Mapoly0150s0016



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_153161
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR31945 FAMILY NOT NAMED
PANTHER PTHR31945:SF4

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH17 transcription factor, bHLH Mapoly0150s0016.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0150s0016.1 scaffold_150:303565..309142  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0150s0016.1  

Gene structure:

mRNA scaffold_150:303565..309142  ( + strand )
five_prime_UTR scaffold_150:303565..304990  ( + strand )
CDS scaffold_150:304991..305052  ( + strand )
CDS scaffold_150:305683..305791  ( + strand )
CDS scaffold_150:306118..307533  ( + strand )
CDS scaffold_150:307937..308155  ( + strand )
CDS scaffold_150:308271..308444  ( + strand )
CDS scaffold_150:308599..308697  ( + strand )
three_prime_UTR scaffold_150:308698..309142  ( + strand )

Sequences:

Gene

>Mapoly0150s0016.1
GGAGGAGAGAGATAGAGATAGAGAGCGCGCGAGGCAGGCCTAGACTCTAGAGAGATCCTACATCGGCCAACATCACAAGGAAGCAGCAGAGGCATTGTGCAAGCAAGGGACGGATAGTCGCAGTCAGGAGTCAGAGCAAGCTCAGGAGGAGAGCTGTTCCAGTGCAGAGGAGGTCCTGTCCGCACCGGTAGAGAGAGGGAGAAGGAAGAGAGAGGGAGAGACGCGGTCAGACGGACAGACAGAGCCAGAGAGAGAGAGCAGCAGCAGCTGCTGCTGCTGCTACCGTCGTAGCTGCCTATGCCTATGCCCGCCCTGCACTCACTCACTCTGATGACTGACGGGATCATTACTTGCTTACTTACTTGTCGACTGGCGGCCCCTCCCCTCGCAAGTGCATGACGAGGTGAAACTAGACAGACCACGCCAGCGGTAAAATAGAACAAGATTTGGAATCCGTTTCCAATGCTCAATGCTGCTGCTGGCATTGAACCTGGAGAGTGACAAGCCAGAGCCAAATATCTGAGCATAGTGAGAGAGATAGATAGATAGAGAGATAGAGAGAGAGAGGGAGAGATAGATAGGACGGGGGACGAGAAGATGCAAAAATTAGTTGCAGCGGCAGCCACGTATGTCCGAGGTCATTTGAAGATTCCACTGAATGTCCACACTGAATGCCCGTCGACTCCAGCTTCGGCGTAACATGGCGCAGGGATCCGGTGGCTTTTCCTTGCGGGTAGTCGCTCATCGTCAAGCTCGACGACAGGAATGTAACGGGAAGGCTGAGGCGGAAGCGAGGAAGGCAGTGGCCGCGCTGGTCTGAGAGAGAGACGCAGTGAGGGGGTGGAGGGGAGGGGAGGGGAGCGAGGGCCGGGGAGGGGGAAGCGAGAGTACAATCTCGCGAGCTCGACAGTTAGCAAACAGTGCGACGGGAATAAGAGCACAGCTTCATTTATTGAGCACGGTGACCGTACGCAACAAGGTATTACCTACTCAAATGCGTGTCAGAAGGAGGGAACCTGAAAGCTCCTCGCAAATTGCTCAAGGCAGCAGTTCAGATAGAGACTTGATTCATCACGGAGGACCAGGCAATTGCAGCCCATCTCGATCAGTTCGTTCGGTTCGGAAGCGGCACAAGCTGTTGCCGAGAGTACTTCAACCCCTCGCCGTCTGGCTGCTGTTGCTGCTGCTGCCGCCGCTGCTTGGCTTGGCTTTCTCAGACAAGTACTCCTCTGATGACGAACGTCTCGGCCCCGCAACGCTGTTGGTGTGAGACGAAATCGTCGCAACAGAACCCACCTCGCTCGAAGCAACTTGCGCCCAGAGGCGGAGGCGGCAGTTGAGAGAGCGCCGTGGGCCAATGACAATGTGGACGCTGTGAGCATCCCTCGTCGACCGAAGGCGCTCACTCTCTCGGTGCTCGACCGCAATGGCTTCGACCAGAGTCAGCGGGGCCTCGGCCTGGATGGCTGGTAGCTCCTCGAATTTGAGGTACTCTATCTGCGCAGCTCCACGAGACCAAGAAACCGAGTCCGTCTCTAGGAATGCAACGCATGAATGAATGGATTACCGTCCGATGGTGATTGCTCGACTTCTGAATGCACCGTGCCTTCTGTTGGAATGCAACGCATGAATGAATGAATGGAGGAACTTCCGATGGTCATTGATTGATTGATTGACTTCTGAATGTGCTGTGCGTTCTCGTCCTTTCCATTGCATTCGACTCAGCTGAGCGCCAGCCTTCTATCTATCCTACGTATAATTTCGCCGTTTGACCCGAGCTAGAATCTGTCGTTAAATTCGCTGATAGATGTGCACATGTTTTATCTGTCCGAGTATATGAGATGATGAAGATCGGTCCCACCAGCAAATACATTAGTAGCTTTCCTAAGTCAACCACCCTCGCTCCAAGTTAGTGTCGATAAAGTACTCCCGAGTCCCGAAAGATACAGCAACTCTTACATCGTCCCCGTCGCTTCCTCTCCTTCTCCCCGTTTCGCTGCACCTCGTCGGACAGTCTGATGTATGGCAGACACTGTAGGTAGTAGCGGTGGATCTAGAGCAGAATTCGCATTCCGAGTTTACAGCTGGTAATAAAATATTGCGTTTTGTGCTGAGCAGGCTGCCATCATCTATACCTTTCCTCGAAGACGACCCCAACCCAAGGTGGAGGCATACACCGGCACCGTGCCAGCAGAACCAAATGACCCAAGAACATTCTCTGGTTAAGGTGAGTGCGGATCTCTTTAATTTTGCGATCTGCCCAGTCGGCGACTGATCTCCGCGAAGAGTATTGCAGAGTCGGGCGGTCGGGACATCGCGCTTTGCCCCTGTCAGAGCGTCGTCGTGTAGCTTTGGTAGAAGATCCTAGAGTTGCCAGGAGATTGTATATTGTTGTGAGGCATAGGAAAAGGAGTCGCGCTTGAACCAGTCTTCCGACAGGTCGTCCTTCAGCTTGACCGTCGTTCGAATGACGCAGACCCTCTTCATTTCGAACGAATTTCAGATGCGTTCCGCCCCCGGGTTGCTGATTTTGGCCTGTGGATTGGATTGCAGGACGACCTGCCATCGAGCATCGGTTTCTCCCAGGGGCTGTCGGATATACCGAGCTCGACCTACTCCAAGGGGATCTTGGAGGAAGACTGGTACATGACCACTGAGAACTCGCTGATGGATGAAATGAAGGAGCTTTCTTATGCTGCGTCGTCTCTGGCGACGCAATCCGAGCCCATGACTTCGTCCCATTACAGCTTAGACTCAACTCATCTCAATTTTCTCTCGCGCAATGCGAGCAAGAATTTCAACTCTGCAGACAATAGATCGTACTTATCCAATTTCATGGAGGGAGGAGGACTCCCTTTCGACACTTCAGGCACTGGTCCGCTCAACAGCTTCGGTCACACAGGGCCCCATGGAGGAGGAGCAGGAGTAGTAGGAGGCCACAACGGGAACGCCATCCTTCACAATCACGGTCAAATTGGCCTCAGCACCAGCAGTCCCCTCGCGGGCAACAATCAATTTTCAGGAAGCAACATGAGCATCCTTCCAAACTCAGGCCTGGTCGCCGGAAATTCTGGATTTTCAAACTTGCACTCGAACTCGAACAGCCTTAACGAGAGCATGCTCTTGAGCAACATCAGTTCCAGACCCACACTGGGCGGCAGCAGCTTCGGCCAGAATCTCAGCGGTTTTCTCAATGGTGGAATAAGCAACGCCTTCAGCTGCGGTTCGGGACCTCCCATCGACGCGAATTTCGCTCAGAGCCTCAGCTCGAGCATGGCCAGGGGCGCTGCTTCCGTTGACATGTTCAACAGCAACAACCACAACTCGCTGGGCAGGACCATTGCAGGCAACACGATCAAGAGCACTTCTCCTCTCTTGAATGTGGACAAACCTCCTTTCCGGTCCAAGGCTGGAGTTCTGAGCCCCGATGCCGTGACAGCCACGGTTGCAGGCTCTCAGCAGACAATTTTCCAAAAGCGAGCAGCATTACGGCGGACTGTCTCGTCCTCTGGCGGATCGATATCCCCCAAGCTGAAGACGCACCCTCAGCTCGTCACTTCAGTTTCCAATGACTCCTCCGTAGATATGCCCGACGAAGAGAGCCCAAATATAAAAAATCCGAGCAAGGGGAAGAAGGCCGTGTCCCCGGCGTCCAGGGTCGACAAGCGGCCCCCAGCACTGCCCTCTGGCTCGGACGAAATGGCCGATGGAGACCAGGATGACGGCAAAGATGACGACGATATGGACGAAAGCGGAGATGTGTCTGGGATGCTCTACGAGGACGATGCAGCTGGCATGGACGGTGCTGCCGCTGGTCAAGGTATGCTACAAAGTGGTGGTCACTCTGGGGAGAAGGGCAAGGGCAAAAAAGGCTTGCCTGCGAAGAATCTCATGGCAGAAAGGAGGCGACGGAAGAAATTGAATGATCGACTGTACATGCTTCGATCTGTGGTACCCAAAATTACAAAGGTGAGCAGTTCTTCACCTCTCTTTTCAACTTTTTCCAATTTCTTCCTGACTTCAATATTTCTGACTGGTTTGTTGATTGATTGAATAGACGAAATGAGATGAAAGAATGCAGATTAAAAATTATGACTCGAGGATTTGTTCTCATTCTCGGATGTTTTGAGTCACCTCATGCAAACTTCTTGAAACTTCTTGAGGTTTCCAGTTTGCATCTCTGGCTTTAAATGATTCTTCAGAGTCTCATGAAACGGGGAAGGATTTGAATTGAAAGGAGATGTGAGAGATGAAAAGAATCTGCTTGTATCGACATTGCGTTAATGTTGTACCTGTAAAGTGATTGCAGCCCATCTGGGCCCGACTTCCCAATGATAGATTTCTCAAACTCTTGCACTGTGCAAAACTATAGATGGACAGAGCATCAATCCTTGGGGACGCAATCGACTACTTGCGGGATCTTGTTGCAAAGATTCATGAGCTGCATGCGGAGCTGGACGGGGACACAGCTGCTGACAAACCTCCGCCTTTGAGTCCTTCAGCCCCTCTACCTATGCAGATTACATCCGCTCTTGCATATCGTGTTAAGGAGGAGCCTCCATCAACCTTCCCCGATCTAACACCCACTACGGTAAGCTCAAATTTCACAAATTTGCAACTCCTCCTGCTTACATTGCACATAACATGAAATAGTTTCATGCTAATCTAGCCATGGAGAGCTAAAGTTCTACACTCTGGATGTTCAGATTGAGGTCTCAGCGAAGGAGGAAGGCAAGGCACTTAACATTCACATGCTGTGTGCACGGAAACCGGGACTCTTACTTTCGATCATGCGTGCGCTGGATGGACTCGGGCTTGAAGTCGAACAAGGAGTTGTTAGCTGCTTCAACGGTTTCGCTCTAGATATCTTCCGGGCAGAGGTATTGTATTTTCCATCGATGAACTTGTGATTTCCAAACACTAAATGATCAAGTTCTGCCTGAAACAGAGGAACAAATAGTTCTGAAAACTGCAACGAATCATCTCTGGCATGCAACATTTATCTGACCTTCTGCTACACTTTTTGACTGGCAGCAACTTAGTGGCTTGGATGTCGGCCCGGAAGAGATCAGACAAGCCCTACTTCTCACAACAGGAGCGAGCCCTGTAGAGCAAAATGTGATTCTTCAGTAAAGTATATACCTTCTCACCAGAGATTTAGAAAATCACCAGACAATTCAGCTCTGTCTCAGGGCAGTGTATATTATATTTCATCGTTTGTAAGTCCTGTATCCGTCATTTCACACAAAGGTGGAGAAATCTCACGTCCTCCCGGGCCATGCTGGAGGGGCGGTGAAGACAAACAGGATTAGGCATACGAGATTATTAGTAGCCTTGATTCTAGACCGTGCTTAGTTTTAATAGTAAACATGCAACCTCCATCATAGATATAGAGTCAGGCCAAAAGATGGCCTCCAATTTTTGACTCGACGAAGGCTAGGAGTTGGTTTCTCACTCACTACGAGCTTCGCTTCATGTGGCATGTGTAAATGGAGTTTTGGGTTATATATGTTCCCGTGAGTCGGTCCGAGCAGCTGTGATCACAATATGAAAAAGTTACAAAGAGATTCATCTCCTG

