Mapoly0156s0012



Description

Homeobox domain // START domain

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0008289 Lipid binding
KEGGORTH K09338 Homeobox-leucine zipper protein
KOG KOG0492 Transcription factor MSH, contains HOX domain
OrthoMCL OG5_133354
PFAM PF00046 Homeobox domain
PFAM PF01852 START domain
PANTHER PTHR24325 FAMILY NOT NAMED
PANTHER PTHR24325:SF14

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC4HDZ Homeodomain protein Published
MpHD18 transcription factor, HD Mapoly0156s0012.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0156s0012.1 scaffold_156:173161..178557  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0156s0012.1  

Gene structure:

mRNA scaffold_156:173161..178557  ( + strand )
five_prime_UTR scaffold_156:173161..174130  ( + strand )
CDS scaffold_156:174131..174316  ( + strand )
CDS scaffold_156:174603..174805  ( + strand )
CDS scaffold_156:174922..175039  ( + strand )
CDS scaffold_156:175141..175329  ( + strand )
CDS scaffold_156:175431..175883  ( + strand )
CDS scaffold_156:175989..176093  ( + strand )
CDS scaffold_156:176182..176391  ( + strand )
CDS scaffold_156:176501..176675  ( + strand )
CDS scaffold_156:176782..177053  ( + strand )
CDS scaffold_156:177155..177250  ( + strand )
CDS scaffold_156:177371..177760  ( + strand )
three_prime_UTR scaffold_156:177761..178557  ( + strand )

Sequences:

