Mapoly0162s0017



Description

SWI/SNF CHROMATIN REMODELING COMPLEX COMPONENT

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005515 Protein binding
GO GO:0005524 ATP binding
KOG KOG0383 Predicted helicase
OrthoMCL OG5_170732
PFAM PF00176 SNF2 family N-terminal domain
PFAM PF00271 Helicase conserved C-terminal domain
PFAM PF00385 Chromo (CHRromatin Organisation MOdifier) domain
PFAM PF00628 PHD-finger
PFAM PF00855 PWWP domain
PFAM PF06465 Domain of Unknown Function (DUF1087)
PANTHER PTHR10799 SWI/SNF-RELATED MATRIX-ASSOCIATED ACTIN-DEPENDENT REGULATOR OF CHROMATIN SUBFAMILY-RELATED
PANTHER PTHR10799:SF131 SWI/SNF CHROMATIN REMODELING COMPLEX COMPONENT

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB20 transcription factor, MYB Mapoly0162s0017.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0162s0017.1 scaffold_162:265675..286198  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0162s0017.1  

Gene structure:

mRNA scaffold_162:265675..286198  ( - strand )
three_prime_UTR scaffold_162:265675..266250  ( - strand )
CDS scaffold_162:266251..268866  ( - strand )
CDS scaffold_162:269070..269976  ( - strand )
CDS scaffold_162:270360..270433  ( - strand )
CDS scaffold_162:270782..270896  ( - strand )
CDS scaffold_162:271235..271374  ( - strand )
CDS scaffold_162:271906..274983  ( - strand )
CDS scaffold_162:275354..275569  ( - strand )
CDS scaffold_162:275841..275942  ( - strand )
CDS scaffold_162:276891..277367  ( - strand )
CDS scaffold_162:277503..277604  ( - strand )
CDS scaffold_162:277918..278445  ( - strand )
CDS scaffold_162:278662..278725  ( - strand )
CDS scaffold_162:279740..279796  ( - strand )
CDS scaffold_162:280087..280124  ( - strand )
CDS scaffold_162:280505..280714  ( - strand )
five_prime_UTR scaffold_162:280715..280718  ( - strand )
five_prime_UTR scaffold_162:281074..281148  ( - strand )
five_prime_UTR scaffold_162:283249..286198  ( - strand )

Sequences:

Gene

>Mapoly0162s0017.1
TGCTTGGCTGCCATGCCATGGATGGCATGCAACAACAAATCTTGGAGAAAGGACGGTCCGGTCTGGTCACGTCTGAACTGTGTCACATGTGTCAGTTTTAGAGTGACTTGACACCCATCGACTCTTGACTATGATAAGTAGAGAACCCCAGAAGCGAAACAGTCCAAGAGACTCCGAGGGAAACATTTTTTGGATTGAACTCAACTCAGCTCCGCTTACGAAGCTTTCTCCTGGGACCGACGTGTCCTCACTGCATTTGAAATAAGAAGAAGGCTTGGGATGGCCCGCCCGCCGGGCCTCGGCATCCCTTCCTTTCTCCCAGGCAGGCTTGACATGAGAAGGCAGAGAGTGAGAGGCAGCCAGCCATGCCAAGCGAGCCAGCTCGTGCTAGCTCTCAATTGCTTTGACTCTGTTTAAAGATATCAAATGTGAGTGCGACTTCCTCCATAATTACCGCGCCACTCTCCAGGCACTGTACCTTCTTCTGAGCTGCAGGCCCACCTCTCCCTCCCGTCCCCTACCCTTGCGCTACTCCTCCTACTTCTACATACTCCCTGACTGCCGGATTTTAGCGTCTCCGGCTCCCACTCCTTCTCCTGCTCTCGCTGCTCTGCTTCTCCCACCACTGTATATCTCCAGCCCGAGAACTGGCGGTGCCATCCAAGCCATGCTATGCCCCTGGGGATTGCCATTAAATTTACTCACCCAACCGAGATCTACACTGCAAACTTTTTCTCTAACTAAACATAGAGATGGCTTATGAGTCCTCATGTCGTCAGCGAAACAGCAGCATATGTGGGTGGAATAGTCGGATAAACGGCACTCGGGATGGGGATGAGCATAGAATTCGCGCACTGAGAAGAATGCGGTAAGCGGAAAGAGGAAAACAGATTAGGGTCGGGGATGAGTGACGGCCTCAGGAAGGGGGCAGTGTACACAGTGAACGAAATGAATGCAGCGAAGCAAATGGAGAGAAGATCTGCGTCCGGTGATGATGATGAGTGATGAACCGAGTAGTGAGTAGTGATGTTGCTTCCACCTCTGATCATCGGATCATGAGGTGAAGAACGATCCTCTCTCTCTCTCCAGAAAGGGAGCTGACTCTTCTTCCCTCTCCGTGCCTCTCCCTTCCATCTTATACCAGCGAGCGAGTAAGCAAGAAAAGTTCGAACGGAACGAATCCAATCCAATCTAGCTTTTCTCCTCTCACCCATCGCATACTCGGTGTGCCTGGTCCGTCTGATCTGAGCAAACCTCCGCCAGAGCGTCATGAGATCAAATCGCAACCGACAACAACAAAATGACATGTCGTATCCACCCTACTGTAGCACTCTTCAATAAAACCCTTAGAGTATATAGTGGAGCGGTTTCACATGATAATGATGTTATCACTCACTCCGGTCTTAAAGACATCAGGCTGGTGATACCAAACTGCCGATTATAAGGACGAATGTTCTGGCACCGAGTAAGAAGCAGATTCCTTCAACATGGGAATGTAATTACCGTTCGTAGAAAGGGAAAATAATCGCCGGGCGGATGAAGACGCAGTAGAAGATAGAAGAAATTGCGACTCCCGGAACGTTTGAATGAATGTATGCATGAATGATTGAAGAAGAAGTTTGAAGCAGAGAGACCAGAAGTCGGAGGATGTTAGATGTTGGGCGGGGACGCAGGCGAGACTCTCTGGCTGCTTTTAGAAGCACGAATGAGGGGAAGCCACGTGGCTGACCGCCGCAATCGTGCGCTTTGGAGACCCGACCTACTGCAGCGCCCCACGTGGTGGTTCTATGCTCGTGATTGTCCTGCTCCGGCTGCACACATCAGTCCTGCTCTTCTGCAATGCTCTTCGCTTGAGGTTTCTTACGATCATTTGCCTTGCTAGGCCCCAATTCTTTCTCATAGCGTACACTTCGGCTCACGCTCTCCATCGGCTCTTGCTTACATCCCACTTCTTTCTTGCTTGACCTCGTTCGTTGGCGTGCATAGCACACAGTGTTATTCGCATGAGCATCATCTATCTCTTTCATTCCTGCGCTCTGCCCCCTCATCCTGGTCCTGACTCTTATGTCCTTATGTCCTTACCACCACCACCTGTTCCTGCCCGCTGCCGGTACTGCCGCTGTAGGCAGACGCGCACTTTGGAGTGGAAGGACCCCTTCCAGCAGCGAGAGAGAAAGATAGGGGTTAGTTGTTGGAGAAGCTCGAAGGTTTGCTCTGGGTTTGAATGAAGGGTGTTGCCGCCCTCCCCGCTTGGCTCCTTATGGGTACGAAGGAGTAGGCCAGACATGGTAGGTGGGCGCTTACGCTTATGGTAAGCAGCTCGTTCCAAGTTTTTGTTTTTTCCGTAAGAACCCGAGTTTGTGGTGGTGACGTCTTGACGAGGTAAGGAGGAATCATAGCTCGCTCGAGGACGGGGGACGGGGATAGCGTGTGATGCAAGGGTGCCTATGTCATCAAGATTGCTTGTGAGCTGAGGAAGGGAAGCGAAGAAAGCAGCACAGATAAGGACTTTACCCGACGGGAGGCATGAGGATCAGAGTTTTGATTACAGGAAGATAGGCGGTAGTGGAGCATTTCAGGTTCGAAGGAGAGCAGAAGACTGGTAACCTTATCTTTTAAGTGTCGAGGAGATCAATTCTCTAGCATTGTTTGTAGCACCGGGCACTATTTCCGAGGTGGACGAAGTACACTGGGTGGAGGAAAATCAGGCAGTCTTGACAGTGTGGCTTTTCTTGGGACTTATCGGTTGCCCATCATCTTGGTAGCAGAACAGGGAGCGGGTAAAATACATCGACATGTCGAAGGAAGCTTTTAACATCCTCGTCGTTACATATTGCTCATAACCTGCCCTCGGAAGGACAAGGAGGCGAAGTCGTTCACGGAGTCGTATTCTTATTGGGGCCACTATCGTTGGAAGCCACGCTTTCAGGGATACTCATGAGGAGCCGTGGTGAGTTTGATGTCGCCCGGTCCCATGGACCGATCAATTCTACCTTCTGTTCATTACTTAGGCCCGTGTGATGCTAAACTCTTGCCTTTAGGTCTCTCAAGCCAATTGAGATGCGGCCCAAACAATTTCGGCTTGTTGTTTCTGGCCATCTGCTTGCAGTATGTACTCTACGTTCCGATTGAGGTTGTTTTTCAAGAGTGAGTGATCCTTTGGGGTGCTTCCCGCGGGTCAAGCTTAGATGTTTTTTCAATTGGAAGGACAGAGTATTTAATTAAAAGAAATTCCCTTCCACATAAGAAACTCAATGAAGATCAAATTTGGTTCACGCATGTCACAAGGATCCGTAGAAGCTGATGATGAACTCAATTCACTGATCGCTGAGTCACTCTCACTTGTTCGCTAAACTTGGGCTTCCATAAAGCAGTTCAGTATGCTGTTTTGTGGCTTTGCTCTTCAATCGTCTTTCGCATGTTTTCCAGGGAAAGCAATTTGTGTCTTAATCTTTGTCTTACCACTTCATCCCCTATTTTTCCCTTCAACTCCAGATGGCGTTGATTTATGCCATGCGTAATGGCAATTATGTTAGTAATGCCAGATCCATTACCTGCAACACTTGAGTTTCGTTGTTCTCTCGTGACGTACGTGTGTTAACTATGGCTTTTTTTCAGCTGAGTCGATGAAATTAAACAGAATGATTCAACCCAAGAGCATAGAGTGAAATCCGTATGATGAGAAGTCTTTTATTGGTCAGACCAATTTATAAATACAGGAAAGGGTGAAAATTGTGTCTAGCTCTCCGCAATTCATATAGAGCTGGTAAGGTGCTCTTATCGAACTTGTAAAGCTGAAGCCTGTGTTGGTTTCGCACGTAACCTTATCTAAGTCGTTTATGATCTACGGGAGTGAAATATTACGAACAGCAAACGGACAGTACAGCAGGACCTTTTTCGGATTGGAGGCGTGAGAATCACTTAATTGTGTTCGTATACACGTAGTTGTTTAGTGAGAAGTCGGTTTTTGTCATCCTTCAGCGAGGCAATCCCCGGGAAGATGTGGCACGTATGAGTTCTGTGTTAATATCTCCCCCTAATGGAAGCCACCTTATCGTTACATTCCTTAATAAGTGCACAGTTCACGTGCGAGTGAGGCCATTGTCTGTCGTCCTTCACGGTCGTCATCGAGATTATCGATTGACTCTACCAAAATTGGTTTTGGTATCCCGTGATCATGTCAGATGGGTTTTCAGTTGGTCCGGAAACACGGTGACCATTTTGATACAAACTCAAAGGTCTTGTCATGGTTACGTAATCGACCTCATATTCATCATTTTGTGGATCATTCTTAGGCTATACAAGTTCTAACGATTTCTGATTTCGAGTTTCCGTGCTATTCAATTTGACGTGAATAACAGCTTCCCGCGTAGTTTCCGGTAAGCAGCTACATATTAAATACTGCAACTCACTTGTCCTGTCAAAGCTTCATCTGCCACCAGCATTTATATCCTTATCGGTCTGTTGAACCTCCGAAATATCGTATCAGATAGGTACTTTGTCGCTGGAAAGAACTTTGAGAGGTCTTTGGGCATTAGAAGCTCTTCGCATGCATGACTTAAGATCACTATCGTCTCCAATGTGGATAGGTGGCCACTCAGTTTCAACAGGAAATTAGCGCTGGACCACTACGTTAGTCTTATCTAAGTGCAATCTGTTTATCCACCAGATGTTAAAGAAGTGCATGGTAGCTTTCACGGAATGTTTTCTTGAAGTTGGAGATTGTTCTGGTTAGTGAGCTCTTTGAAGTACTTCGATATGCAAAAAACGGACTGTGGTCTGATTTGCCTCTGATTTGCTCTTATTATACCACGAAGTATTCGCTCGAGATCCAAGCTCTCGTGTGACAAAAAGTCAAAACTCGATTCAGGGACTCTTTACTTTGTAGTTCCACCTGCATTCCGATTCCTTGTTCTGGTTTTATGCTTGCATGAGGAATGTATTGTCTATCGTAAATTAGCATTGATTTATGATGTTCAATTAGTCCTGGCGTTCTCTGAGTTCCGACGACTTTTTTGATTTTTGGAAACTTTTTGCTGTCTTGTTGCAGAGTATTTGGGACGAAAGTGAGTCCAGCTGACTGATGCATATCACTGTTTGGAGGTTACCCCAAGCAGACACCGGGGTAAGTCCACTTCGCAGGTCAACATATCTTCAGATGGCATAGGTCCAACGACACATATATGTTATGATTGAACGAAACGACATATTCTGATTGGAACACAATTCTCGTCAAAGGCGGTGGAGGGTTTAGAATATTGAGTTCTTCACATATAATTGGAAGGCGTAACTTCGCATTTATATTTTAATACCTCACTTCGCTGTGTTGCAAAGTTCGTTTCAGTGTTTGCCTTCTGCAGATAGGGAACGACCTCTCGTCGTTTATTTGCAACTATACGGACTTGAAAGCATGTGGAGGCCACATTCCTTCCTTCAGTGCAATTTATGTGAAGGCTCTAACAACCTTAGTTTCTTCTCAGGATAATGAGTAGCGAGTTGCCAGTTGAAGTACAAGTCCCAGTCCTGGCAAGCTCTAAAAAACAACGGAGTGCGCGGAGCACAGCTAGGAACGGCTGGGGGCCAGGACAGCCTGAGACACGTAGACTTGTAGGATGCAGCTATGTAAGCACAACATTTCCCCGCCATACGTTGGTTTGGGCAAAGCGGGATAATGGAGTCTGGTGGCCAGCTAAGGTGAGTCATTCATAAAAACCAAAGCTCCCTCAGCCTATTATCACTTACTCTTTCGCCTGGATAGAAAATCAATTCAGTCATGTTGGAAGACATTGTACAGAAACATCGCATTGATTTTATGGGGAAGCTTTGACTCAATTCTTAGGGTCTTCAAGCTGAAGTTCGACCTACAGTCTAAGCTGGGAACAGGCATCTCAAGTGATTCTTTTTCTGCTTAATCTTGTCTCGCAAAACGTACTTGCTCAATAAGTGACGTAGATGGATTTTTGCCACGTAGGATTCTGAAGCAATCAAACATGTTGTTGGTGCTCGACACGCAAGTACTTAGCGGATGTTGCTCAGATTTACTAACATTCTCTTTTGTATTTCCGGTATTTAAGGTTGTGGGTGTTGACGAAATACCAGAGGACCTCAAGAAGTAAGTAACCCCTTGTGCAAGCTTCATGTTGGAATTTCTATCTTGGGTCTATAGTTATCAGGCCATAACAGGCACACTGTGAGAGTACAGGTATGTGCTGTAATCGCCGAAACTGTACTAGCAAAGTCGGGGTGCACATGACGATTAGTACTTGTAATTTTCAGCTGAACTGCTCACGTACTTTTAAGATAATATGACAGTTAATATTTACTTGGTATTTTGCAGTCTTTTTTATTTATAGATCGCCTCGCTGATCAGAATCCGATTGCCAAACTTTTTTTTGTCAACAGGCAAGAAGAAGGTTGGACATGTGTAAAATATTATGGAATCGATGTCGCCCAAGCCTTGTAAGTTAATTCTCATACTTGTCTTTGTTAAAACAGTTTGGTCTCTCCTGTTCGAATAGCCATTTCAGACGTAAGTTCGTCTTTCCCTTTTGATGAAATGAAAATTTTAACAGGTATATCCTATTATGACATATTGTAACATTTCGATATTCTATTGTTTTCAACGCATTTCCCTTGAAACCTGCGTTGTCTGATGCTTTCATTTTATGTTCTCAACCTGCAATCCAAAGTTTGTGGTTCTTTGGGAGTAGCCTCTAGAGTCTGGCTGAATTATACTTTTCACTTCATTATTGTGTTTCCCGGTCTGCACCTAAATGTTCTGGTTACTTGAGACAGTTTCTCTTCTGGAGCCTTATTTATCACATGTTTGTTGTTTTACTCTCTCTCCATCCCTCTCACTTTTCTTTTCTCTGTTACCACGAGCACTGGTCAGAGTGACGGCGCCGGGTCTGTAGTTTTTAGTCTACGATGGGCAAAGACGAATGTGATCAGTTCTGCATTAGTTCGAAATGTAGTACTTTCATCCATTATGTTTCATATGCTTTGTGTGGAAGATATTTTGCACTTGAGGCGATCTGCGTAACAACGTTTGTTGATATATATGTTATGTCTAGTAATAAGTAATTGTGTATTGAGGATGGTTACCTTGGTTACTATCAACGCTTGCTATGCATACATGCATGACTAAGTTTGGCAGACTAAGTAGAACATCAGGAAGAGTATCTAAGTAAGCTTGTCAACCTCTCACATTCAACTTACACAGTTGAATGTGAGAGGTTGAGAGCCATTTTGATTCGAATATTCCACTGCGTAACTTAGGATGTTCGAACCAATATAACTTTTATAACCTTGTCTTGTAGGTATATTTTTCTACTTTATTACGCATTATATACCACAATCATCCGATCATTCTTGCATGACACATTTGATGTATTTGCGAGTTGTAGGTCAGTTGAAGATGTATGTAGTTCTTAGTGGAGTCCCTAATTCATCGTTCCTATTCCATATTTGCAGCGCTTGGTTGAAGTCCGAAGACTTGTGTTCTTACGACAATCACTTAGAAGAGTACAGTAAGCAGGTAATACTGCCAAAAAACTATATGAAGTTTTTGGATCTGGAAAGTTGGAACTTTCCGTGACGTTTTTATATCTTCAGTATCACATTATCCCCGCTTATTACTAAGTTCTCCTATCGATTGTGAGCACGCATTGCGTCTTTATTGAGTTTTCTCTGAATCAGATGAATCGAGTTCGGACCAGGTTGATTAATTTTCTGCTTTGTTACCATTGAGCAGCATTTACCTGATGGCATCAAAGCAGATGAATTCAAGTCAGCTATGACTGAAGCCCAAGAGGCCGCCAATAATCGCGCTGACAACGCAATGGTAAAACCGACGAGTGTCATTGCAAAGCCTCAGGATATCAAAAGCCGGATGACCCCACGTGTTGAGAAGGAAACGGCGAAGGAAGAAATAGCTGCACCGAGTGAGGATACTGAACAGGCTCCGAAGCGGAGAAAATTGAAACTCAAAGGAGTGGACAAAGTCCCAGTGAAGGAATCTACTTCAAAATTCCTTTTGAAAGGGAAGGAAGGTACCAAGGATGCTAAGGTTATTGACAAGAGCGTTGAATTGACAAGAAAGCGGAAGCGAATGTTGAAAAGGCCACAGACTGGTACAAATGATCACGAATTGCCCAAGGGTGAAACACTCGAGTCACCTACGAAGAAAATTGGATCTCCAACTGGCAACTCAAGCAGCCTCAACTCGCGCGATCCAGCTAAGAAGTCCAGTTCTCGAGGAAAGAAAACAGGTGACGATGGGGTAAGTTCGGAAGACAAAGCTCCAGGCGATAGCAGATGCATGTTTGCCATTCTTCCAGAAGGATATTGGAATGAAATCATTAAGAGGCTTTACCTTGAATAAAGAGTTCAAAGATATCACATATTAGATGTAAGAAAGAAGATCCGAGTAGCCGAAAATGTGGTCTCACATCTCTCTAAATTACTTATTTTAACAGAGTCATCCAGCTCTAGCATACTGCCGTATATTTTACAGTCAAGGGGTACTTATGCGAGGAGTCTACGATTTATGTTAGCGTTTGAAATTATTGTCGTGTGCAATCTGTACCTTGCAGTATTATTTCGAATGCATGGTCTGCGATATGGGAGGAGACTTGCTGTGCTGTGACCTTTGTCCACGAGTTTATCACTTGGAGTGTCTCAGTCCTCCGCTGAAGGTAATTGACATCATTAGCCACAAATCTTAGATGTTTATCCTTTTGCATAAGTGTGTTAGAGGCCTTGCTTCTCCTACATTTATCCCTTAAATGTTGTTCGTACTTTCAACTAGAAACCTCCATGAAATTTTGCAGCGTACACCTCCAGGCAAGTGGATATGTCCTGTCTGTAAAGAACTACCTGGAGCAGCTAAAGGTATAATTCAGACACCAGATTCCAAGCCTAGGTTCAAATCAACTACACATGTTGGTGAACCTTCTTCTCATGTTACGGGACACAAGCTCAAAGGGCTAAAACGTGGATGGAAAATCTTCCATAGAGGGAAGCCGATAGTTCCGGACTTGGACATCAAAAAGTTGCGAAAGAGGAAAAGAGATGAGGATTCCGAAAGATCCAGGAAAAGGCTCAACTTGAAATTGAGTCGACCGTTTAGTCAAACACAAATTAAGTGTAGGCAGTGTGGCGCTGGCATTCATTCATCAGGGGAGTCTTCAAGCAATGTTCTCTGCAAGGAGTGTGTAGAGTTGGTTAAGCTAAAGAATTCTACCTTACCAGCGAAGATGTTGGCTACTCCGAGGAAGGACATGATACCAACTAGACACTCAAAGCTGGTAAACTTCTGGATCCATGCCTCAGATCATGTTTTTATTAAATGCAATTTACTTTACACTTGTCCTCGTTCCATCTTTTAAAGCAGATACTATCACCATTTGTATAGGTTCATATGCTCCATATATTGTTAGTGCAAGCCGAATACGGAAATCAAGTACAAAGAATATCTGAAATGTGGATAAAGGTATTATGTGAGGAATTGTAAACTGGATCAGATGTAAGGAAGAATCAATCAGATTAGAGCTTGTTATGAGATTGCACAAATTGCCTAGTGTTCATTATCTTAGCCGCGTGTTTCTGGCCATTAGCAATTCAGCCTCTGCTCAGGAAGAAGCAACCTTTGTTACCCGACACCGGAAAATATACACCTGGTGTGCCCCAAACTTTTATAGAAGTTGGCCATAGCAAACGAAGATGAGTTTGCACTTGGGTATGAAAACTAAAGAAAGGCACGTCGTTTTGCTGTATCCTACTATTCCGATCTACATATGTACAACCTCTGCTTCGTGCGTTCTCGAAGCAGGCGTTAGATATTTGAAGGATCTTTTAAGTGATCAAGACTATAAAAAGTGAAATATAGTATTTCGGTTCATCAACACTATAAAAAGTATGGACAGGCTTCAATGTCTGAACTGCGCTCTCCTTTCTTTCCTCTCGTTGTCCATAAGTAGAAGTTGATTTGCTCCTAAGCGTTTTTTAACCCTCAGAAAGACCCTTTAGCTTTGTGTACTTCAGGGCTCTTCGTTGGAATTTTTGACCTCTGTGTTCTCGGTACTCGTATTTTCAGATCAGATAGTCTATGAGGATATAATAAGAGGAACATGACGTTTCTGAGTGGCCTTTGGCGCAGTTTTGATTCAATGTCAATTTGATGTTTTTGCATTGAAGATCAAGTTGATCTCTAGGAACGGCGAGGAGAGGAATTTACCTTCAATCGTTGGTTGCAGAAACCAGGGAAGTGTGACATCTGTCAGCAAGATGGGTTTGTGATCCTCTGTGATGTTTGTCCAAGAGGGTATCACAAAGACTGTCTTAGCCCACCGAGAAAAGTGAGTGAAATCTCCGAGGTGATTTTCATTGTTTGTTTTGCCGTTAAAGAATAAACCAGATTACCAATGTATATCGTCTACAGCATTTAGGTAGAGAGTCAACCTGAATTTACTCGGACTCCAGCATGATAGCTTTTGTATCGATGAAATTAACAGAAAGTCTCATAATTTTATGTGTTTTTACATTGTAAGTCTTCCCACGTTACTTTTGTAAGTTTCCGATGTTGATGGACTCTTAGCTCCCAATTTTGATGGGATTTTTTTCTTTCAGAGAGCACCAAAGGGAGCTTGGTCTTGTCCAAAGTGTGGACCTTCAAAGGAGATCAAAGAGGGCAAAGAGACGAGGGAAGTACGGGAGGCTCGGGAAGCGGCAAAGGCCGCGAAAGCAGTGAAAGCAGTGAAGGTTGTGAAGGAGAAGGAGACAAAGGTTGAAGAACGTGAAGGAGGTTCTCCGGAGCCAGTGGTAGCGTCACCTGTTACGTTAGAGGCAAGTTCCACATTATACGAAACTTTGAACTCGTTTACCCTATCTGAGAACGCGAGATTACATGTACGAATACGTCCATGTTTAAAGTCTTGGTCTCCAACCCTTTGTTGTCAGGGTCTACATAATTTTGTTCACATAATTTCCAGCCTCAGAGTCGGTGCTAAGAATTGGGAACTTTTTAAAGATGCCTTTTTTGACGTTGGACACTTGAAGCTCATTGGTCGTTTTGCAAACAAATTATGAATTTAAAACTTAAAGAAAGCTTGTCTATTCTTATTCTCCAGATCTACATCTTGAATGTAGCTTGATTGTGTATATTCAGTCCAGTGTATTTAGAGTGTTCAACTGAAGCGCTTGTGGCCAAGTACAGGTCGAACGAATTCTAGGTTGCCGCTTGAGTCAAGCTACAACTTCGAACAAGGTAGAGCACAGTGAGTCTCATGCCTCCGATAAGTCAGAACGACTAGCACCGGGTGAGAACGGCTCGATATTATGGAGGAAGTCAGAAGAGAGACACGATATTGAGATCAGGTTACCAATCTGCAAGGTAGAAGATGCTGAAGGTGAACGGAATTTGCAAGAAAAAGTCGAATCGGATGATGCGAGCACGACACCTCTGTCTCTTCCTGGAGTTGGAGCACAGGGTAGTTGTTCTAATGAGAAGGGTAGACTTGGAGTCTCGGCAGACACAACTTGTGATAGATCAGCTGCTGAACTATCTACAGCGGGCAAGCTGGAGATTGATTTAGAGAAGGGAGTCTCAAATGAAGCTTCTTCGCCAGCAGAGAAGGAATTTTTGGAAGAAAAGGATGTTGGATCAGAGACTGATGCTACCAATACTTCTTGTACACCTCAGGAAGTTTGTCCAAAGATGGAAGAGCAGGTTGACGGTAGTGGATCAGAAGCATCGACAGTTAAAGAAGATGAGGATGAAGAGGGCAAACTTCTACCAGTTCTCTTTGCTCCTGAGAAATCCGATGGAAATTCAGTCGATACTCATCTTATAGCTAAGGAAAACCTTTCATCCGGTGAATCCAAAGGTCCAGAGAATTCGTTGAGCTCCGAAGGTGATGGGCTGGATATTGCTGTACCATCCTTGTCCTTGGAGCCAGCCTGCAGCACAAAGAGCTCTACAGGGACTGATAGATCTGCACCTTCGGAAGCGAGAACTGCCCTGGTGGATACGGATGATCCTGTTGCTGAATCGTCACGAGGAGGGGCTCAGAGTCCCTCCGCAGCAGTGGACTCAGCTATGAAACAATCTGATCGAGAGTTCCTAGTTAAGTGGAATGGCAAGGCCCACATACATAACGAGTGGGTCAGTGAAGAGCGTCTGCGGAAAATAGCCAAACGGAAACTGGACAATTACAAGGTCAAGTACGGTAATGCTCTTCATGTGCTTACGGAGGAACAATGGCACCATCCTCAGCGAATTGTTGCTAAAAGAGTGGGAAAGGGAAGTGTGAACGAAGTCTTTGTGAAGTGGTGCGGATTGTCGTACGAGGATTGTACGTGGGAGCTCACAAGCGAGCCTGTCGTAAAGAAGAGTGAGGAGCTTGTGCAAGCTTATGACGGCTTTGAAAAGGCAGCACAAGAAAGCTGCACAAATACTTCTGCGATAGATGCAAGTAGTCCCGATCTGTCAGATCTTAAGACGCAGCGCCCACCTGAAATCGAGGCACTTGTTGAGCAGCCAGCCTATTTGAAGGGAGGGTCGCTTTTTCCTCATCAATTGGAAGCGTTGAATTGGTTACGGAAGTGTTGGCATCGGCAACGCAATGTTATTCTGGCTGATGAGATGGGCCTCGGGAAGACTATATCAGCTTCTTCGTTCTTGGCCGCGGTTCACCATGAGTTCAAAGTAAAGGCACCATGTCTAGTTCTAGTTCCACTATCCACCATGCCAAACTGGCTGGCTGAGTTTTCCTTGTGGGCTCCATCTCTGAATGTAATAGAGTATCATGGTAGTGCCAAGGCAAGAACAATCATACGTGAGCATGAGTGGCATGCCATCGCCCCGGACGGGTCTGGGAAGAAGCTGAAACAAGTATATAAGTTTAACGTGATGCTGACTACCTACGAGATGGTGATACAAGACTCAAGTCAGTTGCGAGCGATTCCCTGGGAAGTCTTAGTTGTCGATGAAGGCCATAGACTGAAGAATTCTGGGAGTAAACTCTTTACTCTTCTCAATACGTTTTCGTTTTCTCACAGAGTACTTCTAACGGGTACGCCTTTGCAAAACAACTTCTCAGAGATGTTCAATCTACTGAACTTTTTACAGCCCGATACATTTCCATCTCTGGCTGCCTTCGAGGAGAAGTTCAGTGGATTGAGCACTGCTGAGCAAGTGGAAGAACTCAAGAAGCTAGTTGCTCCTAACATGCTTCGTCGTCTCAAGAAAGATTCCATGCAGAAGATTCCTCCCAAAACGGAGCTTGTTGTCCCAGTGGAGATGAATTCTGTGCAGTCAGAGTATTACAAAGCTCTTCTGACCAAGAATTACTTGTTGCTACGGAATGGAGCAAAGCAACAGTCCATGCTGAATATTGTGATGCAGCTCAGGAAAGTCTGTAACCATCCTTATTTGATTCCGGGTACCGAGCCAGAGACAGGTACAGCGGAATTTTTGCAGGAGATGAGAATAAAGGCCTCTGCAAAGTTGATGCTTTTACATTCAATGCTGGGCAAGCTAAAAGCTGATGGACATCGGGTCCTTATATTTTCGCAGATGACCAAGCTTCTCGATATCTTGGAAGATTACCTTACTTACCAGTTTGGAAGTGAAGCGTTTGAGCGTGTTGATGGATCTGTATCTGTAGCTGAGCGACAAACAGCTATTGCTCGCTTCAACCAAGATACTTCTCGATTTGTTTTCTTGCTCTCTACTCGGTCATGCGGTCTCGGAATCAACTTGGCTACCGCAGATACTGTAATCATATATGATTCTGATTTCAACCCACAAGCCGATATCCAGGCGATGAATAGGGCTCACCGGATAGGTCAGTCGAAGACACTGCTGGTGTACAGACTTGTGGTTCGATCAAGCGTAGAGGAGCGCATTTTACAACTTGCGAAAAAGAAACTGATGCTGGATCATTTGTTTGCAAACAAGTCCGGATCTCAGAAGGAGGTACAGGACATAATTCGATGGGGTACAGAAGAACTGTTCCAGGAATCGTCAACTCCGGTGGAGGAGACGTCCTGTGTTCCACACATGACTCATTCAGGCGATGTCGAAGGGGTAGACGATGGAGAGACAAGGCTTAAGAAGAAGAGTGGGGGTCTTGGAGATGTTTACGATGATTACTATCAAAAGCTGGGCCGCTCCAAACTTGAGTGGGACGATGCGGCCGTAACCCGCCTTCTTGATCGATCAGAAATTAGTACTCGCCATCCAGATGTCAGTGAAGGAGAACATGAAAGTGATCTGCTTGGCTCGTTGAAGGCATGTATTCCTATCCCTTTCCCTTCCTCAAGTATGAAATGTGCAAACTAATGCAGCTCTTCTTTCTTTCATTCTTGTCTTTAGTCGTCGAGAGCGAGTCGATTGTTCTAGAACCAGTCAGTGCTGTCGATGTGATTAATTTTAATCGATGTCCGAGTATGTTAAATGCTTGTGAGATTCGGAGATGCTTATTGTTTTTTTTGAAATAAGACTTGAAAATTTGAATCGTGTGTATAGAGCTGATTGGGTTTCAAGATTGGGACACTCAATACTCTATGATCTCACCGATCAAAGTTAACATTATCCTTCTTTTCTGCCTCATTGATCCGTCACTTTGCTAGGTTAGTGTCACTGGTCATCTGGTCACTGCCTATGTAATGTCTCAACGTTCACGATATATTTAGCTTCTGATGTGTCGTGTGGAATTATGAAACAGCGTTATTTATTCTTGTGAAGATGCCTCCAAAATGCCTGAGGTGATCAATTGCTGTGTTTTTACTGAAGTATATATATCTCTTCCTTTACCGTCAGGCTTGGGATTGGAACGATCAAGATGTAATTCCTGAAGAGCACGAAAAAGACGATCCTAATGGAAAAGATACTGATCTGGGGATTATGAAATCTCCTCTTGCGGAAGAGGAAAATCAGTGGGACAAGCTCCTGAAATCAAGGTGCGCTTTGTTGGTGTAATGACATTTCTACTTTTTTCTGAAATTGATCTTGTTGGTTGTGAGGAGTATTGTGAAGTCCTTCATTTCTTTCATATATCGGAATAGGAAGTATTCTGAAGATGGTAAATTATAACCATGAGCTCGTAAGCCTCTGAAAGGTCGCATATCATTGTATTCCTGTGTATTGTGATTTAGCTACTTCTTTACTTCCATGTTTACTAGAAGATGTTCAATTAGTTTTTGGGTCTGGACATGCCATAATCTTCAAACTGTCACGAGCAGTATGTCCTTGTTGTGTGCTCACCGTGATCGAACAATCATTTTTGAGAATATCGCAGATGGGAAACCATGCAAGCTGAAGAGGAAGCTGCTCTGGGCCGTGGTAAACGCCTTCGTAAAGCTGTATCATACATTGAATCAAATGGAGAGAAACCGAAAGAACCGTCGAGTGAGGTATTTTCCTTGTCTGTCGAGGCATGACCTCATGACTACTACTGCATAAGAATTGCATTTGAACTTTCATGAACTGACAAAAGCCTGATCTTTTCGACATTCTACTTCGAAGAGTGCTTTATTTTCATAGAAGTACATTTTCTGATACGTCAAATGTACGTCATTTATATGTGAACTACGCCTTTTGATCTCAGAAGAAACTATAGGGTTATTCCTAGGGTGATATATACTGACAAATTCAAGATATATCAGAGTGAATTTTCCTTCAGCTCAAACTAGAGATGAGTTTCAAGGACAAATTTGGGAGAGATGTATCTGAAGAATTTATATGTGGAATTCTCTTGACAGTCATCAGATGCTGAGAGGGAGGACGACCCTGAACCAGATTACACTCCAGTAGGTCGGGCTTTTAAGCAAAAACTGTAAGTCATCAAGAACATTTCTGATTAAAACGCTGTTTGTAAAGTTTCTATTCTTATGTAGACTTGCTTGTAACTGCTGTGTGCCGCTCTTTTCTTTGTTCTCTTGGCCACGTCCTGCTTTCGTGGACCTCGAATGCCATTTATTCACTTGTTCTCCTTACTCACTATCCAAATTCTCATATTTAGATGTAGCAACCCCATCAGTTCTACAAGCTTAGGCTTTTCGACTATAAAAAACGTGTTAGTTATAGCTTGATGGAAGCTTACTGCTTTGAATACGGTAGCCTGGACAAAGAGGGACAAGTTGGAGTTCGCATAATGACTTGAAATTGGTTCTTTGCTCCAATTTATGTTACCAAGTAATTTATTGCTTGACTCTACAGGCAAAGGCTTCGAGCAAGGCAAAAAGATCGTATTCAGCAGAGGTACAATGGGGCTGCTGGTATAGCAGAAGGGGAACGGTTGGTGACTTTGACTGGAATCCCTACCGATGGTTTGGGTGTTTTGAAGAAACTAGAACTACTGCCAGAATCCCCTGCTCCACCGTGGCCACCGCAGCCTGGCTTGCCATTTTTGAATATAGCATCAGACCCTTTCTCACAGGCTTTAAGCAAGGCAACTGCATCCTCTGTTGTATCGCATGCTGTAACTGACATACAGTCTGTAAGGAATTCAAGTTCACCTACCGCCCCGGCCATCAATGTCGATTGGTACTCAAGTAGTAAACCATCGTATCCTCAGCAGCATCATCCAGCGACTGGCACATCAAATGATGAAGGTGCGTCAAGTTCAAAACTACCGGGTCATAATCTTGGACATCCTAGGTGGCTTGGAGGTTTAGGGTCAGAGCCTAGTAGTACCTCTGTTATGACGCAAATTTTTGGGAGGCCAGCATGTGTGGGTGATGAAGTTCGAACAGAGAATGCATCTGGAGTGACGCTAGCAACTCTGTCACAAGGAACAAATGGGGGTCATTTGAGCCACCTGCTACCGGATTTTCGACAAAGTCTGCAGGGAGTGCATCAAAGCAATTCATCACGACAATCACCTCCATCGCAGATCGATTCTAGAGGATCGACACCAGGTCCTCTGGAAGTACCTTTCCAGCAAGATGGTGGATTGAGTTCTTCATCAGGTCTGCGAACCGCAAATGGTGCTAAGACTACATTCTCCTTTGAGGAAATGAAATCATATTCTGGTCATCAGTACAAATCTAAACCTCCAGACGTTGCTCTTGAGTTTTCTCAAAAGATTTTCGGCACTGAGAAAGCTCTCAACTCGGGTGTTACGGTAATTATCTCCTTAAACCATCCTCTTGAAGTTCTATCATGTGACGAGCAAAGGACCAAAGAATCTTGCTGAAAAGAGTGAACAACTTGGGGTTCTTGTATTCTTTGAGTATTAGAGGACATGAGGTAGACCTTCAATTGATACTTCGTTTCAATGCTCGATGCTTACTGGTGTTTATATTTCCTTTGTGTTCGACTCGACAGTCGACAGGAGGAGAAGCTTCAACTTGCCAGGGAATCAAGCAGGGTCCTTTACAACTCTCGTCTCTTCTCCCTGTGGATCCTAGTTCTTCTCTGAAGAGTCAGAGGTCCGAGTACAGTTCAGCTTTACCAGGATCCTCTTCTCAGCCATCAACACATGATTCAAGGAGTCCCAATTTGTCAATAGCTCTGGGCCTCGGAGGTTTGATGAGTGGTAGTCATGAACATTCGAAAGAAGCGAGTCCGGCTATTGATGCCAGAAACTTCCTGGATATGCGAGTGCAGGTATCTGCTGCGTCTTCCTCAGCTGTATCTTTGATATCTACTGTCGGGGTAGATTTGAATGACTTGGGCAGAGTGGAAACTATGCCTATTGAGCTGGATGATGATCAAGATTCTCAGCCAACTGTAAGTACGAGAGGTTTCTTAAGTCCAGCGAAGATTGATGGATCAGGAAGAGGATGGCACATAGAAGAGCAAAGGAAGCACAAAGAAGAAATCGACAGAACCTGGACTGATGAAGAATTGGATGCTCTGTGGTCTGGAGTCCGGAGGCATGGGCGAGGCAATTGGGCTGCTATGCTTATCGACTCTAAATTATGCTTCTTGAAATCTAGATCTGTAGGTGAGCTGTCAGAGCGTTGGAAAGAAGAAGAAATGAAAATGTTTGCAAAACCAGAACAGGTGTCTGAAGTTATGAAGCAACCTGCAATCCGCTGGGGAGGTACGAACAAATTGTCCAATGTTGAAGGGGGATCAGAACACCTTTTGCAGCATATGAGCGGGGCTGAACGAGGAAGGCATCTCCAATCTAGTATACCTTTGGCACCGAGTTGTACTTCAGATATTGGTCTGGCTGGCCCTCACGAGAGGAGAGACGGAATGCCGTGGAGTCTTCCTGATTTAGATGTCAAGCCAGAGAAAGAAAGATTGCCATACTTTGGTTCATCTACATCTGGAAATCTTTCCACACCACCCAGCTTGGATCTCGTTGATAAAATTGGGGAGCTTGGAGGCAGTAGACCATCGATCAACTATCACAATCTGCTCGACTTGCAACCTGGACGATCATCTCCCGTGCTTCAGCCTGGCATGTCCTCGAGGAACAGCTCGTTGCCTGGAACTGCCTTGGGAGTGAATTTAGTAGGCTCCTTTGTCCCGTCGCAGGCATTGAGTAGGCTGGAAAGCAGTGGTATCTTGAAGTCAAGTGGGCATCTGGACCATGTTGGTGCGGAATCTGCTCCCTCATTGAGCCCAGGACTAGCCCTCGGTCCGGATTGGAGGAGAAACGACAGTAGGTCCAAAGAACGGGGACCTTTGCAACAATCACCAAACTTCTCTGGTGTAGAAAGTCTCAAACATCACCCTCACTTCTCGGAGAGCAATGTTTTTAAGTCACATGATTCTCACCCATCGGCCCCGTTTCCTCCCGCTCCTAGTCCTGTTTTGGGATCACCAACAGGACAATCTTTGGGCAACCGGGCTTTGGTTTCTCTTCCACACAATGGAGGAGGTTTGTCCACTGCGGACCAGAGGAGGAGGGCCAGACCGGCTCCTCCAAAGGATGAGTCGGCTTCAAGTAATTTACCTCACTGGTTGAGAGAAGCTGTCAAGGCAAGGTCTGCTCCCCCCCAGCCCCCTCTTCCACAAGCAATTGCAGCAGTAGTGCAGGCTACAAGCATGCTGTACAAGGGATCTAAGCGACTGCTCCCTCCTCTGGTGCATCCGGGGTATCCTCTTGTACCACCACGGGAACCTCCTAAGAAAGCTGAAAGGAGACGTCGTAGGCCTAAGGTGAATCCCCAAGTCACTGGGAATCCACTTGTTGCTGCACCAAATCAATCGATTATCGATCTTACGCGGTCTATTAAGCTTGAAGGCCTCAATCCATCACTCCTTCCTCAATCGGCAGAAGTAATCAGTGGATTGCTCTCCAGATCTCTGCCAACTCTTGGGCAGATGAGTACTCTATCGCGGACGAAAGGCTTCGATTTTCCTTTGATACCAAGTTTCGATCATTCTCAGCAAGTACAACCCCCTCCTGCAGGTTCGATTTCAGAAATGATGGCTCGTAGAAGCTTGATAGAGCTCGGATTCATGTCTGGACACAGTGACCCCATGTTGGCATCAACTCTGAACAGTAGCAGGAATCCTTCTCTTGAGGAGACAAATTTAGGGTCCTTAGGACAAGGAAGACGACCGCCATTTGACTTTCGTCCTCCTGAAGCGGATCTGCCTTGGAAACGAACTGACTTGCAGAGCGCGTCTTTACCAACGAGTGCCCCTTCAACGTCACGTCAGTTTAGCAGAAACAATCAAGGAGCCAATTTTTCAGAAGCTTTTTCTCAATCTGCCTCTAGAATTGCTGAGGGAAATGTTTCTGATTCGGAGAAGAAATCTCAGCTTCCTCAATGGCTGCTGAACGAAAACCCTCAACCTAAGAGTGACAGCAGGCAGAAGCAACTCCCGAAGGTCAATGTTGATGCTGATGATGGTGATGATTCTTCTTCCAGCAAAACTGTATCCGACCCTGGGATACGCGGCAAACGAGGCAAAGATGCAGACAATGAAGATGATGCCTCATCAGAAGAGACCATCTCAGATGATGGCACCCAGTAAGCAAGTTGAGGGAGTTTTGGGACGAGCTGTAGCTGTATGAATACATTTTTCCGACTTCTAATTTAGAAGACCATGTGGATATTACAATTTGAATGGTCCAGTGAGAAATCCCTTTTTAGCTGCAAATCAAAGCGTGAGTAGGATTTGATGTATACTCATATATCTGCTCCCAGAAGTAGAATCGCAGATCCTACAGACATAGGATTGATGTCTAGTAAATTTTCGTGCACTGGCTTGGGTCAAGGGGAATTCAGTTTCCTTCGTCTGGGAAAGCTCGCCCCCACTGAATTGTGACACTGTCTTGTGTCTGCACTAGAGTATATCATTGACCACTTGCAAGCTTAGCGTACCGAAGCTCAATGCTTAAGAACCCCGATATGATTCGCCCATCCCCCCGCTTAGTTGTAGGTAGTTTATATATATATTGTTGGGCTACAATTGACCGATGTCCTTTTTTGAGTACTGTGCAGGAAACCTGCGAGTGGATGACAAATTTTGTTCTTTCTATCATGCCCCCTTTTTCCCCCGACGAGGGTCTTAGTTAAATCCCACTGGGAAGCTCATTTTTGAGTCTCT