mRNA

>Mapoly0150s0016.1
GGAGGAGAGAGATAGAGATAGAGAGCGCGCGAGGCAGGCCTAGACTCTAGAGAGATCCTACATCGGCCAACATCACAAGGAAGCAGCAGAGGCATTGTGCAAGCAAGGGACGGATAGTCGCAGTCAGGAGTCAGAGCAAGCTCAGGAGGAGAGCTGTTCCAGTGCAGAGGAGGTCCTGTCCGCACCGGTAGAGAGAGGGAGAAGGAAGAGAGAGGGAGAGACGCGGTCAGACGGACAGACAGAGCCAGAGAGAGAGAGCAGCAGCAGCTGCTGCTGCTGCTACCGTCGTAGCTGCCTATGCCTATGCCCGCCCTGCACTCACTCACTCTGATGACTGACGGGATCATTACTTGCTTACTTACTTGTCGACTGGCGGCCCCTCCCCTCGCAAGTGCATGACGAGGTGAAACTAGACAGACCACGCCAGCGGTAAAATAGAACAAGATTTGGAATCCGTTTCCAATGCTCAATGCTGCTGCTGGCATTGAACCTGGAGAGTGACAAGCCAGAGCCAAATATCTGAGCATAGTGAGAGAGATAGATAGATAGAGAGATAGAGAGAGAGAGGGAGAGATAGATAGGACGGGGGACGAGAAGATGCAAAAATTAGTTGCAGCGGCAGCCACGTATGTCCGAGGTCATTTGAAGATTCCACTGAATGTCCACACTGAATGCCCGTCGACTCCAGCTTCGGCGTAACATGGCGCAGGGATCCGGTGGCTTTTCCTTGCGGGTAGTCGCTCATCGTCAAGCTCGACGACAGGAATGTAACGGGAAGGCTGAGGCGGAAGCGAGGAAGGCAGTGGCCGCGCTGGTCTGAGAGAGAGACGCAGTGAGGGGGTGGAGGGGAGGGGAGGGGAGCGAGGGCCGGGGAGGGGGAAGCGAGAGTACAATCTCGCGAGCTCGACAGTTAGCAAACAGTGCGACGGGAATAAGAGCACAGCTTCATTTATTGAGCACGGTGACCGTACGCAACAAGGTATTACCTACTCAAATGCGTGTCAGAAGGAGGGAACCTGAAAGCTCCTCGCAAATTGCTCAAGGCAGCAGTTCAGATAGAGACTTGATTCATCACGGAGGACCAGGCAATTGCAGCCCATCTCGATCAGTTCGTTCGGTTCGGAAGCGGCACAAGCTGTTGCCGAGAGTACTTCAACCCCTCGCCGTCTGGCTGCTGTTGCTGCTGCTGCCGCCGCTGCTTGGCTTGGCTTTCTCAGACAAGTACTCCTCTGATGACGAACGTCTCGGCCCCGCAACGCTGTTGGTGTGAGACGAAATCGTCGCAACAGAACCCACCTCGCTCGAAGCAACTTGCGCCCAGAGGCGGAGGCGGCAGTTGAGAGAGCGCCGTGGGCCAATGACAATGTGGACGCTGTGAGCATCCCTCGTCGACCGAAGGCGCTCACTCTCTCGGTGCTCGACCGCAATGGCTTCGACCAGAGTCAGCGGGGCCTCGGCCTGGATGGCTGGTAGCTCCTCGAATTTGAGGCTGCCATCATCTATACCTTTCCTCGAAGACGACCCCAACCCAAGGTGGAGGCATACACCGGCACCGTGCCAGCAGAACCAAATGACCCAAGAACATTCTCTGGTTAAGGACGACCTGCCATCGAGCATCGGTTTCTCCCAGGGGCTGTCGGATATACCGAGCTCGACCTACTCCAAGGGGATCTTGGAGGAAGACTGGTACATGACCACTGAGAACTCGCTGATGGATGAAATGAAGGAGCTTTCTTATGCTGCGTCGTCTCTGGCGACGCAATCCGAGCCCATGACTTCGTCCCATTACAGCTTAGACTCAACTCATCTCAATTTTCTCTCGCGCAATGCGAGCAAGAATTTCAACTCTGCAGACAATAGATCGTACTTATCCAATTTCATGGAGGGAGGAGGACTCCCTTTCGACACTTCAGGCACTGGTCCGCTCAACAGCTTCGGTCACACAGGGCCCCATGGAGGAGGAGCAGGAGTAGTAGGAGGCCACAACGGGAACGCCATCCTTCACAATCACGGTCAAATTGGCCTCAGCACCAGCAGTCCCCTCGCGGGCAACAATCAATTTTCAGGAAGCAACATGAGCATCCTTCCAAACTCAGGCCTGGTCGCCGGAAATTCTGGATTTTCAAACTTGCACTCGAACTCGAACAGCCTTAACGAGAGCATGCTCTTGAGCAACATCAGTTCCAGACCCACACTGGGCGGCAGCAGCTTCGGCCAGAATCTCAGCGGTTTTCTCAATGGTGGAATAAGCAACGCCTTCAGCTGCGGTTCGGGACCTCCCATCGACGCGAATTTCGCTCAGAGCCTCAGCTCGAGCATGGCCAGGGGCGCTGCTTCCGTTGACATGTTCAACAGCAACAACCACAACTCGCTGGGCAGGACCATTGCAGGCAACACGATCAAGAGCACTTCTCCTCTCTTGAATGTGGACAAACCTCCTTTCCGGTCCAAGGCTGGAGTTCTGAGCCCCGATGCCGTGACAGCCACGGTTGCAGGCTCTCAGCAGACAATTTTCCAAAAGCGAGCAGCATTACGGCGGACTGTCTCGTCCTCTGGCGGATCGATATCCCCCAAGCTGAAGACGCACCCTCAGCTCGTCACTTCAGTTTCCAATGACTCCTCCGTAGATATGCCCGACGAAGAGAGCCCAAATATAAAAAATCCGAGCAAGGGGAAGAAGGCCGTGTCCCCGGCGTCCAGGGTCGACAAGCGGCCCCCAGCACTGCCCTCTGGCTCGGACGAAATGGCCGATGGAGACCAGGATGACGGCAAAGATGACGACGATATGGACGAAAGCGGAGATGTGTCTGGGATGCTCTACGAGGACGATGCAGCTGGCATGGACGGTGCTGCCGCTGGTCAAGGTATGCTACAAAGTGGTGGTCACTCTGGGGAGAAGGGCAAGGGCAAAAAAGGCTTGCCTGCGAAGAATCTCATGGCAGAAAGGAGGCGACGGAAGAAATTGAATGATCGACTGTACATGCTTCGATCTGTGGTACCCAAAATTACAAAGATGGACAGAGCATCAATCCTTGGGGACGCAATCGACTACTTGCGGGATCTTGTTGCAAAGATTCATGAGCTGCATGCGGAGCTGGACGGGGACACAGCTGCTGACAAACCTCCGCCTTTGAGTCCTTCAGCCCCTCTACCTATGCAGATTACATCCGCTCTTGCATATCGTGTTAAGGAGGAGCCTCCATCAACCTTCCCCGATCTAACACCCACTACGATTGAGGTCTCAGCGAAGGAGGAAGGCAAGGCACTTAACATTCACATGCTGTGTGCACGGAAACCGGGACTCTTACTTTCGATCATGCGTGCGCTGGATGGACTCGGGCTTGAAGTCGAACAAGGAGTTGTTAGCTGCTTCAACGGTTTCGCTCTAGATATCTTCCGGGCAGAGCAACTTAGTGGCTTGGATGTCGGCCCGGAAGAGATCAGACAAGCCCTACTTCTCACAACAGGAGCGAGCCCTGTAGAGCAAAATGTGATTCTTCAGTAAAGTATATACCTTCTCACCAGAGATTTAGAAAATCACCAGACAATTCAGCTCTGTCTCAGGGCAGTGTATATTATATTTCATCGTTTGTAAGTCCTGTATCCGTCATTTCACACAAAGGTGGAGAAATCTCACGTCCTCCCGGGCCATGCTGGAGGGGCGGTGAAGACAAACAGGATTAGGCATACGAGATTATTAGTAGCCTTGATTCTAGACCGTGCTTAGTTTTAATAGTAAACATGCAACCTCCATCATAGATATAGAGTCAGGCCAAAAGATGGCCTCCAATTTTTGACTCGACGAAGGCTAGGAGTTGGTTTCTCACTCACTACGAGCTTCGCTTCATGTGGCATGTGTAAATGGAGTTTTGGGTTATATATGTTCCCGTGAGTCGGTCCGAGCAGCTGTGATCACAATATGAAAAAGTTACAAAGAGATTCATCTCCTG