Gene

>Mapoly0156s0012.1
TCGTGGGCGTGGAGAAGCTGCCCTCGTCGCAGTGTTCGGTTCGTGTTCGCTTCTCGTCTGTTGTTCTAGCTAGGATTGGGTCTGTCGAGACGATTGCATCGAGCTCACCTGCGGAGGATTGGTAGCAGTGTGTGAGAGCTCGTCGTCGACTTTTCTCCTCTTTCGAGCAATTCTGACTGTTGTCTGTAACGCTTGAAGCTCGCCGCTGCATACCCTGGTTTCCACCTAGCTCTCACCTCCCCTCTTTTCGCATGCGTTGTTAGTAGTGCCTGGTCCTCGGAGGTTGAGAGCAGTGTAATAGTTCTCTCTGAGAGGGAGAGAAAGAGAGAGAAAGGAGAGTCAGCACGGCAGGTGCTTGCCTTCTCTCTCCCTCTTTCTCTCTGGACGTTCAGAGAGAGGGAAGGAGGCAAAAGTAACGTGAGGTCAGTGTTTCTTATTCGTCTGGGTTTACTCCAGACGAGTGACAAACACTAGCAACACCTGCCTCCCTCACTCTCTCTAGTCCCTAGCTCTCTTCGTTCAGTTTTTCTTTTGTTTTCCCCCTTATGTTCATTACTTCTTCTGTACGTGCTTCTGTCAGTGACCTTTAAGATGCCTTGACTGCGCAATCTTCCTGTTTCTCAATCCTCACCACTACCCGGTGGTTGTGTATTTGTAAAAAGCATTCTCGAAGTAGACAATGTCAGATTTGCCCTCTCATTGTACATTCCTCCCTCCAAGCGAAGTAGCCTCCCTGTTTTCCGAAGGCTTCAAACAGGTCCAGGCCTCCGAGGACGGGGCAGCTGAACATCACATCGTAACTAAGTAGAGTTCGAGAGGAGTAGGTGGCTCATTAGGAGCTCGCGTAGGTTGGAGTTCTGATCCTGCAGTGCCATCTAGTGTGGTAACGCAAAAGAAGGAGAACCACACTGATTGTAGCCATGAAGAGAGGTTAAGAGTGGGCACCGTGGCTTTCGATATCAGTGAAGGAATGAGGTTGGGGGGTGTGACAGTTACGGTGACAGCGAACGGAGGGGGAGTAGGGCCGAAATATCTCTCAGAACTAGCTGTTATGCCATCCTCCGTAATGGCCCCTCCGAGACTAGCGCCACCCAATGCAATGGCGCGGGGACCCCAAAAGAATGTGTTTACATCTCCAGGCCTATCTCTGGCACCGGTGAGTTAACTTCTGCGTGGAGTTTGAGCTCGAATAGCTTGATATGCAGCTCCTCACAAGGCGTGAGTGCATTTGATAGTATTTGCTTTTATTCACCAAGTTGGGGGGTGGAGGGGCTTCTGACACTGGAGCTCAAGCACAGTGCGTTTCTAATTTGAGTGTGGAGTGAAGTGAAGTGGTTTGCAAAGAGTCGCCTGTGTCCTGAAGCTGAACGGTTTACTTCGCCTGCTCTCGACTACAGTGAGCTTGACAACATTTACTGAGATCATTCAGTGATTTGATGCAGCCGAGTGGGCTGGAAGGTCAGCCTCAGGTCAGCCAGAGTGCTGAGAGTGAGCAGGTGAAGCAGAAAGACAATGAGGAGTATGAGAGTAGATCGGGTAGCGACAACATGGAAGGAGGCTCTGGGGATGATCAGGACCCTGATCACCCCCCGCGCAAGAAGCGCTATCACCGCCACACCCCGCGCCAGATCCAGGAAATGGAAATGTAAGAGCTAGATGTGAACACTTGAAGTTCGTTCATTTTTCATTGAATACTTCTAGCTTGTTACTGTCATCCTTGGGTTGAGTGTTGATATTTCAGCTGCTCACTTCATTTTGTAGGGTGTTCAAAGAGTGCCCACACCCAGATGATAAGCAAAGGCAGGAACTCAGCAAGGAGCTCGGCCTGGAGCCTCGCCAGGTCAAGTTTTGGTTCCAAAACAGGAGGACGCAGATGAAGGTGAGAACTCTCGAGCTACTTGATACCACTGTTGGTTTTCGGGCAAGTTCTAGCTTTGACGGGTTGGAGAGAGCTGAGTCCCACTGTTTGACCTTCTGCAGGCTCAGCAGGAACGAGCTGAAAACTCTATGCTACGAGCTGAGAACGAGAAGCTTCGTTCTGAGAACATTACCATGCGAGACGCCATGAAGAACGCCTCCTGTCCGCACTGTGGGGGTCCTACGACGATGGGAGAGATGTCATTTGATGAGCAGCAGCTGCGCATAGAGAATGCTCGCCTCAAAGATGAGGTACTGATAACCTTCACCGGACTCGAAGCTATGTCCTCTACTCGTCACATTCCCTCGTCACCTCTCTGAATACCCACTGACGCAATGTGAACTTTTTGTAGATCGACCGCGTATCAGCACTAGCTGCGAAGTATTTGGGGCGCCCTGTCGCACCAATGAACTCTTTACCCCCAATGTCAACGTCCTCCCTAGAGCTACAAGTTGGAGGTAGTTTTGGAATGCATCAGGGAACTGGCACTGACCTCGTACCTCAAGGCCCCTCCGTAGCTGATGTGGCGACACGGCCAGGTGGTCTGTCGGATGCTGAGAAACCAATGGTCTTCGAGCTTGCTGTCGCAGCTATGGACGAACTCGTTCGCCTTGCGCAATCAGACGAGCCGTTATGGATTCCTGGTCACGATGGTGCGAAGGAAACATTAAATTACGACGAGTACGTGCGTCAGTTTCCCAGAGGGATTGGTCCGAAGCCTTTCGGATTGAAAACGGAGGCCACTCGAGAGACTGGTCTAGTCATGATGAACGGTGTTACTTTGGTGGAGACTCTAATGGATCATGTACGACCAACCTCATCTTCTCTTTTTGAGCTTTTTCCTGGTCATTCCGTCCTGTGGTGTCCTAAGCTTATCAGCTGTAGCTCATGTCATTTACTGTCTGTGCAGGTTCGATGGACCGAAATGTTTCCCTGCATGGTCTCTAGAGCACTCACTGTAGAGGTTCTCTCTACGGGCATCGGCGCGTGCAATCGGAATGGCGCTCTTCAACTGGTAAGTCGGTTACAGAGGCTACATGCGTGCATGACTTATGCACGGGCTTACTTTGGGATAATACTGACTCTGACTGTTATTTTGGCAGATGTACGCCGAGCTTCAGGTTTTATCTCCCCTTGTTCCCACACGTGAGTGCTACTTCTTGCGATTTTGCAAGCAGCATGGCGAAGGAATTTGGGCTGTAGTCGATGTGTCTGTCGACAGTCTCAGAGACAACCCACCTCCGGCGTTGATGCGTTCTCGAAGACGGCCTTCTGGATGCCTTATTCAGGACATGCCGAATGGTTACTCGAAGGTAGTGATTCATTAATTGCGTTCGTTTGAGACTTTGGGTGAACTTGACGTCCGGGTTGGGCTCAGTGCGGAGGCTTACTAAATGTCTTTCATGTCTCCTCACATTGCAGGTGACTGTCCTCGAGCACATGGATTACGACGACAGAACCGTGAACCGGATGTACAAATCCTTAGTAAATAGCGGCCAAGCTTTCGGAGCACAACGATGGTTAGCCACCTTACAAAGGCAATGTGAGCGTCTTGCAAGCATGCTGGCCAGCAACCTCTCTCAGAGAGATCTAGGTGGTGAGTACTAGTCTTGAGTTCTGCGCCTGTTACACGCTCCTGCTGCAACCATTTCAACCTCATCTCCTCATTTCCTGACGCTTCCTGACATCGTCTCTGCGCGCAGGTGTGCCGACTGCCAATGGTAGACGAAGTATGCTCAAGCTTGCTCAAAGAATGACAAACAACTTCTGCGCCGGAGTTAGCGCTTCTACTGTCCACACGTGGACTACATTGGCAGGAAGTGGAGAGGACGACGTCCGAGTTATGACTCGCAAGAGTGTCGATAACCCCGGTGAACCGCATGGCATCGTTCTCAGCGCTGCTACTTCGCTATGGCTACCCGTGTCCCCTCAGCGAGTTTTTGAGTTTCTGAGAGACGAACGTCTCAGACATGAGGTGCGACTCTTAAGCAAACCTCCCCTGCCGCACAGCCCGCGATGCCGTCTCTCAATCATCCCTCATTAATGCTATATCTGATATGTCTGTCTCGTCTGCAGTGGGATATTCTGTCCAATGGTGGGCATGTAGCGGAGATGGCTCACATTGCGAAAGGCCAGGACCCTGGGAACAGCGTGTCACTTCTCCGAGTGAATGTAAGCTGAAGCCGTGGCTTCCAGTTTCTGTTCTATTCTATTCCTAATGTGTAATCGCAATCATCTCAGCTCATTGAGTGCTTGCCTGAGCTCAAGAATCTTTTAATTGGTGATGTGCAGGCTATCAATCCTGGACAAAGCAACATGCTCATTCTCCAGGAGAGTTGCACCGACGTGTCTGGCTCTCTAGTGATCTACGCACCTGTTGATATTCCCGCGATGACCTTGGTATTGCAAGGCGGAGATCCCGCCTACGTAGCACTGCTACCTTCAGGCTTCGCGATCCTACCCGACGGTCCTGAGAACCGCCGCTCGCTTGGGGACGGTAGCGGCCTTCCTGAAAGCCCAAGGAGAACAGGCGGAGCGCTGCTTACAGTAGCGTTTCAGATTTTGGTGTCCAGCGTGCCATCGGCGAAGCTATCTCTCGAATCTGTGGCAACCGTCAACAACCTTATCTCCTGCACTGTCCAGCGAATCAAGCAAGCTCTTCAGGTGCCCGACGAGTCTTGAATATGAATATCGCCTTGGGGATGGGTTACTTGGTGAAATCTGCACAAGCGGTTTTCACTCTGCATACTGACAAGAAAGGGAGGAAGTGACGACGAAGGTAAATGCCGAGGAGGGAGACATGTTCTCAGGTTATCGCAGGAGCAGGGTACAGAAAGTTGAAAAGAGCTTCGCTTCGGGAGTGTGACGAAGTAGACATGCTCGTATCTAGTGCTTGTGAGAGCGCGATGGTTGAGGGGTACTCAACACCTTGTGAAGCTCACATTGAGCACGGTGTTGAGTGCTCCTCACATCGCACTGGTCTCAGGCCTGTCGTAAAGTCAGTCAATCAGGATTAGCAGTCAGCTAGGTTACAAATCTCAGAACGTTGACAAATAATGTCGAATCACGCCTCCTTTGGAGTGCTTTTAACCATCAAAGACTTTGAAGTGGAACGGACGTGCAGGAAATAGTCAAGAACGCACCACAGATGCCTCCTTGCTAAGTGGTAAGGCATTATGCACCCGAGTGTGCCTGTGCGCCATCTCTAGCTCAACCCGGGCTTATTTTGATGCGCGCCTTGCACACTGATGAGGGGCATGTGTCTCACCACTCTGCAAGGCTAGTGGTTCGGGTATTGACTTTCTTCCGGAAGTCCCCTCCCATTCTAAAGATTTTCATTAGTTTTTACTTGGAGCGTCTCCACTAGGAAGCTGCCGCTGCGGTATGTACACTTTTTGAATCGACTGCAGTAAAGGTGGAGTTTGTGTAGCCTTGTCTTGAGTATACCATTTTGTATAAAACGTAGGACGTTATTGCGG

