Mapoly0153s0037



Description

(UnKnown)

Reference DB

Database ID Description
OrthoMCL OG5_138321
PANTHER PTHR21213 FAMILY NOT NAMED
PANTHER PTHR21213:SF0 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-17 transcription factor, C2H2-ZnF Mapoly0153s0037.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0153s0037.1 scaffold_153:302491..304752  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0153s0037.1  

Gene structure:

mRNA scaffold_153:302491..304752  ( + strand )
five_prime_UTR scaffold_153:302491..303033  ( + strand )
CDS scaffold_153:303034..303354  ( + strand )
three_prime_UTR scaffold_153:303355..304752  ( + strand )

Sequences:

Gene

>Mapoly0153s0037.1
GGAGGGTGGTGGCTGGCGGCTGCAGCCACGGCCAGGCAGGGCTGGCGACGGTCACCTCCACCGAAACGAAGAGAGCTCAAGAAGGAAGGCAGCAACGAAGGCGCACGAAGGACGAGACGAAGGCCGACCCTAACCTCCTCCTTTCCGTCTCAACTCTTGCGCAGCACGAGTTCGCGAGTCGGAGCCAGCAGCAGCAGCAGCAGCCGAAGAAGGGGATTGCAGGCAGACCCATCGATGCGCGGAGCGAGGGAGTGAGTCCTCGAGCGAGCGGTTGTGCGATTGATCGATCTTCCGGTGGATTGACCGAGTGCCTCGAGCGAAGCGGGGCGGAGATCGGATCGTGGACCGAGCGAGGTTTGTAAGGAGGAGGAGGGAGGAGGAGCAGCCATTGAGCGCATTCATAGATGGTCGTAAACGCGTTGTGTTTGGAGTGTGTGAGAAAGAGCGGTAAGCAGCTAGAAAGGCCGACGAGGACGTTCGGTTGAAGCCGAGCGGACAAGGGAATTTCGGCCGTCGGAGAGGGGAGGAAGGCGGAGAAGGAACATGACGGGCAAAGCCAAGCCCAAGAAGCACACTGCCAAGGAAATCGCGGCCAAGATTGATGCGGCCACGACCAATAGGGGTGGGGGCAAAGCGGGTGTAGAGGACCGTAAGGCGTTGGAGAAAGGAGGTCACGCGAAGCTGGCCTGTCCAATTTGCAGGGTCACTGCACCTGATTCGAAGAGTATGCTGATTCACCATGAAGCTCGCCACCCGAAGATGCCGTATGAGGAGGAGAAGCTCATCAATCTGCATGCTACTACGCCTGTGGAAGCAGAATCATCTAAGCCCAAACCCGGCGTCAGGGGCAGCTTGAAAAAGTGAACTGGGGTTGTACACCCTGATCATAGTTTGGATGCATTAGCGAGCCTCATCTCTTGCCACGAAGGTATGCACGGGACGTCAGCAATGTCTGACGACTAGTTCCTGTCTGTCTGCTGTGGTTGGCTCTGTCTGTTGAAGTGAGTGCACGAATTAGCTATTGAAGATTGGTCTGAGGGGAACGAAACCTGAGAATCGAATCATAGTGGACGAGATGTCAAACACTCTAAACACGCAAAGAAGAATCATCTTTCCCAAGTCGCCGAACATCTGGACTGCCGCAGTGTCGCAAATTGTACACATTTTCAGGTGCACGAAGTGGAGTATAGATCAAGGCATACGAAAGGATATAAACTGGAGATTTGTGGTTTCCCATTTCTTACCCGCACTACTCTGTTCTTGTCTTAGTGTGTGACTAGACTTATCAAACTTTTTCTCCTGACGTCTCCTGTTAGACGCCAGCAGTTAAATCCGAACTGATATTTGTTTTACTTCGGACGAAATTGTAAACCTAATTTTGGTGTTTGAGCCAGGTCACTGTTTTCTACATACTGAGGTGGATTGGCTGAGCATGTTCCCATTGAATAGCCATGAACTTTATCAGACCTTCGCTTCATCTATTCTGACCAGGAAGGTTGCACTTTCAACTGCCGGAGCTTGAATTCCCTATCGTATGTCATGAGTTGTTGTCCAAGTTGCCTAAGTGCCTGTCGTAGCTGTTATGAGATGGATTCTGTTGTGTACCAATCTGCAAGCTTTTAAGGGTTTGGTCCCTTGCTCATAGGGGTTTTTCTCCATAGCACGTGGATTTTGTCGCTCCGCCGAGAGTAGGGTGATAGTACTGATTTGTATTGAAGTTGAGAGCAGATTGTAATGTAGCTTATGAATTCTGATCTACTAGAACATGGTGTGGTCATCATATTTCCATTCTTTCCCGTGGAATGAACCTCAACCGATTTGTAGGCTGCAGTAGAATGATGACGAAAGAAAAGGGGGGAAATCCCCACCCCCTCTTCAATCCCACATTCTGTCAGTATCTATCGAAGACCATTTGCATTTTTAGGCCTACCTCAGGGAAGTCGTCTCCTGGGGAAACGTCTCTGTAATTTTTCCCATTGAGAATCAGTAGGACAAAAGTGCGAGTGTGTGGAGACAGGAGAAAGGAACTCGAGATTCATCCCAAGTAAACAACGAAACGGGCTAAAACTGCAGTCGAGAGGACAATTCGAAAGGAAATAAAGGAGATTAGGAGGAATGTCTAGAAAACCCGCGTGGTTCTGGCAAATCTCAATGTTGTCGTGTAATTCATCATGCTAGGGACACGCAGGATCTAATGAACGCAATTCGTCGAGAAAGAGATGAGAAACGAAGTCATGTGAATCTCTCGGAGGTAAGCAGCGG