mRNA

>Mapoly0162s0017.1
TGCTTGGCTGCCATGCCATGGATGGCATGCAACAACAAATCTTGGAGAAAGGACGGTCCGGTCTGGTCACGTCTGAACTGTGTCACATGTGTCAGTTTTAGAGTGACTTGACACCCATCGACTCTTGACTATGATAAGTAGAGAACCCCAGAAGCGAAACAGTCCAAGAGACTCCGAGGGAAACATTTTTTGGATTGAACTCAACTCAGCTCCGCTTACGAAGCTTTCTCCTGGGACCGACGTGTCCTCACTGCATTTGAAATAAGAAGAAGGCTTGGGATGGCCCGCCCGCCGGGCCTCGGCATCCCTTCCTTTCTCCCAGGCAGGCTTGACATGAGAAGGCAGAGAGTGAGAGGCAGCCAGCCATGCCAAGCGAGCCAGCTCGTGCTAGCTCTCAATTGCTTTGACTCTGTTTAAAGATATCAAATGTGAGTGCGACTTCCTCCATAATTACCGCGCCACTCTCCAGGCACTGTACCTTCTTCTGAGCTGCAGGCCCACCTCTCCCTCCCGTCCCCTACCCTTGCGCTACTCCTCCTACTTCTACATACTCCCTGACTGCCGGATTTTAGCGTCTCCGGCTCCCACTCCTTCTCCTGCTCTCGCTGCTCTGCTTCTCCCACCACTGTATATCTCCAGCCCGAGAACTGGCGGTGCCATCCAAGCCATGCTATGCCCCTGGGGATTGCCATTAAATTTACTCACCCAACCGAGATCTACACTGCAAACTTTTTCTCTAACTAAACATAGAGATGGCTTATGAGTCCTCATGTCGTCAGCGAAACAGCAGCATATGTGGGTGGAATAGTCGGATAAACGGCACTCGGGATGGGGATGAGCATAGAATTCGCGCACTGAGAAGAATGCGGTAAGCGGAAAGAGGAAAACAGATTAGGGTCGGGGATGAGTGACGGCCTCAGGAAGGGGGCAGTGTACACAGTGAACGAAATGAATGCAGCGAAGCAAATGGAGAGAAGATCTGCGTCCGGTGATGATGATGAGTGATGAACCGAGTAGTGAGTAGTGATGTTGCTTCCACCTCTGATCATCGGATCATGAGGTGAAGAACGATCCTCTCTCTCTCTCCAGAAAGGGAGCTGACTCTTCTTCCCTCTCCGTGCCTCTCCCTTCCATCTTATACCAGCGAGCGAGTAAGCAAGAAAAGTTCGAACGGAACGAATCCAATCCAATCTAGCTTTTCTCCTCTCACCCATCGCATACTCGGTGTGCCTGGTCCGTCTGATCTGAGCAAACCTCCGCCAGAGCGTCATGAGATCAAATCGCAACCGACAACAACAAAATGACATGTCGTATCCACCCTACTGTAGCACTCTTCAATAAAACCCTTAGAGTATATAGTGGAGCGGTTTCACATGATAATGATGTTATCACTCACTCCGGTCTTAAAGACATCAGGCTGGTGATACCAAACTGCCGATTATAAGGACGAATGTTCTGGCACCGAGTAAGAAGCAGATTCCTTCAACATGGGAATGTAATTACCGTTCGTAGAAAGGGAAAATAATCGCCGGGCGGATGAAGACGCAGTAGAAGATAGAAGAAATTGCGACTCCCGGAACGTTTGAATGAATGTATGCATGAATGATTGAAGAAGAAGTTTGAAGCAGAGAGACCAGAAGTCGGAGGATGTTAGATGTTGGGCGGGGACGCAGGCGAGACTCTCTGGCTGCTTTTAGAAGCACGAATGAGGGGAAGCCACGTGGCTGACCGCCGCAATCGTGCGCTTTGGAGACCCGACCTACTGCAGCGCCCCACGTGGTGGTTCTATGCTCGTGATTGTCCTGCTCCGGCTGCACACATCAGTCCTGCTCTTCTGCAATGCTCTTCGCTTGAGGTTTCTTACGATCATTTGCCTTGCTAGGCCCCAATTCTTTCTCATAGCGTACACTTCGGCTCACGCTCTCCATCGGCTCTTGCTTACATCCCACTTCTTTCTTGCTTGACCTCGTTCGTTGGCGTGCATAGCACACAGTGTTATTCGCATGAGCATCATCTATCTCTTTCATTCCTGCGCTCTGCCCCCTCATCCTGGTCCTGACTCTTATGTCCTTATGTCCTTACCACCACCACCTGTTCCTGCCCGCTGCCGGTACTGCCGCTGTAGGCAGACGCGCACTTTGGAGTGGAAGGACCCCTTCCAGCAGCGAGAGAGAAAGATAGGGGTTAGTTGTTGGAGAAGCTCGAAGGTTTGCTCTGGGTTTGAATGAAGGGTGTTGCCGCCCTCCCCGCTTGGCTCCTTATGGGTACGAAGGAGTAGGCCAGACATGGTAGGTGGGCGCTTACGCTTATGGTAAGCAGCTCGTTCCAAGTTTTTGTTTTTTCCGTAAGAACCCGAGTTTGTGGTGGTGACGTCTTGACGAGGTAAGGAGGAATCATAGCTCGCTCGAGGACGGGGGACGGGGATAGCGTGTGATGCAAGGGTGCCTATGTCATCAAGATTGCTTGTGAGCTGAGGAAGGGAAGCGAAGAAAGCAGCACAGATAAGGACTTTACCCGACGGGAGGCATGAGGATCAGAGTTTTGATTACAGGAAGATAGGCGGTAGTGGAGCATTTCAGGTTCGAAGGAGAGCAGAAGACTGGTAACCTTATCTTTTAAGTGTCGAGGAGATCAATTCTCTAGCATTGTTTGTAGCACCGGGCACTATTTCCGAGGTGGACGAAGTACACTGGGTGGAGGAAAATCAGGCAGTCTTGACAGTGTGGCTTTTCTTGGGACTTATCGGTTGCCCATCATCTTGGTAGCAGAACAGGGAGCGGGTAAAATACATCGACATGTCGAAGGAAGCTTTTAACATCCTCGTCGTTACATATTGCTCATAACCTGCCCTCGGAAGGACAAGGAGGCGAAGTCGTTCACGGAGTCGTATTCTTATTGGGGCCACTATCGTTGGAAGCCACGCTTTCAGGGATACTCATGAGGAGCCGTGAGTATTTGGGACGAAAGTGAGTCCAGCTGACTGATGCATATCACTGTTTGGAGGTTACCCCAAGCAGACACCGGGGATAATGAGTAGCGAGTTGCCAGTTGAAGTACAAGTCCCAGTCCTGGCAAGCTCTAAAAAACAACGGAGTGCGCGGAGCACAGCTAGGAACGGCTGGGGGCCAGGACAGCCTGAGACACGTAGACTTGTAGGATGCAGCTATGTAAGCACAACATTTCCCCGCCATACGTTGGTTTGGGCAAAGCGGGATAATGGAGTCTGGTGGCCAGCTAAGGTTGTGGGTGTTGACGAAATACCAGAGGACCTCAAGAAGCAAGAAGAAGGTTGGACATGTGTAAAATATTATGGAATCGATGTCGCCCAAGCCTTCGCTTGGTTGAAGTCCGAAGACTTGTGTTCTTACGACAATCACTTAGAAGAGTACAGTAAGCAGCATTTACCTGATGGCATCAAAGCAGATGAATTCAAGTCAGCTATGACTGAAGCCCAAGAGGCCGCCAATAATCGCGCTGACAACGCAATGGTAAAACCGACGAGTGTCATTGCAAAGCCTCAGGATATCAAAAGCCGGATGACCCCACGTGTTGAGAAGGAAACGGCGAAGGAAGAAATAGCTGCACCGAGTGAGGATACTGAACAGGCTCCGAAGCGGAGAAAATTGAAACTCAAAGGAGTGGACAAAGTCCCAGTGAAGGAATCTACTTCAAAATTCCTTTTGAAAGGGAAGGAAGGTACCAAGGATGCTAAGGTTATTGACAAGAGCGTTGAATTGACAAGAAAGCGGAAGCGAATGTTGAAAAGGCCACAGACTGGTACAAATGATCACGAATTGCCCAAGGGTGAAACACTCGAGTCACCTACGAAGAAAATTGGATCTCCAACTGGCAACTCAAGCAGCCTCAACTCGCGCGATCCAGCTAAGAAGTCCAGTTCTCGAGGAAAGAAAACAGGTGACGATGGGTATTATTTCGAATGCATGGTCTGCGATATGGGAGGAGACTTGCTGTGCTGTGACCTTTGTCCACGAGTTTATCACTTGGAGTGTCTCAGTCCTCCGCTGAAGCGTACACCTCCAGGCAAGTGGATATGTCCTGTCTGTAAAGAACTACCTGGAGCAGCTAAAGGTATAATTCAGACACCAGATTCCAAGCCTAGGTTCAAATCAACTACACATGTTGGTGAACCTTCTTCTCATGTTACGGGACACAAGCTCAAAGGGCTAAAACGTGGATGGAAAATCTTCCATAGAGGGAAGCCGATAGTTCCGGACTTGGACATCAAAAAGTTGCGAAAGAGGAAAAGAGATGAGGATTCCGAAAGATCCAGGAAAAGGCTCAACTTGAAATTGAGTCGACCGTTTAGTCAAACACAAATTAAGTGTAGGCAGTGTGGCGCTGGCATTCATTCATCAGGGGAGTCTTCAAGCAATGTTCTCTGCAAGGAGTGTGTAGAGTTGGTTAAGCTAAAGAATTCTACCTTACCAGCGAAGATGTTGGCTACTCCGAGGAAGGACATGATACCAACTAGACACTCAAAGCTGAAACCAGGGAAGTGTGACATCTGTCAGCAAGATGGGTTTGTGATCCTCTGTGATGTTTGTCCAAGAGGGTATCACAAAGACTGTCTTAGCCCACCGAGAAAAAGAGCACCAAAGGGAGCTTGGTCTTGTCCAAAGTGTGGACCTTCAAAGGAGATCAAAGAGGGCAAAGAGACGAGGGAAGTACGGGAGGCTCGGGAAGCGGCAAAGGCCGCGAAAGCAGTGAAAGCAGTGAAGGTTGTGAAGGAGAAGGAGACAAAGGTTGAAGAACGTGAAGGAGGTTCTCCGGAGCCAGTGGTAGCGTCACCTGTTACGTTAGAGGTCGAACGAATTCTAGGTTGCCGCTTGAGTCAAGCTACAACTTCGAACAAGGTAGAGCACAGTGAGTCTCATGCCTCCGATAAGTCAGAACGACTAGCACCGGGTGAGAACGGCTCGATATTATGGAGGAAGTCAGAAGAGAGACACGATATTGAGATCAGGTTACCAATCTGCAAGGTAGAAGATGCTGAAGGTGAACGGAATTTGCAAGAAAAAGTCGAATCGGATGATGCGAGCACGACACCTCTGTCTCTTCCTGGAGTTGGAGCACAGGGTAGTTGTTCTAATGAGAAGGGTAGACTTGGAGTCTCGGCAGACACAACTTGTGATAGATCAGCTGCTGAACTATCTACAGCGGGCAAGCTGGAGATTGATTTAGAGAAGGGAGTCTCAAATGAAGCTTCTTCGCCAGCAGAGAAGGAATTTTTGGAAGAAAAGGATGTTGGATCAGAGACTGATGCTACCAATACTTCTTGTACACCTCAGGAAGTTTGTCCAAAGATGGAAGAGCAGGTTGACGGTAGTGGATCAGAAGCATCGACAGTTAAAGAAGATGAGGATGAAGAGGGCAAACTTCTACCAGTTCTCTTTGCTCCTGAGAAATCCGATGGAAATTCAGTCGATACTCATCTTATAGCTAAGGAAAACCTTTCATCCGGTGAATCCAAAGGTCCAGAGAATTCGTTGAGCTCCGAAGGTGATGGGCTGGATATTGCTGTACCATCCTTGTCCTTGGAGCCAGCCTGCAGCACAAAGAGCTCTACAGGGACTGATAGATCTGCACCTTCGGAAGCGAGAACTGCCCTGGTGGATACGGATGATCCTGTTGCTGAATCGTCACGAGGAGGGGCTCAGAGTCCCTCCGCAGCAGTGGACTCAGCTATGAAACAATCTGATCGAGAGTTCCTAGTTAAGTGGAATGGCAAGGCCCACATACATAACGAGTGGGTCAGTGAAGAGCGTCTGCGGAAAATAGCCAAACGGAAACTGGACAATTACAAGGTCAAGTACGGTAATGCTCTTCATGTGCTTACGGAGGAACAATGGCACCATCCTCAGCGAATTGTTGCTAAAAGAGTGGGAAAGGGAAGTGTGAACGAAGTCTTTGTGAAGTGGTGCGGATTGTCGTACGAGGATTGTACGTGGGAGCTCACAAGCGAGCCTGTCGTAAAGAAGAGTGAGGAGCTTGTGCAAGCTTATGACGGCTTTGAAAAGGCAGCACAAGAAAGCTGCACAAATACTTCTGCGATAGATGCAAGTAGTCCCGATCTGTCAGATCTTAAGACGCAGCGCCCACCTGAAATCGAGGCACTTGTTGAGCAGCCAGCCTATTTGAAGGGAGGGTCGCTTTTTCCTCATCAATTGGAAGCGTTGAATTGGTTACGGAAGTGTTGGCATCGGCAACGCAATGTTATTCTGGCTGATGAGATGGGCCTCGGGAAGACTATATCAGCTTCTTCGTTCTTGGCCGCGGTTCACCATGAGTTCAAAGTAAAGGCACCATGTCTAGTTCTAGTTCCACTATCCACCATGCCAAACTGGCTGGCTGAGTTTTCCTTGTGGGCTCCATCTCTGAATGTAATAGAGTATCATGGTAGTGCCAAGGCAAGAACAATCATACGTGAGCATGAGTGGCATGCCATCGCCCCGGACGGGTCTGGGAAGAAGCTGAAACAAGTATATAAGTTTAACGTGATGCTGACTACCTACGAGATGGTGATACAAGACTCAAGTCAGTTGCGAGCGATTCCCTGGGAAGTCTTAGTTGTCGATGAAGGCCATAGACTGAAGAATTCTGGGAGTAAACTCTTTACTCTTCTCAATACGTTTTCGTTTTCTCACAGAGTACTTCTAACGGGTACGCCTTTGCAAAACAACTTCTCAGAGATGTTCAATCTACTGAACTTTTTACAGCCCGATACATTTCCATCTCTGGCTGCCTTCGAGGAGAAGTTCAGTGGATTGAGCACTGCTGAGCAAGTGGAAGAACTCAAGAAGCTAGTTGCTCCTAACATGCTTCGTCGTCTCAAGAAAGATTCCATGCAGAAGATTCCTCCCAAAACGGAGCTTGTTGTCCCAGTGGAGATGAATTCTGTGCAGTCAGAGTATTACAAAGCTCTTCTGACCAAGAATTACTTGTTGCTACGGAATGGAGCAAAGCAACAGTCCATGCTGAATATTGTGATGCAGCTCAGGAAAGTCTGTAACCATCCTTATTTGATTCCGGGTACCGAGCCAGAGACAGGTACAGCGGAATTTTTGCAGGAGATGAGAATAAAGGCCTCTGCAAAGTTGATGCTTTTACATTCAATGCTGGGCAAGCTAAAAGCTGATGGACATCGGGTCCTTATATTTTCGCAGATGACCAAGCTTCTCGATATCTTGGAAGATTACCTTACTTACCAGTTTGGAAGTGAAGCGTTTGAGCGTGTTGATGGATCTGTATCTGTAGCTGAGCGACAAACAGCTATTGCTCGCTTCAACCAAGATACTTCTCGATTTGTTTTCTTGCTCTCTACTCGGTCATGCGGTCTCGGAATCAACTTGGCTACCGCAGATACTGTAATCATATATGATTCTGATTTCAACCCACAAGCCGATATCCAGGCGATGAATAGGGCTCACCGGATAGGTCAGTCGAAGACACTGCTGGTGTACAGACTTGTGGTTCGATCAAGCGTAGAGGAGCGCATTTTACAACTTGCGAAAAAGAAACTGATGCTGGATCATTTGTTTGCAAACAAGTCCGGATCTCAGAAGGAGGTACAGGACATAATTCGATGGGGTACAGAAGAACTGTTCCAGGAATCGTCAACTCCGGTGGAGGAGACGTCCTGTGTTCCACACATGACTCATTCAGGCGATGTCGAAGGGGTAGACGATGGAGAGACAAGGCTTAAGAAGAAGAGTGGGGGTCTTGGAGATGTTTACGATGATTACTATCAAAAGCTGGGCCGCTCCAAACTTGAGTGGGACGATGCGGCCGTAACCCGCCTTCTTGATCGATCAGAAATTAGTACTCGCCATCCAGATGTCAGTGAAGGAGAACATGAAAGTGATCTGCTTGGCTCGTTGAAGGCTTGGGATTGGAACGATCAAGATGTAATTCCTGAAGAGCACGAAAAAGACGATCCTAATGGAAAAGATACTGATCTGGGGATTATGAAATCTCCTCTTGCGGAAGAGGAAAATCAGTGGGACAAGCTCCTGAAATCAAGATGGGAAACCATGCAAGCTGAAGAGGAAGCTGCTCTGGGCCGTGGTAAACGCCTTCGTAAAGCTGTATCATACATTGAATCAAATGGAGAGAAACCGAAAGAACCGTCGAGTGAGTCATCAGATGCTGAGAGGGAGGACGACCCTGAACCAGATTACACTCCAGTAGGTCGGGCTTTTAAGCAAAAACTGCAAAGGCTTCGAGCAAGGCAAAAAGATCGTATTCAGCAGAGGTACAATGGGGCTGCTGGTATAGCAGAAGGGGAACGGTTGGTGACTTTGACTGGAATCCCTACCGATGGTTTGGGTGTTTTGAAGAAACTAGAACTACTGCCAGAATCCCCTGCTCCACCGTGGCCACCGCAGCCTGGCTTGCCATTTTTGAATATAGCATCAGACCCTTTCTCACAGGCTTTAAGCAAGGCAACTGCATCCTCTGTTGTATCGCATGCTGTAACTGACATACAGTCTGTAAGGAATTCAAGTTCACCTACCGCCCCGGCCATCAATGTCGATTGGTACTCAAGTAGTAAACCATCGTATCCTCAGCAGCATCATCCAGCGACTGGCACATCAAATGATGAAGGTGCGTCAAGTTCAAAACTACCGGGTCATAATCTTGGACATCCTAGGTGGCTTGGAGGTTTAGGGTCAGAGCCTAGTAGTACCTCTGTTATGACGCAAATTTTTGGGAGGCCAGCATGTGTGGGTGATGAAGTTCGAACAGAGAATGCATCTGGAGTGACGCTAGCAACTCTGTCACAAGGAACAAATGGGGGTCATTTGAGCCACCTGCTACCGGATTTTCGACAAAGTCTGCAGGGAGTGCATCAAAGCAATTCATCACGACAATCACCTCCATCGCAGATCGATTCTAGAGGATCGACACCAGGTCCTCTGGAAGTACCTTTCCAGCAAGATGGTGGATTGAGTTCTTCATCAGGTCTGCGAACCGCAAATGGTGCTAAGACTACATTCTCCTTTGAGGAAATGAAATCATATTCTGGTCATCAGTACAAATCTAAACCTCCAGACGTTGCTCTTGAGTTTTCTCAAAAGATTTTCGGCACTGAGAAAGCTCTCAACTCGGGTGTTACGTCGACAGGAGGAGAAGCTTCAACTTGCCAGGGAATCAAGCAGGGTCCTTTACAACTCTCGTCTCTTCTCCCTGTGGATCCTAGTTCTTCTCTGAAGAGTCAGAGGTCCGAGTACAGTTCAGCTTTACCAGGATCCTCTTCTCAGCCATCAACACATGATTCAAGGAGTCCCAATTTGTCAATAGCTCTGGGCCTCGGAGGTTTGATGAGTGGTAGTCATGAACATTCGAAAGAAGCGAGTCCGGCTATTGATGCCAGAAACTTCCTGGATATGCGAGTGCAGGTATCTGCTGCGTCTTCCTCAGCTGTATCTTTGATATCTACTGTCGGGGTAGATTTGAATGACTTGGGCAGAGTGGAAACTATGCCTATTGAGCTGGATGATGATCAAGATTCTCAGCCAACTGTAAGTACGAGAGGTTTCTTAAGTCCAGCGAAGATTGATGGATCAGGAAGAGGATGGCACATAGAAGAGCAAAGGAAGCACAAAGAAGAAATCGACAGAACCTGGACTGATGAAGAATTGGATGCTCTGTGGTCTGGAGTCCGGAGGCATGGGCGAGGCAATTGGGCTGCTATGCTTATCGACTCTAAATTATGCTTCTTGAAATCTAGATCTGTAGGTGAGCTGTCAGAGCGTTGGAAAGAAGAAGAAATGAAAATGTTTGCAAAACCAGAACAGGTGTCTGAAGTTATGAAGCAACCTGCAATCCGCTGGGGAGGTACGAACAAATTGTCCAATGTTGAAGGGGGATCAGAACACCTTTTGCAGCATATGAGCGGGGCTGAACGAGGAAGGCATCTCCAATCTAGTATACCTTTGGCACCGAGTTGTACTTCAGATATTGGTCTGGCTGGCCCTCACGAGAGGAGAGACGGAATGCCGTGGAGTCTTCCTGATTTAGATGTCAAGCCAGAGAAAGAAAGATTGCCATACTTTGGTTCATCTACATCTGGAAATCTTTCCACACCACCCAGCTTGGATCTCGTTGATAAAATTGGGGAGCTTGGAGGCAGTAGACCATCGATCAACTATCACAATCTGCTCGACTTGCAACCTGGACGATCATCTCCCGTGCTTCAGCCTGGCATGTCCTCGAGGAACAGCTCGTTGCCTGGAACTGCCTTGGGAGTGAATTTAGTAGGCTCCTTTGTCCCGTCGCAGGCATTGAGTAGGCTGGAAAGCAGTGGTATCTTGAAGTCAAGTGGGCATCTGGACCATGTTGGTGCGGAATCTGCTCCCTCATTGAGCCCAGGACTAGCCCTCGGTCCGGATTGGAGGAGAAACGACAGTAGGTCCAAAGAACGGGGACCTTTGCAACAATCACCAAACTTCTCTGGTGTAGAAAGTCTCAAACATCACCCTCACTTCTCGGAGAGCAATGTTTTTAAGTCACATGATTCTCACCCATCGGCCCCGTTTCCTCCCGCTCCTAGTCCTGTTTTGGGATCACCAACAGGACAATCTTTGGGCAACCGGGCTTTGGTTTCTCTTCCACACAATGGAGGAGGTTTGTCCACTGCGGACCAGAGGAGGAGGGCCAGACCGGCTCCTCCAAAGGATGAGTCGGCTTCAAGTAATTTACCTCACTGGTTGAGAGAAGCTGTCAAGGCAAGGTCTGCTCCCCCCCAGCCCCCTCTTCCACAAGCAATTGCAGCAGTAGTGCAGGCTACAAGCATGCTGTACAAGGGATCTAAGCGACTGCTCCCTCCTCTGGTGCATCCGGGGTATCCTCTTGTACCACCACGGGAACCTCCTAAGAAAGCTGAAAGGAGACGTCGTAGGCCTAAGGTGAATCCCCAAGTCACTGGGAATCCACTTGTTGCTGCACCAAATCAATCGATTATCGATCTTACGCGGTCTATTAAGCTTGAAGGCCTCAATCCATCACTCCTTCCTCAATCGGCAGAAGTAATCAGTGGATTGCTCTCCAGATCTCTGCCAACTCTTGGGCAGATGAGTACTCTATCGCGGACGAAAGGCTTCGATTTTCCTTTGATACCAAGTTTCGATCATTCTCAGCAAGTACAACCCCCTCCTGCAGGTTCGATTTCAGAAATGATGGCTCGTAGAAGCTTGATAGAGCTCGGATTCATGTCTGGACACAGTGACCCCATGTTGGCATCAACTCTGAACAGTAGCAGGAATCCTTCTCTTGAGGAGACAAATTTAGGGTCCTTAGGACAAGGAAGACGACCGCCATTTGACTTTCGTCCTCCTGAAGCGGATCTGCCTTGGAAACGAACTGACTTGCAGAGCGCGTCTTTACCAACGAGTGCCCCTTCAACGTCACGTCAGTTTAGCAGAAACAATCAAGGAGCCAATTTTTCAGAAGCTTTTTCTCAATCTGCCTCTAGAATTGCTGAGGGAAATGTTTCTGATTCGGAGAAGAAATCTCAGCTTCCTCAATGGCTGCTGAACGAAAACCCTCAACCTAAGAGTGACAGCAGGCAGAAGCAACTCCCGAAGGTCAATGTTGATGCTGATGATGGTGATGATTCTTCTTCCAGCAAAACTGTATCCGACCCTGGGATACGCGGCAAACGAGGCAAAGATGCAGACAATGAAGATGATGCCTCATCAGAAGAGACCATCTCAGATGATGGCACCCAGTAAGCAAGTTGAGGGAGTTTTGGGACGAGCTGTAGCTGTATGAATACATTTTTCCGACTTCTAATTTAGAAGACCATGTGGATATTACAATTTGAATGGTCCAGTGAGAAATCCCTTTTTAGCTGCAAATCAAAGCGTGAGTAGGATTTGATGTATACTCATATATCTGCTCCCAGAAGTAGAATCGCAGATCCTACAGACATAGGATTGATGTCTAGTAAATTTTCGTGCACTGGCTTGGGTCAAGGGGAATTCAGTTTCCTTCGTCTGGGAAAGCTCGCCCCCACTGAATTGTGACACTGTCTTGTGTCTGCACTAGAGTATATCATTGACCACTTGCAAGCTTAGCGTACCGAAGCTCAATGCTTAAGAACCCCGATATGATTCGCCCATCCCCCCGCTTAGTTGTAGGTAGTTTATATATATATTGTTGGGCTACAATTGACCGATGTCCTTTTTTGAGTACTGTGCAGGAAACCTGCGAGTGGATGACAAATTTTGTTCTTTCTATCATGCCCCCTTTTTCCCCCGACGAGGGTCTTAGTTAAATCCCACTGGGAAGCTCATTTTTGAGTCTCT