mRNA

>Mapoly0156s0012.1
TCGTGGGCGTGGAGAAGCTGCCCTCGTCGCAGTGTTCGGTTCGTGTTCGCTTCTCGTCTGTTGTTCTAGCTAGGATTGGGTCTGTCGAGACGATTGCATCGAGCTCACCTGCGGAGGATTGGTAGCAGTGTGTGAGAGCTCGTCGTCGACTTTTCTCCTCTTTCGAGCAATTCTGACTGTTGTCTGTAACGCTTGAAGCTCGCCGCTGCATACCCTGGTTTCCACCTAGCTCTCACCTCCCCTCTTTTCGCATGCGTTGTTAGTAGTGCCTGGTCCTCGGAGGTTGAGAGCAGTGTAATAGTTCTCTCTGAGAGGGAGAGAAAGAGAGAGAAAGGAGAGTCAGCACGGCAGGTGCTTGCCTTCTCTCTCCCTCTTTCTCTCTGGACGTTCAGAGAGAGGGAAGGAGGCAAAAGTAACGTGAGGTCAGTGTTTCTTATTCGTCTGGGTTTACTCCAGACGAGTGACAAACACTAGCAACACCTGCCTCCCTCACTCTCTCTAGTCCCTAGCTCTCTTCGTTCAGTTTTTCTTTTGTTTTCCCCCTTATGTTCATTACTTCTTCTGTACGTGCTTCTGTCAGTGACCTTTAAGATGCCTTGACTGCGCAATCTTCCTGTTTCTCAATCCTCACCACTACCCGGTGGTTGTGTATTTGTAAAAAGCATTCTCGAAGTAGACAATGTCAGATTTGCCCTCTCATTGTACATTCCTCCCTCCAAGCGAAGTAGCCTCCCTGTTTTCCGAAGGCTTCAAACAGGTCCAGGCCTCCGAGGACGGGGCAGCTGAACATCACATCGTAACTAAGTAGAGTTCGAGAGGAGTAGGTGGCTCATTAGGAGCTCGCGTAGGTTGGAGTTCTGATCCTGCAGTGCCATCTAGTGTGGTAACGCAAAAGAAGGAGAACCACACTGATTGTAGCCATGAAGAGAGGTTAAGAGTGGGCACCGTGGCTTTCGATATCAGTGAAGGAATGAGGTTGGGGGGTGTGACAGTTACGGTGACAGCGAACGGAGGGGGAGTAGGGCCGAAATATCTCTCAGAACTAGCTGTTATGCCATCCTCCGTAATGGCCCCTCCGAGACTAGCGCCACCCAATGCAATGGCGCGGGGACCCCAAAAGAATGTGTTTACATCTCCAGGCCTATCTCTGGCACCGCCGAGTGGGCTGGAAGGTCAGCCTCAGGTCAGCCAGAGTGCTGAGAGTGAGCAGGTGAAGCAGAAAGACAATGAGGAGTATGAGAGTAGATCGGGTAGCGACAACATGGAAGGAGGCTCTGGGGATGATCAGGACCCTGATCACCCCCCGCGCAAGAAGCGCTATCACCGCCACACCCCGCGCCAGATCCAGGAAATGGAAATGGTGTTCAAAGAGTGCCCACACCCAGATGATAAGCAAAGGCAGGAACTCAGCAAGGAGCTCGGCCTGGAGCCTCGCCAGGTCAAGTTTTGGTTCCAAAACAGGAGGACGCAGATGAAGGCTCAGCAGGAACGAGCTGAAAACTCTATGCTACGAGCTGAGAACGAGAAGCTTCGTTCTGAGAACATTACCATGCGAGACGCCATGAAGAACGCCTCCTGTCCGCACTGTGGGGGTCCTACGACGATGGGAGAGATGTCATTTGATGAGCAGCAGCTGCGCATAGAGAATGCTCGCCTCAAAGATGAGATCGACCGCGTATCAGCACTAGCTGCGAAGTATTTGGGGCGCCCTGTCGCACCAATGAACTCTTTACCCCCAATGTCAACGTCCTCCCTAGAGCTACAAGTTGGAGGTAGTTTTGGAATGCATCAGGGAACTGGCACTGACCTCGTACCTCAAGGCCCCTCCGTAGCTGATGTGGCGACACGGCCAGGTGGTCTGTCGGATGCTGAGAAACCAATGGTCTTCGAGCTTGCTGTCGCAGCTATGGACGAACTCGTTCGCCTTGCGCAATCAGACGAGCCGTTATGGATTCCTGGTCACGATGGTGCGAAGGAAACATTAAATTACGACGAGTACGTGCGTCAGTTTCCCAGAGGGATTGGTCCGAAGCCTTTCGGATTGAAAACGGAGGCCACTCGAGAGACTGGTCTAGTCATGATGAACGGTGTTACTTTGGTGGAGACTCTAATGGATCATGTTCGATGGACCGAAATGTTTCCCTGCATGGTCTCTAGAGCACTCACTGTAGAGGTTCTCTCTACGGGCATCGGCGCGTGCAATCGGAATGGCGCTCTTCAACTGATGTACGCCGAGCTTCAGGTTTTATCTCCCCTTGTTCCCACACGTGAGTGCTACTTCTTGCGATTTTGCAAGCAGCATGGCGAAGGAATTTGGGCTGTAGTCGATGTGTCTGTCGACAGTCTCAGAGACAACCCACCTCCGGCGTTGATGCGTTCTCGAAGACGGCCTTCTGGATGCCTTATTCAGGACATGCCGAATGGTTACTCGAAGGTGACTGTCCTCGAGCACATGGATTACGACGACAGAACCGTGAACCGGATGTACAAATCCTTAGTAAATAGCGGCCAAGCTTTCGGAGCACAACGATGGTTAGCCACCTTACAAAGGCAATGTGAGCGTCTTGCAAGCATGCTGGCCAGCAACCTCTCTCAGAGAGATCTAGGTGGTGTGCCGACTGCCAATGGTAGACGAAGTATGCTCAAGCTTGCTCAAAGAATGACAAACAACTTCTGCGCCGGAGTTAGCGCTTCTACTGTCCACACGTGGACTACATTGGCAGGAAGTGGAGAGGACGACGTCCGAGTTATGACTCGCAAGAGTGTCGATAACCCCGGTGAACCGCATGGCATCGTTCTCAGCGCTGCTACTTCGCTATGGCTACCCGTGTCCCCTCAGCGAGTTTTTGAGTTTCTGAGAGACGAACGTCTCAGACATGAGTGGGATATTCTGTCCAATGGTGGGCATGTAGCGGAGATGGCTCACATTGCGAAAGGCCAGGACCCTGGGAACAGCGTGTCACTTCTCCGAGTGAATGCTATCAATCCTGGACAAAGCAACATGCTCATTCTCCAGGAGAGTTGCACCGACGTGTCTGGCTCTCTAGTGATCTACGCACCTGTTGATATTCCCGCGATGACCTTGGTATTGCAAGGCGGAGATCCCGCCTACGTAGCACTGCTACCTTCAGGCTTCGCGATCCTACCCGACGGTCCTGAGAACCGCCGCTCGCTTGGGGACGGTAGCGGCCTTCCTGAAAGCCCAAGGAGAACAGGCGGAGCGCTGCTTACAGTAGCGTTTCAGATTTTGGTGTCCAGCGTGCCATCGGCGAAGCTATCTCTCGAATCTGTGGCAACCGTCAACAACCTTATCTCCTGCACTGTCCAGCGAATCAAGCAAGCTCTTCAGGTGCCCGACGAGTCTTGAATATGAATATCGCCTTGGGGATGGGTTACTTGGTGAAATCTGCACAAGCGGTTTTCACTCTGCATACTGACAAGAAAGGGAGGAAGTGACGACGAAGGTAAATGCCGAGGAGGGAGACATGTTCTCAGGTTATCGCAGGAGCAGGGTACAGAAAGTTGAAAAGAGCTTCGCTTCGGGAGTGTGACGAAGTAGACATGCTCGTATCTAGTGCTTGTGAGAGCGCGATGGTTGAGGGGTACTCAACACCTTGTGAAGCTCACATTGAGCACGGTGTTGAGTGCTCCTCACATCGCACTGGTCTCAGGCCTGTCGTAAAGTCAGTCAATCAGGATTAGCAGTCAGCTAGGTTACAAATCTCAGAACGTTGACAAATAATGTCGAATCACGCCTCCTTTGGAGTGCTTTTAACCATCAAAGACTTTGAAGTGGAACGGACGTGCAGGAAATAGTCAAGAACGCACCACAGATGCCTCCTTGCTAAGTGGTAAGGCATTATGCACCCGAGTGTGCCTGTGCGCCATCTCTAGCTCAACCCGGGCTTATTTTGATGCGCGCCTTGCACACTGATGAGGGGCATGTGTCTCACCACTCTGCAAGGCTAGTGGTTCGGGTATTGACTTTCTTCCGGAAGTCCCCTCCCATTCTAAAGATTTTCATTAGTTTTTACTTGGAGCGTCTCCACTAGGAAGCTGCCGCTGCGGTATGTACACTTTTTGAATCGACTGCAGTAAAGGTGGAGTTTGTGTAGCCTTGTCTTGAGTATACCATTTTGTATAAAACGTAGGACGTTATTGCGG

