCATGTGGCAGGGGCTAACGTCAGTGCCCTTCAGTGA

Protein

>Mapoly0150s0015.1
MMTSTTRPAPGGVWMAGNSPDLRLASCIPGIENDLRWRPTNCQSPSSNDPTAMKDDLPSSSGFSAKGMLDDESWYMGPESTLLDEMKELVGSQQQQQHQHQHHHQHQHQQQDNMSSAHFNTLDAPHLHGLFNRSNVNRSFGGLSSFLDTGMQYDGGMSSIHCQGGGGPAGAAGMGGNFLQHQHQPQADGQSAVGGSSSSGVIAMPSLGPNVHSGNVRGALLSNLSPRGGLQVEGGGGGGAAFGHQGANLNKLLSTCSFTNAVGGFNNHHAHAHHSAHHGLGAAGMGSGGFGDTYNNSLSRNLMAKDNHSLQMLNVERPPYLSKHLLCSSSSAQKVAPCSTTSTSSQQHKRGGTLRHAVSGGPISPAPVDKASLRVITSASNDSSVNMPGDDRSNAGGKPDKAMVVNMCGPAPAPAPAPSSAGAKDDAKAKLGSDDGGATAGDTDMADTEPRLDQDEAKDDDDIEESGYGSGLYEADDMNGMDGQGPGTALSLHGEKGKGKKGLPAKNLMAERRRRKKLNDRLYMLRSVVPKITKMDRASILGDAIEYLKELLDRINDLHNELGSTTPLDRPPIQQQQQQNNHNNNNSSNNNNNVVNSAALQAAMPQPSSSTLTTCRVKEELPSSIPSPDSQQQPQTLRVDVNMGERRGLNIHMFCSRRPGLLLSTMRALDGLGLEVQQAVVSCFNGFALDVFRAEQLQDNEIGSEEVRSVLLHVAGANVSALQ

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>