CDS

>Mapoly0162s0017.1
ATGAGTAGCGAGTTGCCAGTTGAAGTACAAGTCCCAGTCCTGGCAAGCTCTAAAAAACAACGGAGTGCGCGGAGCACAGCTAGGAACGGCTGGGGGCCAGGACAGCCTGAGACACGTAGACTTGTAGGATGCAGCTATGTAAGCACAACATTTCCCCGCCATACGTTGGTTTGGGCAAAGCGGGATAATGGAGTCTGGTGGCCAGCTAAGGTTGTGGGTGTTGACGAAATACCAGAGGACCTCAAGAAGCAAGAAGAAGGTTGGACATGTGTAAAATATTATGGAATCGATGTCGCCCAAGCCTTCGCTTGGTTGAAGTCCGAAGACTTGTGTTCTTACGACAATCACTTAGAAGAGTACAGTAAGCAGCATTTACCTGATGGCATCAAAGCAGATGAATTCAAGTCAGCTATGACTGAAGCCCAAGAGGCCGCCAATAATCGCGCTGACAACGCAATGGTAAAACCGACGAGTGTCATTGCAAAGCCTCAGGATATCAAAAGCCGGATGACCCCACGTGTTGAGAAGGAAACGGCGAAGGAAGAAATAGCTGCACCGAGTGAGGATACTGAACAGGCTCCGAAGCGGAGAAAATTGAAACTCAAAGGAGTGGACAAAGTCCCAGTGAAGGAATCTACTTCAAAATTCCTTTTGAAAGGGAAGGAAGGTACCAAGGATGCTAAGGTTATTGACAAGAGCGTTGAATTGACAAGAAAGCGGAAGCGAATGTTGAAAAGGCCACAGACTGGTACAAATGATCACGAATTGCCCAAGGGTGAAACACTCGAGTCACCTACGAAGAAAATTGGATCTCCAACTGGCAACTCAAGCAGCCTCAACTCGCGCGATCCAGCTAAGAAGTCCAGTTCTCGAGGAAAGAAAACAGGTGACGATGGGTATTATTTCGAATGCATGGTCTGCGATATGGGAGGAGACTTGCTGTGCTGTGACCTTTGTCCACGAGTTTATCACTTGGAGTGTCTCAGTCCTCCGCTGAAGCGTACACCTCCAGGCAAGTGGATATGTCCTGTCTGTAAAGAACTACCTGGAGCAGCTAAAGGTATAATTCAGACACCAGATTCCAAGCCTAGGTTCAAATCAACTACACATGTTGGTGAACCTTCTTCTCATGTTACGGGACACAAGCTCAAAGGGCTAAAACGTGGATGGAAAATCTTCCATAGAGGGAAGCCGATAGTTCCGGACTTGGACATCAAAAAGTTGCGAAAGAGGAAAAGAGATGAGGATTCCGAAAGATCCAGGAAAAGGCTCAACTTGAAATTGAGTCGACCGTTTAGTCAAACACAAATTAAGTGTAGGCAGTGTGGCGCTGGCATTCATTCATCAGGGGAGTCTTCAAGCAATGTTCTCTGCAAGGAGTGTGTAGAGTTGGTTAAGCTAAAGAATTCTACCTTACCAGCGAAGATGTTGGCTACTCCGAGGAAGGACATGATACCAACTAGACACTCAAAGCTGAAACCAGGGAAGTGTGACATCTGTCAGCAAGATGGGTTTGTGATCCTCTGTGATGTTTGTCCAAGAGGGTATCACAAAGACTGTCTTAGCCCACCGAGAAAAAGAGCACCAAAGGGAGCTTGGTCTTGTCCAAAGTGTGGACCTTCAAAGGAGATCAAAGAGGGCAAAGAGACGAGGGAAGTACGGGAGGCTCGGGAAGCGGCAAAGGCCGCGAAAGCAGTGAAAGCAGTGAAGGTTGTGAAGGAGAAGGAGACAAAGGTTGAAGAACGTGAAGGAGGTTCTCCGGAGCCAGTGGTAGCGTCACCTGTTACGTTAGAGGTCGAACGAATTCTAGGTTGCCGCTTGAGTCAAGCTACAACTTCGAACAAGGTAGAGCACAGTGAGTCTCATGCCTCCGATAAGTCAGAACGACTAGCACCGGGTGAGAACGGCTCGATATTATGGAGGAAGTCAGAAGAGAGACACGATATTGAGATCAGGTTACCAATCTGCAAGGTAGAAGATGCTGAAGGTGAACGGAATTTGCAAGAAAAAGTCGAATCGGATGATGCGAGCACGACACCTCTGTCTCTTCCTGGAGTTGGAGCACAGGGTAGTTGTTCTAATGAGAAGGGTAGACTTGGAGTCTCGGCAGACACAACTTGTGATAGATCAGCTGCTGAACTATCTACAGCGGGCAAGCTGGAGATTGATTTAGAGAAGGGAGTCTCAAATGAAGCTTCTTCGCCAGCAGAGAAGGAATTTTTGGAAGAAAAGGATGTTGGATCAGAGACTGATGCTACCAATACTTCTTGTACACCTCAGGAAGTTTGTCCAAAGATGGAAGAGCAGGTTGACGGTAGTGGATCAGAAGCATCGACAGTTAAAGAAGATGAGGATGAAGAGGGCAAACTTCTACCAGTTCTCTTTGCTCCTGAGAAATCCGATGGAAATTCAGTCGATACTCATCTTATAGCTAAGGAAAACCTTTCATCCGGTGAATCCAAAGGTCCAGAGAATTCGTTGAGCTCCGAAGGTGATGGGCTGGATATTGCTGTACCATCCTTGTCCTTGGAGCCAGCCTGCAGCACAAAGAGCTCTACAGGGACTGATAGATCTGCACCTTCGGAAGCGAGAACTGCCCTGGTGGATACGGATGATCCTGTTGCTGAATCGTCACGAGGAGGGGCTCAGAGTCCCTCCGCAGCAGTGGACTCAGCTATGAAACAATCTGATCGAGAGTTCCTAGTTAAGTGGAATGGCAAGGCCCACATACATAACGAGTGGGTCAGTGAAGAGCGTCTGCGGAAAATAGCCAAACGGAAACTGGACAATTACAAGGTCAAGTACGGTAATGCTCTTCATGTGCTTACGGAGGAACAATGGCACCATCCTCAGCGAATTGTTGCTAAAAGAGTGGGAAAGGGAAGTGTGAACGAAGTCTTTGTGAAGTGGTGCGGATTGTCGTACGAGGATTGTACGTGGGAGCTCACAAGCGAGCCTGTCGTAAAGAAGAGTGAGGAGCTTGTGCAAGCTTATGACGGCTTTGAAAAGGCAGCACAAGAAAGCTGCACAAATACTTCTGCGATAGATGCAAGTAGTCCCGATCTGTCAGATCTTAAGACGCAGCGCCCACCTGAAATCGAGGCACTTGTTGAGCAGCCAGCCTATTTGAAGGGAGGGTCGCTTTTTCCTCATCAATTGGAAGCGTTGAATTGGTTACGGAAGTGTTGGCATCGGCAACGCAATGTTATTCTGGCTGATGAGATGGGCCTCGGGAAGACTATATCAGCTTCTTCGTTCTTGGCCGCGGTTCACCATGAGTTCAAAGTAAAGGCACCATGTCTAGTTCTAGTTCCACTATCCACCATGCCAAACTGGCTGGCTGAGTTTTCCTTGTGGGCTCCATCTCTGAATGTAATAGAGTATCATGGTAGTGCCAAGGCAAGAACAATCATACGTGAGCATGAGTGGCATGCCATCGCCCCGGACGGGTCTGGGAAGAAGCTGAAACAAGTATATAAGTTTAACGTGATGCTGACTACCTACGAGATGGTGATACAAGACTCAAGTCAGTTGCGAGCGATTCCCTGGGAAGTCTTAGTTGTCGATGAAGGCCATAGACTGAAGAATTCTGGGAGTAAACTCTTTACTCTTCTCAATACGTTTTCGTTTTCTCACAGAGTACTTCTAACGGGTACGCCTTTGCAAAACAACTTCTCAGAGATGTTCAATCTACTGAACTTTTTACAGCCCGATACATTTCCATCTCTGGCTGCCTTCGAGGAGAAGTTCAGTGGATTGAGCACTGCTGAGCAAGTGGAAGAACTCAAGAAGCTAGTTGCTCCTAACATGCTTCGTCGTCTCAAGAAAGATTCCATGCAGAAGATTCCTCCCAAAACGGAGCTTGTTGTCCCAGTGGAGATGAATTCTGTGCAGTCAGAGTATTACAAAGCTCTTCTGACCAAGAATTACTTGTTGCTACGGAATGGAGCAAAGCAACAGTCCATGCTGAATATTGTGATGCAGCTCAGGAAAGTCTGTAACCATCCTTATTTGATTCCGGGTACCGAGCCAGAGACAGGTACAGCGGAATTTTTGCAGGAGATGAGAATAAAGGCCTCTGCAAAGTTGATGCTTTTACATTCAATGCTGGGCAAGCTAAAAGCTGATGGACATCGGGTCCTTATATTTTCGCAGATGACCAAGCTTCTCGATATCTTGGAAGATTACCTTACTTACCAGTTTGGAAGTGAAGCGTTTGAGCGTGTTGATGGATCTGTATCTGTAGCTGAGCGACAAACAGCTATTGCTCGCTTCAACCAAGATACTTCTCGATTTGTTTTCTTGCTCTCTACTCGGTCATGCGGTCTCGGAATCAACTTGGCTACCGCAGATACTGTAATCATATATGATTCTGATTTCAACCCACAAGCCGATATCCAGGCGATGAATAGGGCTCACCGGATAGGTCAGTCGAAGACACTGCTGGTGTACAGACTTGTGGTTCGATCAAGCGTAGAGGAGCGCATTTTACAACTTGCGAAAAAGAAACTGATGCTGGATCATTTGTTTGCAAACAAGTCCGGATCTCAGAAGGAGGTACAGGACATAATTCGATGGGGTACAGAAGAACTGTTCCAGGAATCGTCAACTCCGGTGGAGGAGACGTCCTGTGTTCCACACATGACTCATTCAGGCGATGTCGAAGGGGTAGACGATGGAGAGACAAGGCTTAAGAAGAAGAGTGGGGGTCTTGGAGATGTTTACGATGATTACTATCAAAAGCTGGGCCGCTCCAAACTTGAGTGGGACGATGCGGCCGTAACCCGCCTTCTTGATCGATCAGAAATTAGTACTCGCCATCCAGATGTCAGTGAAGGAGAACATGAAAGTGATCTGCTTGGCTCGTTGAAGGCTTGGGATTGGAACGATCAAGATGTAATTCCTGAAGAGCACGAAAAAGACGATCCTAATGGAAAAGATACTGATCTGGGGATTATGAAATCTCCTCTTGCGGAAGAGGAAAATCAGTGGGACAAGCTCCTGAAATCAAGATGGGAAACCATGCAAGCTGAAGAGGAAGCTGCTCTGGGCCGTGGTAAACGCCTTCGTAAAGCTGTATCATACATTGAATCAAATGGAGAGAAACCGAAAGAACCGTCGAGTGAGTCATCAGATGCTGAGAGGGAGGACGACCCTGAACCAGATTACACTCCAGTAGGTCGGGCTTTTAAGCAAAAACTGCAAAGGCTTCGAGCAAGGCAAAAAGATCGTATTCAGCAGAGGTACAATGGGGCTGCTGGTATAGCAGAAGGGGAACGGTTGGTGACTTTGACTGGAATCCCTACCGATGGTTTGGGTGTTTTGAAGAAACTAGAACTACTGCCAGAATCCCCTGCTCCACCGTGGCCACCGCAGCCTGGCTTGCCATTTTTGAATATAGCATCAGACCCTTTCTCACAGGCTTTAAGCAAGGCAACTGCATCCTCTGTTGTATCGCATGCTGTAACTGACATACAGTCTGTAAGGAATTCAAGTTCACCTACCGCCCCGGCCATCAATGTCGATTGGTACTCAAGTAGTAAACCATCGTATCCTCAGCAGCATCATCCAGCGACTGGCACATCAAATGATGAAGGTGCGTCAAGTTCAAAACTACCGGGTCATAATCTTGGACATCCTAGGTGGCTTGGAGGTTTAGGGTCAGAGCCTAGTAGTACCTCTGTTATGACGCAAATTTTTGGGAGGCCAGCATGTGTGGGTGATGAAGTTCGAACAGAGAATGCATCTGGAGTGACGCTAGCAACTCTGTCACAAGGAACAAATGGGGGTCATTTGAGCCACCTGCTACCGGATTTTCGACAAAGTCTGCAGGGAGTGCATCAAAGCAATTCATCACGACAATCACCTCCATCGCAGATCGATTCTAGAGGATCGACACCAGGTCCTCTGGAAGTACCTTTCCAGCAAGATGGTGGATTGAGTTCTTCATCAGGTCTGCGAACCGCAAATGGTGCTAAGACTACATTCTCCTTTGAGGAAATGAAATCATATTCTGGTCATCAGTACAAATCTAAACCTCCAGACGTTGCTCTTGAGTTTTCTCAAAAGATTTTCGGCACTGAGAAAGCTCTCAACTCGGGTGTTACGTCGACAGGAGGAGAAGCTTCAACTTGCCAGGGAATCAAGCAGGGTCCTTTACAACTCTCGTCTCTTCTCCCTGTGGATCCTAGTTCTTCTCTGAAGAGTCAGAGGTCCGAGTACAGTTCAGCTTTACCAGGATCCTCTTCTCAGCCATCAACACATGATTCAAGGAGTCCCAATTTGTCAATAGCTCTGGGCCTCGGAGGTTTGATGAGTGGTAGTCATGAACATTCGAAAGAAGCGAGTCCGGCTATTGATGCCAGAAACTTCCTGGATATGCGAGTGCAGGTATCTGCTGCGTCTTCCTCAGCTGTATCTTTGATATCTACTGTCGGGGTAGATTTGAATGACTTGGGCAGAGTGGAAACTATGCCTATTGAGCTGGATGATGATCAAGATTCTCAGCCAACTGTAAGTACGAGAGGTTTCTTAAGTCCAGCGAAGATTGATGGATCAGGAAGAGGATGGCACATAGAAGAGCAAAGGAAGCACAAAGAAGAAATCGACAGAACCTGGACTGATGAAGAATTGGATGCTCTGTGGTCTGGAGTCCGGAGGCATGGGCGAGGCAATTGGGCTGCTATGCTTATCGACTCTAAATTATGCTTCTTGAAATCTAGATCTGTAGGTGAGCTGTCAGAGCGTTGGAAAGAAGAAGAAATGAAAATGTTTGCAAAACCAGAACAGGTGTCTGAAGTTATGAAGCAACCTGCAATCCGCTGGGGAGGTACGAACAAATTGTCCAATGTTGAAGGGGGATCAGAACACCTTTTGCAGCATATGAGCGGGGCTGAACGAGGAAGGCATCTCCAATCTAGTATACCTTTGGCACCGAGTTGTACTTCAGATATTGGTCTGGCTGGCCCTCACGAGAGGAGAGACGGAATGCCGTGGAGTCTTCCTGATTTAGATGTCAAGCCAGAGAAAGAAAGATTGCCATACTTTGGTTCATCTACATCTGGAAATCTTTCCACACCACCCAGCTTGGATCTCGTTGATAAAATTGGGGAGCTTGGAGGCAGTAGACCATCGATCAACTATCACAATCTGCTCGACTTGCAACCTGGACGATCATCTCCCGTGCTTCAGCCTGGCATGTCCTCGAGGAACAGCTCGTTGCCTGGAACTGCCTTGGGAGTGAATTTAGTAGGCTCCTTTGTCCCGTCGCAGGCATTGAGTAGGCTGGAAAGCAGTGGTATCTTGAAGTCAAGTGGGCATCTGGACCATGTTGGTGCGGAATCTGCTCCCTCATTGAGCCCAGGACTAGCCCTCGGTCCGGATTGGAGGAGAAACGACAGTAGGTCCAAAGAACGGGGACCTTTGCAACAATCACCAAACTTCTCTGGTGTAGAAAGTCTCAAACATCACCCTCACTTCTCGGAGAGCAATGTTTTTAAGTCACATGATTCTCACCCATCGGCCCCGTTTCCTCCCGCTCCTAGTCCTGTTTTGGGATCACCAACAGGACAATCTTTGGGCAACCGGGCTTTGGTTTCTCTTCCACACAATGGAGGAGGTTTGTCCACTGCGGACCAGAGGAGGAGGGCCAGACCGGCTCCTCCAAAGGATGAGTCGGCTTCAAGTAATTTACCTCACTGGTTGAGAGAAGCTGTCAAGGCAAGGTCTGCTCCCCCCCAGCCCCCTCTTCCACAAGCAATTGCAGCAGTAGTGCAGGCTACAAGCATGCTGTACAAGGGATCTAAGCGACTGCTCCCTCCTCTGGTGCATCCGGGGTATCCTCTTGTACCACCACGGGAACCTCCTAAGAAAGCTGAAAGGAGACGTCGTAGGCCTAAGGTGAATCCCCAAGTCACTGGGAATCCACTTGTTGCTGCACCAAATCAATCGATTATCGATCTTACGCGGTCTATTAAGCTTGAAGGCCTCAATCCATCACTCCTTCCTCAATCGGCAGAAGTAATCAGTGGATTGCTCTCCAGATCTCTGCCAACTCTTGGGCAGATGAGTACTCTATCGCGGACGAAAGGCTTCGATTTTCCTTTGATACCAAGTTTCGATCATTCTCAGCAAGTACAACCCCCTCCTGCAGGTTCGATTTCAGAAATGATGGCTCGTAGAAGCTTGATAGAGCTCGGATTCATGTCTGGACACAGTGACCCCATGTTGGCATCAACTCTGAACAGTAGCAGGAATCCTTCTCTTGAGGAGACAAATTTAGGGTCCTTAGGACAAGGAAGACGACCGCCATTTGACTTTCGTCCTCCTGAAGCGGATCTGCCTTGGAAACGAACTGACTTGCAGAGCGCGTCTTTACCAACGAGTGCCCCTTCAACGTCACGTCAGTTTAGCAGAAACAATCAAGGAGCCAATTTTTCAGAAGCTTTTTCTCAATCTGCCTCTAGAATTGCTGAGGGAAATGTTTCTGATTCGGAGAAGAAATCTCAGCTTCCTCAATGGCTGCTGAACGAAAACCCTCAACCTAAGAGTGACAGCAGGCAGAAGCAACTCCCGAAGGTCAATGTTGATGCTGATGATGGTGATGATTCTTCTTCCAGCAAAACTGTATCCGACCCTGGGATACGCGGCAAACGAGGCAAAGATGCAGACAATGAAGATGATGCCTCATCAGAAGAGACCATCTCAGATGATGGCACCCAGTAA

