Mapoly0174s0004



Description

STEROL REGULATORY ELEMENT-BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_144350
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR12565 STEROL REGULATORY ELEMENT-BINDING PROTEIN
PANTHER PTHR12565:SF3 STEROL REGULATORY ELEMENT-BINDING PROTEIN

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH44 transcription factor, bHLH Mapoly0174s0004.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0174s0004.1 scaffold_174:40840..47448  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0174s0004.1  

Gene structure:

mRNA scaffold_174:40840..47448  ( + strand )
five_prime_UTR scaffold_174:40840..41814  ( + strand )
CDS scaffold_174:41815..42091  ( + strand )
CDS scaffold_174:42183..42275  ( + strand )
CDS scaffold_174:42454..42855  ( + strand )
CDS scaffold_174:43149..43293  ( + strand )
CDS scaffold_174:43487..43626  ( + strand )
CDS scaffold_174:44257..44365  ( + strand )
CDS scaffold_174:44636..44705  ( + strand )
CDS scaffold_174:44966..45073  ( + strand )
CDS scaffold_174:45343..46220  ( + strand )
CDS scaffold_174:46518..46644  ( + strand )
CDS scaffold_174:46781..46918  ( + strand )
three_prime_UTR scaffold_174:46919..47448  ( + strand )

Sequences:

Gene

>Mapoly0174s0004.1
CTGCCTGCCTGCCTGGGCTCCTGCCTCACTCAGCCACACTCATCTTCTCATCAGCACTGGCCAGGTCGGTCAGTCACGCACGCACTCGCTCATCTGTTTCGCTTTTGGAGGAGCTCGACGAGCGACGGGAGGGGACGAGAGCTGAGCGGGCGAGAGGCGAGGCGAGGCGAGGCAGGGAGAGGGAGAGGGAGAGCGAGAGCCCAGAGCTGTAGCGATCGAGGCATTGCGTCGCTCGATTCTGGTGTAGTGGCGCCGGGTGACTCTTGGTCTTACATGTGCGTGGGAAGTCCGGCAGGCGTCGAGGACGTGGTGGCCGCTTCACGGAAAGAGCACTTGTCTTCTTCGGGCGGGCGGATTGGAGCGCAGGTCTGAGGTTCCTGGGAGCTGTACGCAATTTGGGTCGGGGCGGGCGGGGCCAAAGAACGAATCTCGCGTTGGAAACAGGAGTCGCTCGAGAGGTCTGGTCCGTCGGTGCGGGGTGTCAGGGTGGTGCGCGAGTAGTATGCTGGGGAGCAATCCGGAGGCCGCAGCAGCAGGCCAAGAGAGCATGCAGCAGGTAGAGCACGTCCGCGAGGTGGAAACGCACGACAATCATGGTAGTCTGGGGAGAAGATCCTGACACTGGTGGTATATAGGGTTTCACCGAGCCTTATTCGCGAGACGTCCGACGCAACTGGTCACTCACTGGTGGTCGAGGTGCGACTCGCGGAAGTCGGGAGGAATTTGCTTCACGCACGACTCAGCAATTCCAGAGCAACCAACCCGCGGGAGAGGGTTGTTCAATTCGGTCGGGGAATTTCTTGGGCAAGAATTGCCGGTGGAATAAGCGCCGCAGAGCATGTGATCAGGGGCCAGTGCTGAGAGCACGAAATTTGTTCGCCCGAGCCTGAGGTTTCACTCGGGCACTCGACTGAGAACGCGCCTGTCGATCGCCAGCGGTGAGCATGGACTCCTGATAGTAACAGCACCGCGGTAATGGCGTTTTCCTCATCGGGAACACCCATGAGCATGAAGGAGCACTCGCTGGGAGTAAGCATCGGGCCCGGGGCGTCCGTCGGTGTTTCGTCTGCTGGGTACACCACCTTCGCCCCTGCCTCGCACGATTTTCAGGGCCCGGTGGAGTTTTCGCAGCAGCAGCGCGAGTATCTGGCGCAGCGGAGCATGATGGGCCAGGCGGCCGAGCAGCAGCACTCGCAGGGCCGCGGCCAGGGCGGAGGCCATTCGCAGGGCCAGCACATCAACATGAACGAAGGTACGTGATCGCATCCTCCTCCGTGTGTCAGAGCCTCGCCTCGCCTCGCCCCGGCTGAGTGTCTTAACCGTTGGAGTCCCGTGCATGGCAGGTGCCAAGCCTTCCACCGTTTCAACTCACGATTTTCTGTCTCTGTATGCCGATAACTCGAACCAGTACGCCGAGCATCACGACAATATGCGAGGTGACAGTCACTCCCCCTTGCACTCAGTCCGCGCTTCGTGTAGTTGGTTGACTGAGACAGTCCGGTGCATGTTGCTAGATCCGATCGGCTCTGTGTTGTGGCGATTGTGCCCCGGCGCGGTCGAGATGTGCGCCTTCTCACTGTCGCCCGGTGAATTGTTCACCTGTTTCCGCCGCAGGGTTGTCGTCGGCCTTGACAACCAAGGATTTTCTGCAGCCTCTGGAGACGCGAGGCAATCACGCAGCTTTCCGAGAAGGGCAGCCGTCGCGAGGTGAGAAGCACCCCCGACAACCCGAAGGCTTGCCCCACGGCAGCACTCCTGCTCCGCCAGCTGTGGTCGAGCGGCTCCTCTCCACTGGCATGAATGTGTACAACGGTGGGCACGGGGTGCCGAACTACGGGCGCGTTGCTAAAGGTGCCATAGACTTGCCTGCGAACACAATGGTTAGAATGGTCGGTGAAGGAAATGTGGAAATGAGGGGCAGGGGAGGATTCAATCCCTCGGCCGGTTCCATGGTGACCCGTGAGGATCACGATGCTCGAAACGACCTTCCCAAAGATCAGGATGCTGCCCCAAGAGGTAACACTTCGGGTCTGCAAGTCTTCTCTGAGCTCGTTCGTATTTCGGGGTCGCCGAAGAATGATTTTTCGTTTCATTGGAATGTCGACCGGCCGAGGCCCCTAGCATTGAGCTTCATGAAGTCAATTGTCCTTTGTTTTTCGGGTTCTGGAAAAAGTCGTCTCGCCACCCTTCAAATTCTCCATGGAGAGCGCGATGTTCGCAAAACGCACAACGAACATCGCTGTGCGTTTGCTTTCGGTTTTGCCCGGCTCACATTCTCGAACTAAGTGGTCTGTTCCTTCATCGTACAGGTGACAACCTCGCATACTGGTCAAACGTCCGCATGAAATTCGGGATGCTTCCTCCAGAGTTGAATTACCATTCCCAGCCTAACCAACCCACATCTCATGTCGTCATGGAAAATGTACAGCAACCACCTGTACCCAACATGCCTAAGTAAGTTATCTTTTGACGATGATTTAGGGCTGCTTGTCAGCAGTTTTGCATGGCATTTATGCTTAGTTTTTCTGCATGTATCATGGTTGGAGCTTGCCTTTATTTGGTCATCCAAACTTTCCTTACATTTACGGACGTTTCAAACACCGATGGGCCAAATCAGCCAAGGATGTCTAATTCTCTGCTCTTACAGGCCGTGGCCACAGGGTGTTCAGGGAGTGATTGACATGACCAAAAGGCCTACCAGAGTACTGTCGGAAGACGACGAAGATGATGAGGAAGAATATGGAGATCGTCCGAGGGAAACCCGCAGCAAAGAACCCTTGTCTAAAGGTAGACAATGATTACCTTATTCTGTGAGGAGTGTGCGACTTCTTTTTATATATTGTCGAAAGTCCAACGAACTTTGCGGTGTTATGTATGCACTTCAGCGAATTGTGCTCTCTACTTAATTGATTTGCTGATTTCGACGTTTATGTATAACTTGAGGCGGAACAAATACATTTCTCATTCTCTATATTTGTTACTCTCATTTTGATTCTGGTCTCTCTTTCTGAATTTTGACTTGACATGTGTAAGTGAAAACTATCTGAAGATACGATCTGTAGTGAGGAAACTCTTTCTTTCTTTATCTTATAATCATCCCATAATGAGCACTGGAATGAAAGGTGTTGAAAGCCTGGGGCCACCTTGGATCAATCAGTCTAAACAGAGATTCATATTAAAAAATTATAACCACGATGTCATTAAAATATAAACTAACGATGAACATGTTTTACAATATATGTTCATCGCGTAGTTGTTCTACGGCTTAGAAAGGATACAGAATAAGTTGATTTCTCTGCGGAGAGTGAAGTTGTACATTTTGTTCAAATTCAGTCCTTATTTCCCATCCACTTCTCCCTCGTGTCCCTTCCTGCTTGACGTCCTAGAAAGTACTAACAGGATTGCGGTCATTTGCAGCTGATCCAGCGCAGAAGGTTGACGGTAAAGCACCCGAAAACAGAGGTGGAACGCCAAGATCAAAGCACTCAGCCACTGAACAACGGAGACGCAGTAAGATTAACGACAGGCAAGTCTTATTTTTTCAACAGAGTCGCGTCTCTTCAAAAATGAAGAAAGTCGATGGGCACAGAAGGTCGCACTTAGCTACAAATGAGTTATCCGGACAAGAAAGAAGGAACATTTCCTCTCGCTTATCGGTTATTGTGATTCTGTTCAGTGCGGATTTCTACTCAAGTGTATTGGTTCTCGTCGTTTTCTCCGTCCGGGAGAGACTATCTCCATCTTTTCAGAATCTAATTGCATGTAGCTTACTTTTTCAAAACTTCGTTTACTGCAGGTTCCAGATGTTAAGAGAACTAGTGCCTCACAGTGATCAAAAGAGGGACAAAGCTTCTTTTCTTTTGGAAGTAAGAACTTTTTACCTACTCAGTTCCTTATCCAGATTGTGGTTGTTGGGTGATTCGCCTCGTCTTGTGTCCAGTTATCAGAAAATGGACAGAGCTGAATTTCTTCTGGAAGTAAGGGCCTTATATTTCAAAGTGGGAGGAGCGGGTTTTAGAGTGAAGACTTCTGGTGTACGGGCACGTGATTGGTTTCCCTTGACATTGAATGGCATGTGTGTTCAAGAAAATTTTTGTAACATACCTTTCCACACATTTTGCTTCAGGTGATCGAGTACATTCAGGTCTTGCAAGACAAGGTTCGAAAATTTGAGACTGCTGAGCAGGGAAGGCATCAAGATCGCCTAAAAAACATGGTCTGGGATCTTTGCAAGGTGCCAAGCAACTGCTAGGATAGTTGACTGTCATTCGATGTAGCATGCAGAGATTAATGATTGCGATCTTTCGTTTCTGCTTTTGAACCGTTGGGAGTCACTTCCATGTCTGCGAACGTGGACTACTCTTCAAATTTTTTCTGTTTCTCCTGTTCTCTGTTCTCCCATATTGTACGAGTTATTCAGTTGTCTTTTCAGAGCAAGGGCTTAATGTGTGCTCCTTCAAGATAATGTTATCTCACCTCTCATTCGGTTTTTCTTTCCTTCAGAGAGGTGGATCTGGTCCCGGAGATACAAGTATCGAAGCTACGTGCATGGATGCTCTTGCGTACGCGAAGGAGTTTGTGCCTTCTTCTGCCGGACTACCAATCGACGTTAAGCAAGTGACTGAAGCCGCTGAGGTGGTTAGGCAGAGGGCTGTAGCCAATGCTGACGAAAATGGTAGCACCGAGTTGTCACACAATCCACAGCACACTCACAAAAGTGGACATCATGGAGCTAGTTCGTCTCACGATGAGAAAGAGGGTGCAGCCGTATTGGGAAAATCGCCCTTGTCGTCTCAACAGCATCAAGGACAGACCACTTTTAGTAGTAGAAACCTACAACACGCTTCACAGTCCAAGCAGCTAAGTGCTGCTTCCGATGCCCAAGCCAATGTTGCCGGTGAAGGGCAAGTACAGAATTCTTCTACCATTGCCCCTGCAACGGGAGCATACGATCAACATGATAAAGCGAATGAGGTGGAGCCCTCACAACAAACTAGGACTCAGGCAAGCACTCAACAATCACAAGGTGAAGGGGATACCAGCGATCAGCAACATCCAGACACCAGACATCGACATGGAACTACCACGGCGGAAGATACAGGCAACGGGCATGCTGCATCTTTCACTGATGACCAATCAAACACGAAGCCTCACATGAAATCGGACCGACAACATGGCTACGGAAGTTCTCCTCGATCCACGCATAACTCTCAGGCCACGGATACTTCTCAGGCCAATTGGCAAGGCCAGCAACATGGCAGTTCAGCTGAAAACTCTCAGCAAAAGGAAGAGTCACGCGGAGCCACAACAAGTGCACAAGGACAAGACCCACTGACGATTCAAGGTGGTGTCATCAACGTCTCCAGTGTCTACTCCCAAGGGTGAGTGAAGCCAACAGAGTTGCTGGGTACCCTACTGTCGTTTGTCCGGTTGACACCGTTCAAAGTGAGATTGATGATTCAGATGCAAGGATTTCATGCTTTTAGAACTCCCCTAGGGTTGTAGAATTGCCGTTGTGATCTGGACTCTGTTCAATTGTTTGAGAGGCCTTCACAATGTTCGTAGTTTGGAGATTGTGAAGGTTTACTTCAAACTTCCTGAAATGCCTTGGAATTTAATTCTGTTGAGCTGAAATCGTGTTGTCAGGTGCTAATCCACACATGTTTACTGATTGACAGGCTGCTTGACACATTAACACGAGCGTTGCAAAGTTCGGGACTAGATTTGTCCCAAGCCAACATATCCGTCCAAATTGATCTAGGGAAGAGTATTTCATCTGCAGCTCTCCCTCCATCTACCCCGAAGGTACTTGTTTTTTCTCCAGTGAATGTCGAGAATATATTTCAACTTGTTGAGATGAGTGCTTCTCATGCTATGTTCGACCTGTCGTGATTTAAAAATACATTTGCTGATTAAATTCCCTCGAAATTTTGGACACCAGGTGAGCGGACAACCAGCTGAAACTTCGGGGCAAAGACATCAACAACAATCTGAGAGTCATACAAGGCAGCAGGGAGGGTCAAGTACAGACCCAGAACATCCTCCTCTCAAACGGCCAAAGCTAGAGATGGAGCTGTAAAACTAGTGCAGAGGAAGTCAAAAGCAACGTATCATATATTTGTCATCACATGTCTGGTTTGGTCTGAAGGACGTGGGGTGACAAATAGGCCCGCTGATTGGATATGTGCATGAAAAGGACGGATGTTCCTATCTTCGACAGGGTTTTAAGTCCATCTCTTTTACAAAAGTTCTTGGAACCCACTTTCAGATGGTATCACATGGCTGCCAGTGTATACGGTGGCTGTCTGAGTAAAGGCGGCCGATCTTGTTAAGGTGCATGATGCAAACATCAGTCAACTGCAACATGCACTTAGAATCAATCCATTTCATGCAGACAGTGCAGTTTTTCTTGCAATGTGTGGCAGAACGGTGAACTGCCAACCTCTCATTATCTAGCACTTGTAAAGCGTTGTGAATTTTCCATTCGTTTGGATCCCATAGAAAATTAAGTGTCGTGGTGCCCCGCCAGCCAACAGTTAGTTGTAAATTAGGCCTCAATCAACAGTTATCTTATCGATGCGTAATAAAGCTCCAACATAAAATTCCAGC