CDS

>Mapoly0150s0016.1
ATGGCTTCGACCAGAGTCAGCGGGGCCTCGGCCTGGATGGCTGGTAGCTCCTCGAATTTGAGGCTGCCATCATCTATACCTTTCCTCGAAGACGACCCCAACCCAAGGTGGAGGCATACACCGGCACCGTGCCAGCAGAACCAAATGACCCAAGAACATTCTCTGGTTAAGGACGACCTGCCATCGAGCATCGGTTTCTCCCAGGGGCTGTCGGATATACCGAGCTCGACCTACTCCAAGGGGATCTTGGAGGAAGACTGGTACATGACCACTGAGAACTCGCTGATGGATGAAATGAAGGAGCTTTCTTATGCTGCGTCGTCTCTGGCGACGCAATCCGAGCCCATGACTTCGTCCCATTACAGCTTAGACTCAACTCATCTCAATTTTCTCTCGCGCAATGCGAGCAAGAATTTCAACTCTGCAGACAATAGATCGTACTTATCCAATTTCATGGAGGGAGGAGGACTCCCTTTCGACACTTCAGGCACTGGTCCGCTCAACAGCTTCGGTCACACAGGGCCCCATGGAGGAGGAGCAGGAGTAGTAGGAGGCCACAACGGGAACGCCATCCTTCACAATCACGGTCAAATTGGCCTCAGCACCAGCAGTCCCCTCGCGGGCAACAATCAATTTTCAGGAAGCAACATGAGCATCCTTCCAAACTCAGGCCTGGTCGCCGGAAATTCTGGATTTTCAAACTTGCACTCGAACTCGAACAGCCTTAACGAGAGCATGCTCTTGAGCAACATCAGTTCCAGACCCACACTGGGCGGCAGCAGCTTCGGCCAGAATCTCAGCGGTTTTCTCAATGGTGGAATAAGCAACGCCTTCAGCTGCGGTTCGGGACCTCCCATCGACGCGAATTTCGCTCAGAGCCTCAGCTCGAGCATGGCCAGGGGCGCTGCTTCCGTTGACATGTTCAACAGCAACAACCACAACTCGCTGGGCAGGACCATTGCAGGCAACACGATCAAGAGCACTTCTCCTCTCTTGAATGTGGACAAACCTCCTTTCCGGTCCAAGGCTGGAGTTCTGAGCCCCGATGCCGTGACAGCCACGGTTGCAGGCTCTCAGCAGACAATTTTCCAAAAGCGAGCAGCATTACGGCGGACTGTCTCGTCCTCTGGCGGATCGATATCCCCCAAGCTGAAGACGCACCCTCAGCTCGTCACTTCAGTTTCCAATGACTCCTCCGTAGATATGCCCGACGAAGAGAGCCCAAATATAAAAAATCCGAGCAAGGGGAAGAAGGCCGTGTCCCCGGCGTCCAGGGTCGACAAGCGGCCCCCAGCACTGCCCTCTGGCTCGGACGAAATGGCCGATGGAGACCAGGATGACGGCAAAGATGACGACGATATGGACGAAAGCGGAGATGTGTCTGGGATGCTCTACGAGGACGATGCAGCTGGCATGGACGGTGCTGCCGCTGGTCAAGGTATGCTACAAAGTGGTGGTCACTCTGGGGAGAAGGGCAAGGGCAAAAAAGGCTTGCCTGCGAAGAATCTCATGGCAGAAAGGAGGCGACGGAAGAAATTGAATGATCGACTGTACATGCTTCGATCTGTGGTACCCAAAATTACAAAGATGGACAGAGCATCAATCCTTGGGGACGCAATCGACTACTTGCGGGATCTTGTTGCAAAGATTCATGAGCTGCATGCGGAGCTGGACGGGGACACAGCTGCTGACAAACCTCCGCCTTTGAGTCCTTCAGCCCCTCTACCTATGCAGATTACATCCGCTCTTGCATATCGTGTTAAGGAGGAGCCTCCATCAACCTTCCCCGATCTAACACCCACTACGATTGAGGTCTCAGCGAAGGAGGAAGGCAAGGCACTTAACATTCACATGCTGTGTGCACGGAAACCGGGACTCTTACTTTCGATCATGCGTGCGCTGGATGGACTCGGGCTTGAAGTCGAACAAGGAGTTGTTAGCTGCTTCAACGGTTTCGCTCTAGATATCTTCCGGGCAGAGCAACTTAGTGGCTTGGATGTCGGCCCGGAAGAGATCAGACAAGCCCTACTTCTCACAACAGGAGCGAGCCCTGTAGAGCAAAATGTGATTCTTCAGTAA

Protein

>Mapoly0150s0016.1
MASTRVSGASAWMAGSSSNLRLPSSIPFLEDDPNPRWRHTPAPCQQNQMTQEHSLVKDDLPSSIGFSQGLSDIPSSTYSKGILEEDWYMTTENSLMDEMKELSYAASSLATQSEPMTSSHYSLDSTHLNFLSRNASKNFNSADNRSYLSNFMEGGGLPFDTSGTGPLNSFGHTGPHGGGAGVVGGHNGNAILHNHGQIGLSTSSPLAGNNQFSGSNMSILPNSGLVAGNSGFSNLHSNSNSLNESMLLSNISSRPTLGGSSFGQNLSGFLNGGISNAFSCGSGPPIDANFAQSLSSSMARGAASVDMFNSNNHNSLGRTIAGNTIKSTSPLLNVDKPPFRSKAGVLSPDAVTATVAGSQQTIFQKRAALRRTVSSSGGSISPKLKTHPQLVTSVSNDSSVDMPDEESPNIKNPSKGKKAVSPASRVDKRPPALPSGSDEMADGDQDDGKDDDDMDESGDVSGMLYEDDAAGMDGAAAGQGMLQSGGHSGEKGKGKKGLPAKNLMAERRRRKKLNDRLYMLRSVVPKITKMDRASILGDAIDYLRDLVAKIHELHAELDGDTAADKPPPLSPSAPLPMQITSALAYRVKEEPPSTFPDLTPTTIEVSAKEEGKALNIHMLCARKPGLLLSIMRALDGLGLEVEQGVVSCFNGFALDIFRAEQLSGLDVGPEEIRQALLLTTGASPVEQNVILQ

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>