CDS

>Mapoly0156s0012.1
ATGAGGTTGGGGGGTGTGACAGTTACGGTGACAGCGAACGGAGGGGGAGTAGGGCCGAAATATCTCTCAGAACTAGCTGTTATGCCATCCTCCGTAATGGCCCCTCCGAGACTAGCGCCACCCAATGCAATGGCGCGGGGACCCCAAAAGAATGTGTTTACATCTCCAGGCCTATCTCTGGCACCGCCGAGTGGGCTGGAAGGTCAGCCTCAGGTCAGCCAGAGTGCTGAGAGTGAGCAGGTGAAGCAGAAAGACAATGAGGAGTATGAGAGTAGATCGGGTAGCGACAACATGGAAGGAGGCTCTGGGGATGATCAGGACCCTGATCACCCCCCGCGCAAGAAGCGCTATCACCGCCACACCCCGCGCCAGATCCAGGAAATGGAAATGGTGTTCAAAGAGTGCCCACACCCAGATGATAAGCAAAGGCAGGAACTCAGCAAGGAGCTCGGCCTGGAGCCTCGCCAGGTCAAGTTTTGGTTCCAAAACAGGAGGACGCAGATGAAGGCTCAGCAGGAACGAGCTGAAAACTCTATGCTACGAGCTGAGAACGAGAAGCTTCGTTCTGAGAACATTACCATGCGAGACGCCATGAAGAACGCCTCCTGTCCGCACTGTGGGGGTCCTACGACGATGGGAGAGATGTCATTTGATGAGCAGCAGCTGCGCATAGAGAATGCTCGCCTCAAAGATGAGATCGACCGCGTATCAGCACTAGCTGCGAAGTATTTGGGGCGCCCTGTCGCACCAATGAACTCTTTACCCCCAATGTCAACGTCCTCCCTAGAGCTACAAGTTGGAGGTAGTTTTGGAATGCATCAGGGAACTGGCACTGACCTCGTACCTCAAGGCCCCTCCGTAGCTGATGTGGCGACACGGCCAGGTGGTCTGTCGGATGCTGAGAAACCAATGGTCTTCGAGCTTGCTGTCGCAGCTATGGACGAACTCGTTCGCCTTGCGCAATCAGACGAGCCGTTATGGATTCCTGGTCACGATGGTGCGAAGGAAACATTAAATTACGACGAGTACGTGCGTCAGTTTCCCAGAGGGATTGGTCCGAAGCCTTTCGGATTGAAAACGGAGGCCACTCGAGAGACTGGTCTAGTCATGATGAACGGTGTTACTTTGGTGGAGACTCTAATGGATCATGTTCGATGGACCGAAATGTTTCCCTGCATGGTCTCTAGAGCACTCACTGTAGAGGTTCTCTCTACGGGCATCGGCGCGTGCAATCGGAATGGCGCTCTTCAACTGATGTACGCCGAGCTTCAGGTTTTATCTCCCCTTGTTCCCACACGTGAGTGCTACTTCTTGCGATTTTGCAAGCAGCATGGCGAAGGAATTTGGGCTGTAGTCGATGTGTCTGTCGACAGTCTCAGAGACAACCCACCTCCGGCGTTGATGCGTTCTCGAAGACGGCCTTCTGGATGCCTTATTCAGGACATGCCGAATGGTTACTCGAAGGTGACTGTCCTCGAGCACATGGATTACGACGACAGAACCGTGAACCGGATGTACAAATCCTTAGTAAATAGCGGCCAAGCTTTCGGAGCACAACGATGGTTAGCCACCTTACAAAGGCAATGTGAGCGTCTTGCAAGCATGCTGGCCAGCAACCTCTCTCAGAGAGATCTAGGTGGTGTGCCGACTGCCAATGGTAGACGAAGTATGCTCAAGCTTGCTCAAAGAATGACAAACAACTTCTGCGCCGGAGTTAGCGCTTCTACTGTCCACACGTGGACTACATTGGCAGGAAGTGGAGAGGACGACGTCCGAGTTATGACTCGCAAGAGTGTCGATAACCCCGGTGAACCGCATGGCATCGTTCTCAGCGCTGCTACTTCGCTATGGCTACCCGTGTCCCCTCAGCGAGTTTTTGAGTTTCTGAGAGACGAACGTCTCAGACATGAGTGGGATATTCTGTCCAATGGTGGGCATGTAGCGGAGATGGCTCACATTGCGAAAGGCCAGGACCCTGGGAACAGCGTGTCACTTCTCCGAGTGAATGCTATCAATCCTGGACAAAGCAACATGCTCATTCTCCAGGAGAGTTGCACCGACGTGTCTGGCTCTCTAGTGATCTACGCACCTGTTGATATTCCCGCGATGACCTTGGTATTGCAAGGCGGAGATCCCGCCTACGTAGCACTGCTACCTTCAGGCTTCGCGATCCTACCCGACGGTCCTGAGAACCGCCGCTCGCTTGGGGACGGTAGCGGCCTTCCTGAAAGCCCAAGGAGAACAGGCGGAGCGCTGCTTACAGTAGCGTTTCAGATTTTGGTGTCCAGCGTGCCATCGGCGAAGCTATCTCTCGAATCTGTGGCAACCGTCAACAACCTTATCTCCTGCACTGTCCAGCGAATCAAGCAAGCTCTTCAGGTGCCCGACGAGTCTTGA