mRNA

>Mapoly0174s0004.1
CTGCCTGCCTGCCTGGGCTCCTGCCTCACTCAGCCACACTCATCTTCTCATCAGCACTGGCCAGGTCGGTCAGTCACGCACGCACTCGCTCATCTGTTTCGCTTTTGGAGGAGCTCGACGAGCGACGGGAGGGGACGAGAGCTGAGCGGGCGAGAGGCGAGGCGAGGCGAGGCAGGGAGAGGGAGAGGGAGAGCGAGAGCCCAGAGCTGTAGCGATCGAGGCATTGCGTCGCTCGATTCTGGTGTAGTGGCGCCGGGTGACTCTTGGTCTTACATGTGCGTGGGAAGTCCGGCAGGCGTCGAGGACGTGGTGGCCGCTTCACGGAAAGAGCACTTGTCTTCTTCGGGCGGGCGGATTGGAGCGCAGGTCTGAGGTTCCTGGGAGCTGTACGCAATTTGGGTCGGGGCGGGCGGGGCCAAAGAACGAATCTCGCGTTGGAAACAGGAGTCGCTCGAGAGGTCTGGTCCGTCGGTGCGGGGTGTCAGGGTGGTGCGCGAGTAGTATGCTGGGGAGCAATCCGGAGGCCGCAGCAGCAGGCCAAGAGAGCATGCAGCAGGTAGAGCACGTCCGCGAGGTGGAAACGCACGACAATCATGGTAGTCTGGGGAGAAGATCCTGACACTGGTGGTATATAGGGTTTCACCGAGCCTTATTCGCGAGACGTCCGACGCAACTGGTCACTCACTGGTGGTCGAGGTGCGACTCGCGGAAGTCGGGAGGAATTTGCTTCACGCACGACTCAGCAATTCCAGAGCAACCAACCCGCGGGAGAGGGTTGTTCAATTCGGTCGGGGAATTTCTTGGGCAAGAATTGCCGGTGGAATAAGCGCCGCAGAGCATGTGATCAGGGGCCAGTGCTGAGAGCACGAAATTTGTTCGCCCGAGCCTGAGGTTTCACTCGGGCACTCGACTGAGAACGCGCCTGTCGATCGCCAGCGGTGAGCATGGACTCCTGATAGTAACAGCACCGCGGTAATGGCGTTTTCCTCATCGGGAACACCCATGAGCATGAAGGAGCACTCGCTGGGAGTAAGCATCGGGCCCGGGGCGTCCGTCGGTGTTTCGTCTGCTGGGTACACCACCTTCGCCCCTGCCTCGCACGATTTTCAGGGCCCGGTGGAGTTTTCGCAGCAGCAGCGCGAGTATCTGGCGCAGCGGAGCATGATGGGCCAGGCGGCCGAGCAGCAGCACTCGCAGGGCCGCGGCCAGGGCGGAGGCCATTCGCAGGGCCAGCACATCAACATGAACGAAGGTGCCAAGCCTTCCACCGTTTCAACTCACGATTTTCTGTCTCTGTATGCCGATAACTCGAACCAGTACGCCGAGCATCACGACAATATGCGAGGGTTGTCGTCGGCCTTGACAACCAAGGATTTTCTGCAGCCTCTGGAGACGCGAGGCAATCACGCAGCTTTCCGAGAAGGGCAGCCGTCGCGAGGTGAGAAGCACCCCCGACAACCCGAAGGCTTGCCCCACGGCAGCACTCCTGCTCCGCCAGCTGTGGTCGAGCGGCTCCTCTCCACTGGCATGAATGTGTACAACGGTGGGCACGGGGTGCCGAACTACGGGCGCGTTGCTAAAGGTGCCATAGACTTGCCTGCGAACACAATGGTTAGAATGGTCGGTGAAGGAAATGTGGAAATGAGGGGCAGGGGAGGATTCAATCCCTCGGCCGGTTCCATGGTGACCCGTGAGGATCACGATGCTCGAAACGACCTTCCCAAAGATCAGGATGCTGCCCCAAGAGGTGACAACCTCGCATACTGGTCAAACGTCCGCATGAAATTCGGGATGCTTCCTCCAGAGTTGAATTACCATTCCCAGCCTAACCAACCCACATCTCATGTCGTCATGGAAAATGTACAGCAACCACCTGTACCCAACATGCCTAAGCCGTGGCCACAGGGTGTTCAGGGAGTGATTGACATGACCAAAAGGCCTACCAGAGTACTGTCGGAAGACGACGAAGATGATGAGGAAGAATATGGAGATCGTCCGAGGGAAACCCGCAGCAAAGAACCCTTGTCTAAAGCTGATCCAGCGCAGAAGGTTGACGGTAAAGCACCCGAAAACAGAGGTGGAACGCCAAGATCAAAGCACTCAGCCACTGAACAACGGAGACGCAGTAAGATTAACGACAGGTTCCAGATGTTAAGAGAACTAGTGCCTCACAGTGATCAAAAGAGGGACAAAGCTTCTTTTCTTTTGGAAGTGATCGAGTACATTCAGGTCTTGCAAGACAAGGTTCGAAAATTTGAGACTGCTGAGCAGGGAAGGCATCAAGATCGCCTAAAAAACATGGTCTGGGATCTTTGCAAGAGAGGTGGATCTGGTCCCGGAGATACAAGTATCGAAGCTACGTGCATGGATGCTCTTGCGTACGCGAAGGAGTTTGTGCCTTCTTCTGCCGGACTACCAATCGACGTTAAGCAAGTGACTGAAGCCGCTGAGGTGGTTAGGCAGAGGGCTGTAGCCAATGCTGACGAAAATGGTAGCACCGAGTTGTCACACAATCCACAGCACACTCACAAAAGTGGACATCATGGAGCTAGTTCGTCTCACGATGAGAAAGAGGGTGCAGCCGTATTGGGAAAATCGCCCTTGTCGTCTCAACAGCATCAAGGACAGACCACTTTTAGTAGTAGAAACCTACAACACGCTTCACAGTCCAAGCAGCTAAGTGCTGCTTCCGATGCCCAAGCCAATGTTGCCGGTGAAGGGCAAGTACAGAATTCTTCTACCATTGCCCCTGCAACGGGAGCATACGATCAACATGATAAAGCGAATGAGGTGGAGCCCTCACAACAAACTAGGACTCAGGCAAGCACTCAACAATCACAAGGTGAAGGGGATACCAGCGATCAGCAACATCCAGACACCAGACATCGACATGGAACTACCACGGCGGAAGATACAGGCAACGGGCATGCTGCATCTTTCACTGATGACCAATCAAACACGAAGCCTCACATGAAATCGGACCGACAACATGGCTACGGAAGTTCTCCTCGATCCACGCATAACTCTCAGGCCACGGATACTTCTCAGGCCAATTGGCAAGGCCAGCAACATGGCAGTTCAGCTGAAAACTCTCAGCAAAAGGAAGAGTCACGCGGAGCCACAACAAGTGCACAAGGACAAGACCCACTGACGATTCAAGGTGGTGTCATCAACGTCTCCAGTGTCTACTCCCAAGGGCTGCTTGACACATTAACACGAGCGTTGCAAAGTTCGGGACTAGATTTGTCCCAAGCCAACATATCCGTCCAAATTGATCTAGGGAAGAGTATTTCATCTGCAGCTCTCCCTCCATCTACCCCGAAGGTGAGCGGACAACCAGCTGAAACTTCGGGGCAAAGACATCAACAACAATCTGAGAGTCATACAAGGCAGCAGGGAGGGTCAAGTACAGACCCAGAACATCCTCCTCTCAAACGGCCAAAGCTAGAGATGGAGCTGTAAAACTAGTGCAGAGGAAGTCAAAAGCAACGTATCATATATTTGTCATCACATGTCTGGTTTGGTCTGAAGGACGTGGGGTGACAAATAGGCCCGCTGATTGGATATGTGCATGAAAAGGACGGATGTTCCTATCTTCGACAGGGTTTTAAGTCCATCTCTTTTACAAAAGTTCTTGGAACCCACTTTCAGATGGTATCACATGGCTGCCAGTGTATACGGTGGCTGTCTGAGTAAAGGCGGCCGATCTTGTTAAGGTGCATGATGCAAACATCAGTCAACTGCAACATGCACTTAGAATCAATCCATTTCATGCAGACAGTGCAGTTTTTCTTGCAATGTGTGGCAGAACGGTGAACTGCCAACCTCTCATTATCTAGCACTTGTAAAGCGTTGTGAATTTTCCATTCGTTTGGATCCCATAGAAAATTAAGTGTCGTGGTGCCCCGCCAGCCAACAGTTAGTTGTAAATTAGGCCTCAATCAACAGTTATCTTATCGATGCGTAATAAAGCTCCAACATAAAATTCCAGC

CDS

>Mapoly0174s0004.1
ATGGCGTTTTCCTCATCGGGAACACCCATGAGCATGAAGGAGCACTCGCTGGGAGTAAGCATCGGGCCCGGGGCGTCCGTCGGTGTTTCGTCTGCTGGGTACACCACCTTCGCCCCTGCCTCGCACGATTTTCAGGGCCCGGTGGAGTTTTCGCAGCAGCAGCGCGAGTATCTGGCGCAGCGGAGCATGATGGGCCAGGCGGCCGAGCAGCAGCACTCGCAGGGCCGCGGCCAGGGCGGAGGCCATTCGCAGGGCCAGCACATCAACATGAACGAAGGTGCCAAGCCTTCCACCGTTTCAACTCACGATTTTCTGTCTCTGTATGCCGATAACTCGAACCAGTACGCCGAGCATCACGACAATATGCGAGGGTTGTCGTCGGCCTTGACAACCAAGGATTTTCTGCAGCCTCTGGAGACGCGAGGCAATCACGCAGCTTTCCGAGAAGGGCAGCCGTCGCGAGGTGAGAAGCACCCCCGACAACCCGAAGGCTTGCCCCACGGCAGCACTCCTGCTCCGCCAGCTGTGGTCGAGCGGCTCCTCTCCACTGGCATGAATGTGTACAACGGTGGGCACGGGGTGCCGAACTACGGGCGCGTTGCTAAAGGTGCCATAGACTTGCCTGCGAACACAATGGTTAGAATGGTCGGTGAAGGAAATGTGGAAATGAGGGGCAGGGGAGGATTCAATCCCTCGGCCGGTTCCATGGTGACCCGTGAGGATCACGATGCTCGAAACGACCTTCCCAAAGATCAGGATGCTGCCCCAAGAGGTGACAACCTCGCATACTGGTCAAACGTCCGCATGAAATTCGGGATGCTTCCTCCAGAGTTGAATTACCATTCCCAGCCTAACCAACCCACATCTCATGTCGTCATGGAAAATGTACAGCAACCACCTGTACCCAACATGCCTAAGCCGTGGCCACAGGGTGTTCAGGGAGTGATTGACATGACCAAAAGGCCTACCAGAGTACTGTCGGAAGACGACGAAGATGATGAGGAAGAATATGGAGATCGTCCGAGGGAAACCCGCAGCAAAGAACCCTTGTCTAAAGCTGATCCAGCGCAGAAGGTTGACGGTAAAGCACCCGAAAACAGAGGTGGAACGCCAAGATCAAAGCACTCAGCCACTGAACAACGGAGACGCAGTAAGATTAACGACAGGTTCCAGATGTTAAGAGAACTAGTGCCTCACAGTGATCAAAAGAGGGACAAAGCTTCTTTTCTTTTGGAAGTGATCGAGTACATTCAGGTCTTGCAAGACAAGGTTCGAAAATTTGAGACTGCTGAGCAGGGAAGGCATCAAGATCGCCTAAAAAACATGGTCTGGGATCTTTGCAAGAGAGGTGGATCTGGTCCCGGAGATACAAGTATCGAAGCTACGTGCATGGATGCTCTTGCGTACGCGAAGGAGTTTGTGCCTTCTTCTGCCGGACTACCAATCGACGTTAAGCAAGTGACTGAAGCCGCTGAGGTGGTTAGGCAGAGGGCTGTAGCCAATGCTGACGAAAATGGTAGCACCGAGTTGTCACACAATCCACAGCACACTCACAAAAGTGGACATCATGGAGCTAGTTCGTCTCACGATGAGAAAGAGGGTGCAGCCGTATTGGGAAAATCGCCCTTGTCGTCTCAACAGCATCAAGGACAGACCACTTTTAGTAGTAGAAACCTACAACACGCTTCACAGTCCAAGCAGCTAAGTGCTGCTTCCGATGCCCAAGCCAATGTTGCCGGTGAAGGGCAAGTACAGAATTCTTCTACCATTGCCCCTGCAACGGGAGCATACGATCAACATGATAAAGCGAATGAGGTGGAGCCCTCACAACAAACTAGGACTCAGGCAAGCACTCAACAATCACAAGGTGAAGGGGATACCAGCGATCAGCAACATCCAGACACCAGACATCGACATGGAACTACCACGGCGGAAGATACAGGCAACGGGCATGCTGCATCTTTCACTGATGACCAATCAAACACGAAGCCTCACATGAAATCGGACCGACAACATGGCTACGGAAGTTCTCCTCGATCCACGCATAACTCTCAGGCCACGGATACTTCTCAGGCCAATTGGCAAGGCCAGCAACATGGCAGTTCAGCTGAAAACTCTCAGCAAAAGGAAGAGTCACGCGGAGCCACAACAAGTGCACAAGGACAAGACCCACTGACGATTCAAGGTGGTGTCATCAACGTCTCCAGTGTCTACTCCCAAGGGCTGCTTGACACATTAACACGAGCGTTGCAAAGTTCGGGACTAGATTTGTCCCAAGCCAACATATCCGTCCAAATTGATCTAGGGAAGAGTATTTCATCTGCAGCTCTCCCTCCATCTACCCCGAAGGTGAGCGGACAACCAGCTGAAACTTCGGGGCAAAGACATCAACAACAATCTGAGAGTCATACAAGGCAGCAGGGAGGGTCAAGTACAGACCCAGAACATCCTCCTCTCAAACGGCCAAAGCTAGAGATGGAGCTGTAA

Protein

>Mapoly0174s0004.1
MAFSSSGTPMSMKEHSLGVSIGPGASVGVSSAGYTTFAPASHDFQGPVEFSQQQREYLAQRSMMGQAAEQQHSQGRGQGGGHSQGQHINMNEGAKPSTVSTHDFLSLYADNSNQYAEHHDNMRGLSSALTTKDFLQPLETRGNHAAFREGQPSRGEKHPRQPEGLPHGSTPAPPAVVERLLSTGMNVYNGGHGVPNYGRVAKGAIDLPANTMVRMVGEGNVEMRGRGGFNPSAGSMVTREDHDARNDLPKDQDAAPRGDNLAYWSNVRMKFGMLPPELNYHSQPNQPTSHVVMENVQQPPVPNMPKPWPQGVQGVIDMTKRPTRVLSEDDEDDEEEYGDRPRETRSKEPLSKADPAQKVDGKAPENRGGTPRSKHSATEQRRRSKINDRFQMLRELVPHSDQKRDKASFLLEVIEYIQVLQDKVRKFETAEQGRHQDRLKNMVWDLCKRGGSGPGDTSIEATCMDALAYAKEFVPSSAGLPIDVKQVTEAAEVVRQRAVANADENGSTELSHNPQHTHKSGHHGASSSHDEKEGAAVLGKSPLSSQQHQGQTTFSSRNLQHASQSKQLSAASDAQANVAGEGQVQNSSTIAPATGAYDQHDKANEVEPSQQTRTQASTQQSQGEGDTSDQQHPDTRHRHGTTTAEDTGNGHAASFTDDQSNTKPHMKSDRQHGYGSSPRSTHNSQATDTSQANWQGQQHGSSAENSQQKEESRGATTSAQGQDPLTIQGGVINVSSVYSQGLLDTLTRALQSSGLDLSQANISVQIDLGKSISSAALPPSTPKVSGQPAETSGQRHQQQSESHTRQQGGSSTDPEHPPLKRPKLEMEL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>