Protein

>Mapoly0162s0017.1
MSSELPVEVQVPVLASSKKQRSARSTARNGWGPGQPETRRLVGCSYVSTTFPRHTLVWAKRDNGVWWPAKVVGVDEIPEDLKKQEEGWTCVKYYGIDVAQAFAWLKSEDLCSYDNHLEEYSKQHLPDGIKADEFKSAMTEAQEAANNRADNAMVKPTSVIAKPQDIKSRMTPRVEKETAKEEIAAPSEDTEQAPKRRKLKLKGVDKVPVKESTSKFLLKGKEGTKDAKVIDKSVELTRKRKRMLKRPQTGTNDHELPKGETLESPTKKIGSPTGNSSSLNSRDPAKKSSSRGKKTGDDGYYFECMVCDMGGDLLCCDLCPRVYHLECLSPPLKRTPPGKWICPVCKELPGAAKGIIQTPDSKPRFKSTTHVGEPSSHVTGHKLKGLKRGWKIFHRGKPIVPDLDIKKLRKRKRDEDSERSRKRLNLKLSRPFSQTQIKCRQCGAGIHSSGESSSNVLCKECVELVKLKNSTLPAKMLATPRKDMIPTRHSKLKPGKCDICQQDGFVILCDVCPRGYHKDCLSPPRKRAPKGAWSCPKCGPSKEIKEGKETREVREAREAAKAAKAVKAVKVVKEKETKVEEREGGSPEPVVASPVTLEVERILGCRLSQATTSNKVEHSESHASDKSERLAPGENGSILWRKSEERHDIEIRLPICKVEDAEGERNLQEKVESDDASTTPLSLPGVGAQGSCSNEKGRLGVSADTTCDRSAAELSTAGKLEIDLEKGVSNEASSPAEKEFLEEKDVGSETDATNTSCTPQEVCPKMEEQVDGSGSEASTVKEDEDEEGKLLPVLFAPEKSDGNSVDTHLIAKENLSSGESKGPENSLSSEGDGLDIAVPSLSLEPACSTKSSTGTDRSAPSEARTALVDTDDPVAESSRGGAQSPSAAVDSAMKQSDREFLVKWNGKAHIHNEWVSEERLRKIAKRKLDNYKVKYGNALHVLTEEQWHHPQRIVAKRVGKGSVNEVFVKWCGLSYEDCTWELTSEPVVKKSEELVQAYDGFEKAAQESCTNTSAIDASSPDLSDLKTQRPPEIEALVEQPAYLKGGSLFPHQLEALNWLRKCWHRQRNVILADEMGLGKTISASSFLAAVHHEFKVKAPCLVLVPLSTMPNWLAEFSLWAPSLNVIEYHGSAKARTIIREHEWHAIAPDGSGKKLKQVYKFNVMLTTYEMVIQDSSQLRAIPWEVLVVDEGHRLKNSGSKLFTLLNTFSFSHRVLLTGTPLQNNFSEMFNLLNFLQPDTFPSLAAFEEKFSGLSTAEQVEELKKLVAPNMLRRLKKDSMQKIPPKTELVVPVEMNSVQSEYYKALLTKNYLLLRNGAKQQSMLNIVMQLRKVCNHPYLIPGTEPETGTAEFLQEMRIKASAKLMLLHSMLGKLKADGHRVLIFSQMTKLLDILEDYLTYQFGSEAFERVDGSVSVAERQTAIARFNQDTSRFVFLLSTRSCGLGINLATADTVIIYDSDFNPQADIQAMNRAHRIGQSKTLLVYRLVVRSSVEERILQLAKKKLMLDHLFANKSGSQKEVQDIIRWGTEELFQESSTPVEETSCVPHMTHSGDVEGVDDGETRLKKKSGGLGDVYDDYYQKLGRSKLEWDDAAVTRLLDRSEISTRHPDVSEGEHESDLLGSLKAWDWNDQDVIPEEHEKDDPNGKDTDLGIMKSPLAEEENQWDKLLKSRWETMQAEEEAALGRGKRLRKAVSYIESNGEKPKEPSSESSDAEREDDPEPDYTPVGRAFKQKLQRLRARQKDRIQQRYNGAAGIAEGERLVTLTGIPTDGLGVLKKLELLPESPAPPWPPQPGLPFLNIASDPFSQALSKATASSVVSHAVTDIQSVRNSSSPTAPAINVDWYSSSKPSYPQQHHPATGTSNDEGASSSKLPGHNLGHPRWLGGLGSEPSSTSVMTQIFGRPACVGDEVRTENASGVTLATLSQGTNGGHLSHLLPDFRQSLQGVHQSNSSRQSPPSQIDSRGSTPGPLEVPFQQDGGLSSSSGLRTANGAKTTFSFEEMKSYSGHQYKSKPPDVALEFSQKIFGTEKALNSGVTSTGGEASTCQGIKQGPLQLSSLLPVDPSSSLKSQRSEYSSALPGSSSQPSTHDSRSPNLSIALGLGGLMSGSHEHSKEASPAIDARNFLDMRVQVSAASSSAVSLISTVGVDLNDLGRVETMPIELDDDQDSQPTVSTRGFLSPAKIDGSGRGWHIEEQRKHKEEIDRTWTDEELDALWSGVRRHGRGNWAAMLIDSKLCFLKSRSVGELSERWKEEEMKMFAKPEQVSEVMKQPAIRWGGTNKLSNVEGGSEHLLQHMSGAERGRHLQSSIPLAPSCTSDIGLAGPHERRDGMPWSLPDLDVKPEKERLPYFGSSTSGNLSTPPSLDLVDKIGELGGSRPSINYHNLLDLQPGRSSPVLQPGMSSRNSSLPGTALGVNLVGSFVPSQALSRLESSGILKSSGHLDHVGAESAPSLSPGLALGPDWRRNDSRSKERGPLQQSPNFSGVESLKHHPHFSESNVFKSHDSHPSAPFPPAPSPVLGSPTGQSLGNRALVSLPHNGGGLSTADQRRRARPAPPKDESASSNLPHWLREAVKARSAPPQPPLPQAIAAVVQATSMLYKGSKRLLPPLVHPGYPLVPPREPPKKAERRRRRPKVNPQVTGNPLVAAPNQSIIDLTRSIKLEGLNPSLLPQSAEVISGLLSRSLPTLGQMSTLSRTKGFDFPLIPSFDHSQQVQPPPAGSISEMMARRSLIELGFMSGHSDPMLASTLNSSRNPSLEETNLGSLGQGRRPPFDFRPPEADLPWKRTDLQSASLPTSAPSTSRQFSRNNQGANFSEAFSQSASRIAEGNVSDSEKKSQLPQWLLNENPQPKSDSRQKQLPKVNVDADDGDDSSSSKTVSDPGIRGKRGKDADNEDDASSEETISDDGTQ

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>