Protein

>Mapoly0156s0012.1
MRLGGVTVTVTANGGGVGPKYLSELAVMPSSVMAPPRLAPPNAMARGPQKNVFTSPGLSLAPPSGLEGQPQVSQSAESEQVKQKDNEEYESRSGSDNMEGGSGDDQDPDHPPRKKRYHRHTPRQIQEMEMVFKECPHPDDKQRQELSKELGLEPRQVKFWFQNRRTQMKAQQERAENSMLRAENEKLRSENITMRDAMKNASCPHCGGPTTMGEMSFDEQQLRIENARLKDEIDRVSALAAKYLGRPVAPMNSLPPMSTSSLELQVGGSFGMHQGTGTDLVPQGPSVADVATRPGGLSDAEKPMVFELAVAAMDELVRLAQSDEPLWIPGHDGAKETLNYDEYVRQFPRGIGPKPFGLKTEATRETGLVMMNGVTLVETLMDHVRWTEMFPCMVSRALTVEVLSTGIGACNRNGALQLMYAELQVLSPLVPTRECYFLRFCKQHGEGIWAVVDVSVDSLRDNPPPALMRSRRRPSGCLIQDMPNGYSKVTVLEHMDYDDRTVNRMYKSLVNSGQAFGAQRWLATLQRQCERLASMLASNLSQRDLGGVPTANGRRSMLKLAQRMTNNFCAGVSASTVHTWTTLAGSGEDDVRVMTRKSVDNPGEPHGIVLSAATSLWLPVSPQRVFEFLRDERLRHEWDILSNGGHVAEMAHIAKGQDPGNSVSLLRVNAINPGQSNMLILQESCTDVSGSLVIYAPVDIPAMTLVLQGGDPAYVALLPSGFAILPDGPENRRSLGDGSGLPESPRRTGGALLTVAFQILVSSVPSAKLSLESVATVNNLISCTVQRIKQALQVPDES

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>