mRNA

>Mapoly0153s0037.1
GGAGGGTGGTGGCTGGCGGCTGCAGCCACGGCCAGGCAGGGCTGGCGACGGTCACCTCCACCGAAACGAAGAGAGCTCAAGAAGGAAGGCAGCAACGAAGGCGCACGAAGGACGAGACGAAGGCCGACCCTAACCTCCTCCTTTCCGTCTCAACTCTTGCGCAGCACGAGTTCGCGAGTCGGAGCCAGCAGCAGCAGCAGCAGCCGAAGAAGGGGATTGCAGGCAGACCCATCGATGCGCGGAGCGAGGGAGTGAGTCCTCGAGCGAGCGGTTGTGCGATTGATCGATCTTCCGGTGGATTGACCGAGTGCCTCGAGCGAAGCGGGGCGGAGATCGGATCGTGGACCGAGCGAGGTTTGTAAGGAGGAGGAGGGAGGAGGAGCAGCCATTGAGCGCATTCATAGATGGTCGTAAACGCGTTGTGTTTGGAGTGTGTGAGAAAGAGCGGTAAGCAGCTAGAAAGGCCGACGAGGACGTTCGGTTGAAGCCGAGCGGACAAGGGAATTTCGGCCGTCGGAGAGGGGAGGAAGGCGGAGAAGGAACATGACGGGCAAAGCCAAGCCCAAGAAGCACACTGCCAAGGAAATCGCGGCCAAGATTGATGCGGCCACGACCAATAGGGGTGGGGGCAAAGCGGGTGTAGAGGACCGTAAGGCGTTGGAGAAAGGAGGTCACGCGAAGCTGGCCTGTCCAATTTGCAGGGTCACTGCACCTGATTCGAAGAGTATGCTGATTCACCATGAAGCTCGCCACCCGAAGATGCCGTATGAGGAGGAGAAGCTCATCAATCTGCATGCTACTACGCCTGTGGAAGCAGAATCATCTAAGCCCAAACCCGGCGTCAGGGGCAGCTTGAAAAAGTGAACTGGGGTTGTACACCCTGATCATAGTTTGGATGCATTAGCGAGCCTCATCTCTTGCCACGAAGGTATGCACGGGACGTCAGCAATGTCTGACGACTAGTTCCTGTCTGTCTGCTGTGGTTGGCTCTGTCTGTTGAAGTGAGTGCACGAATTAGCTATTGAAGATTGGTCTGAGGGGAACGAAACCTGAGAATCGAATCATAGTGGACGAGATGTCAAACACTCTAAACACGCAAAGAAGAATCATCTTTCCCAAGTCGCCGAACATCTGGACTGCCGCAGTGTCGCAAATTGTACACATTTTCAGGTGCACGAAGTGGAGTATAGATCAAGGCATACGAAAGGATATAAACTGGAGATTTGTGGTTTCCCATTTCTTACCCGCACTACTCTGTTCTTGTCTTAGTGTGTGACTAGACTTATCAAACTTTTTCTCCTGACGTCTCCTGTTAGACGCCAGCAGTTAAATCCGAACTGATATTTGTTTTACTTCGGACGAAATTGTAAACCTAATTTTGGTGTTTGAGCCAGGTCACTGTTTTCTACATACTGAGGTGGATTGGCTGAGCATGTTCCCATTGAATAGCCATGAACTTTATCAGACCTTCGCTTCATCTATTCTGACCAGGAAGGTTGCACTTTCAACTGCCGGAGCTTGAATTCCCTATCGTATGTCATGAGTTGTTGTCCAAGTTGCCTAAGTGCCTGTCGTAGCTGTTATGAGATGGATTCTGTTGTGTACCAATCTGCAAGCTTTTAAGGGTTTGGTCCCTTGCTCATAGGGGTTTTTCTCCATAGCACGTGGATTTTGTCGCTCCGCCGAGAGTAGGGTGATAGTACTGATTTGTATTGAAGTTGAGAGCAGATTGTAATGTAGCTTATGAATTCTGATCTACTAGAACATGGTGTGGTCATCATATTTCCATTCTTTCCCGTGGAATGAACCTCAACCGATTTGTAGGCTGCAGTAGAATGATGACGAAAGAAAAGGGGGGAAATCCCCACCCCCTCTTCAATCCCACATTCTGTCAGTATCTATCGAAGACCATTTGCATTTTTAGGCCTACCTCAGGGAAGTCGTCTCCTGGGGAAACGTCTCTGTAATTTTTCCCATTGAGAATCAGTAGGACAAAAGTGCGAGTGTGTGGAGACAGGAGAAAGGAACTCGAGATTCATCCCAAGTAAACAACGAAACGGGCTAAAACTGCAGTCGAGAGGACAATTCGAAAGGAAATAAAGGAGATTAGGAGGAATGTCTAGAAAACCCGCGTGGTTCTGGCAAATCTCAATGTTGTCGTGTAATTCATCATGCTAGGGACACGCAGGATCTAATGAACGCAATTCGTCGAGAAAGAGATGAGAAACGAAGTCATGTGAATCTCTCGGAGGTAAGCAGCGG

CDS

>Mapoly0153s0037.1
ATGACGGGCAAAGCCAAGCCCAAGAAGCACACTGCCAAGGAAATCGCGGCCAAGATTGATGCGGCCACGACCAATAGGGGTGGGGGCAAAGCGGGTGTAGAGGACCGTAAGGCGTTGGAGAAAGGAGGTCACGCGAAGCTGGCCTGTCCAATTTGCAGGGTCACTGCACCTGATTCGAAGAGTATGCTGATTCACCATGAAGCTCGCCACCCGAAGATGCCGTATGAGGAGGAGAAGCTCATCAATCTGCATGCTACTACGCCTGTGGAAGCAGAATCATCTAAGCCCAAACCCGGCGTCAGGGGCAGCTTGAAAAAGTGA

Protein

>Mapoly0153s0037.1
MTGKAKPKKHTAKEIAAKIDAATTNRGGGKAGVEDRKALEKGGHAKLACPICRVTAPDSKSMLIHHEARHPKMPYEEEKLINLHATTPVEAESSKPKPGVRGSLKK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>