Mapoly0182s0009



Description

Multidrug/pheromone exporter, ABC superfamily

Reference DB

Database ID Description
GO GO:0005524 ATP binding
GO GO:0006810 Transport
GO GO:0016021 Integral to membrane
GO GO:0016887 ATPase activity
GO GO:0042626 ATPase activity, coupled to transmembrane movement of substances
GO GO:0055085 Transmembrane transport
KOG KOG0055 Multidrug/pheromone exporter, ABC superfamily
OrthoMCL OG5_126596
PFAM PF00005 ABC transporter
PFAM PF00664 ABC transporter transmembrane region
PANTHER PTHR24221 FAMILY NOT NAMED
PANTHER PTHR24221:SF138

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABCB4 Auxin transport Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0182s0009.1 scaffold_182:79934..88560  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0182s0009.1  

Gene structure:

mRNA scaffold_182:79934..88560  ( - strand )
three_prime_UTR scaffold_182:79934..80973  ( - strand )
CDS scaffold_182:80974..82212  ( - strand )
CDS scaffold_182:82409..82650  ( - strand )
CDS scaffold_182:82790..83205  ( - strand )
CDS scaffold_182:83340..83716  ( - strand )
CDS scaffold_182:83984..84207  ( - strand )
CDS scaffold_182:84690..85009  ( - strand )
CDS scaffold_182:85133..85392  ( - strand )
CDS scaffold_182:85936..86136  ( - strand )
CDS scaffold_182:86321..86496  ( - strand )
CDS scaffold_182:86742..86796  ( - strand )
CDS scaffold_182:87148..87675  ( - strand )
five_prime_UTR scaffold_182:87676..88560  ( - strand )

Sequences:

Gene

>Mapoly0182s0009.1
GAGAAGCAGCTGAACGAGGAGCCCGTTGCAACTATAAACTAACTGCTGCTGCGACTGCGGTCGGCGTCTCTCTCTCGGTTCTGCTCTTCTCTTCTCCCTTGTCTGCTAATCGAATTCTTGCTCGACCGGTCCCGATCCTTCCTTCCTTCAATGTCGGGGCCGTTCGGACCAGGCGAGTCAGGAGCACCGATCGAGCTTCCTTCCATTCTGCTGTTCTTGCCCGGCCTCGCGAATTTCTCTGACCAAATTTCGGCCTCGTGCTCGCTCGAACGATTTGCGCCAGTTCACCGATTTTCCGGACTCTGACAAGGGAAACGATGGACTCTGGACTCTGGACTCGGATCATCCGGAGCCTGACGAAATACTGAGGTGTAAACAAACGAACGCACGTGAGGGGATGGGTGGGTGAATGAGTCGAGGCAGAATCGTTCAGCAGGACACGATGCGCTTGGAGCCTCGCCTTTGATGGGAAGTCTCCAAAGATCGATCAATTGTGAGATTTCGCGAGCGCCTGCCCGATCGCTCGTGAGCAGTTCCCACCGAGTTAGAGATCGAGATGTTTGAGATCGTGGAACGACTTCTGAGCATGCTTCTCAGTTCGCTTCTCTGGCCCGTGTCTGTCAAGGACAGATGAAACTGCCGTGGGTTCCTCTGAGCGTCATGAAGGGCGTGGCAGGTCTCGCTGCCGCCGTCGAGTGCACCTCCAACCGCCCCTACAGAGCATGCGGAAGTCACCTGGACTGCTGCAGGATGCCCTTGCATTAACGAACTCTGCCCTCGCTTCCGAAATCCTCATCGCCCGTCTTCGTGCACGAGTGTCTGCGAGGCAAGATTCCAGAGCTGCAAAGTCCAGTGGCTCGGATTTGCAGACCAGCTGCAACTGAAATGGCTCGAACGGGAGAAGCGAGCATTGATCTCTACGAAGCTGATTTGGAGAATTGCTGGAAGATCGACGGCAGCGAACTGAGTCTGGACAAATCACCGAGTCTCAGAAAGGGAGTGGACGCACTGCCTGCATTGGCCATAACAGCCCATCATGAACTGGAAGATCCGACTGCGTCGCTTCCCACTTCTACCAGCGATCTGGACGAATGTTGTGGAGTTGGCGAGGCATTGACAGTGGCTGAATTCGAGTCCCTTGACCAACACGGGAAGCGAGACAGCGGGCTCGGGGCGTGCGAGCGCGACAAGGAAAGTGGGGCAGCTGCCGATGAGAAAATCCACCAGGTTTCCTTTTACAGGCTCTTCTCATTTGCCGATGGTGTGGACTACTTGCTCATGGGCTTCGGGACGCTCGGAGCTTGCACTCATGGAGTGGCTGTTCCTGTCTTCTTCATTTTCTTCGGCAGGCTCATCGACGCATTCGGAGCCAACTACAACAATCCCTTCCGAATGGGCCATGAGGTTTCCAAGGTCACATTCTTCTTCGAACCTCATTCCACCTGCTACCAGTCCACTGGCATATTTTCCAGGGGTGTTTTGCCACAGCAGTCACCTGCCGATTCTGACAACGCCATGAACAGTTCCAGATGTAGCTGCAGAGTTCATGAACTTAAAATTATATGATCTGATGACATTGATATTCTGTCAGGGCCTCATTATTCTCGAGAAATATGGTGACCACGTTTTCTTTCTTAGATGCAAGGAGAACGCTGTATTATTCTACGAAGTCCAAACCATTCTCTCCTATGCACGTAACAACACTGATCACTTGGTTTCAATCCAGTATCGATGCTTACATATGGCGCCTGTCAACTCCTGCAGTACTCTTTGTACCTGTTCTACTTGGGACTCGTCGTCATGGGCGCATCCTGGCTAGGTACGAGGACGTTTCCTGTTTGAACGGATAGCAATGTGAGTCCATGCTGAATGCAGTCATCGAAAGGTTTAATAAGTCCTGTAACAAAGTCTCTGAAGTTCATGAACACGAGACGTGATGAGATGGAGAACAGAGAGCTTTGAGCATAGAATAAAACAAAGCTATTTTCACGTTGGATTTGCTCTGTTTTGCTTTGCGCTTCGAGTGAAGGCTGGATTATGAGTTCAAACGTCGGGGACACGCAGAGGTGTGGTGCTGGATGCAGACAGGCGAGAGACAATCAGCTCGGATGCGAAGCATGTACTTGAAAGCGGTTCTCAGTCAGAATATGACCTACTTTGACACAAGAGGAACGACGAATGAAATCGCCACTCGCATAGCAAATGACACTGCCCTCGTGCAGGATGCCATCAGTGAAAAGGTTCTCTGAGCTGCGCTTGCCTTCAAATTCATCGTGAAGAACTACAACTTTCAAACACAATCACTTTGTGGACTTAGCTCTGCTACTTCTACTACTTCTTCTAAATCTTCTGCTTCCAGTACTGCACTGCTTTCGAGTCGTCTGACAACCACGTAAAATCTGAAAATGAACTGTTGTGGTTTAGGCAGGGAACTTCCTGCACTTCACGGCGAAATTCATAGTGGCCTTCGCAGTGGGCTTCTGCTCAGTTTGGCAACTCTCACTGATCACTCTGGCAGTAGTGCCTGCCATTGTGATGTCCGGTGCTGCTTACACTGTGATAATGACTGGACATGCGACCAAGGGACAGAAGGCGTACGAAGAGGCTGGGAAGGTGGCAGAACAGGTAAGAAAAAGTGCTACTCCTACTTCCGTCGAGGCTCATAGGAAACTGGCCGGGGAATCCAGTAGAAACAGAACCCGTTGTTTCACCGAAGAAGCACCAAAACCATTCACCAAGTCAAACGCAAAACTATGAATCACCCGCACAAAGACTGCCAAGCATCTGGTTCCAAGTGTTCTCCATTCAGATTGACAGAACGAACTAGAAGCAATACTGAACTGATTGTGTCTAAAAACTCTACCTTGGACAGCTCTGCCTTCTACATTATAATACTGGAAGTGAGAAGATCTATTAAAAGCACAAAGCCCCTAAGAAGGTCATTGACCGTCTAGCTCCCCCGATTCAATACGTCTTGCGTCCACGCAGATAAAACAGTAAAGCATTTACTCTGTGAATCATCAGATCGTCATTCTCGAACGTATTCCAGAAGGGTGTTGATGAAAGCAAAAGGGTCCAGGCCACATGATTGCACTAAGCTCTCGGAAGAATATCCTTTGAGGGATGGTATGGAAGGATGATTCTGAGCCCTAACAATGTCCATTTTAGGTGATAGCTCAAGTGCGGACAGTTTACTCCTTCGTTGGAGAGGCAAGGGCTGTCAAGGATTACTCGACTGCACTTCAGACGACGTTGATCCTCGGCAAGAAATGCGGAATGACCAAAGGTGTGGGCCTAGGAGTCACATACGGTCTGTGCGTGGGAGCATGGGCTCTGCTGCTCTGGTACTCCGGTGTCTTGGTCCGTCACGGAACGACTAATGGTGGCAAGGCATTCACCACCATTCTCAACGTCATCGTGGGTGGAATGTAAGACTCTGACCTCTTTCCAACACTTCCTGCGGTATCGTCTGGCATGGCTCGTCATTCTCATTCGATCCTCTGCAAGTCCTGGTAATCGAGCAATGTCACTTGCTTTTCTGTGGCATGCAGAGCTCTGGGTCAAGCCGCCCCAAATTTGACCGCCTTCTCGAAAGGAAGGGCAGCAGCGTACAACATCCTGGAAATTCTCAAAAGGGGGCCGCCTCAAGACGAGCAGGCGGAAGACGAGGGCCTGACTCTGGAGAACGTCGAGGGCCGTATCGAGTTTCGGAATGTTTGCTTCAACTATCCATCTCGACCCACTATGCCTGTGTTTCAGAACTTCTGCTTGCAACTTCCAGCCGGGAAGACTGTGGCCCTTGTGGGCACCAGTGGCTGCGGCAAGAGCACCGTGGTCTCACTCCTCGAACGCTTCTATGATCCGAACTCAGGTGTGCTCTGCGGATGGTTCTCTCGTGATTTCTCCCTTCAACTTGAGAGAAGTGTGAGCTGCTAACTCGACTTCTGCTTACCCCCACCACACATCTCTGGTCTGATGCATTCACCGATGTTCCATTGGTTGCACTGACGAGTTCCACCACGGCATTCCACTTCGCCCGCGTCACATTCAAACATTTGTCCATAGAGCCAAGATATTCGACCTTCTGCCGAAGTTTGTGAGAGTGTTTACCTTCGGATATGATCTTTGAAACTGACAAATCAGTTCTGAAACTTCTGAAGCTTAAGAAGGACGAAGATAGATATGAATTTCTACATTACACACTCGAAAGATAATCCCTAGCGTCTAAATATAAAAATGCGAATTCAGAGTAGCATGAGTCGTCCACGAACTACTCCCGTACGAACCTTACGATGATAAATAAACCTGCGGCTTTTCAAGCTTCTGCGAACCTACTACTTGATCCACCTGCAGGGGAAGTTTTGCTCGATGGTCACAACCTCAAGACTTTGCGACTCAAATGGCTTAGAGCTCAAATAGGACTCGTGAATCAGGAGCCCGCGCTCTTCGCAACATCGATCAGAGAAAACCTGCTGTATGGTAAGAACGATGCAACCGCCGAAGAGATCGTCGAAGCTGCCAAAGCCTCGAATTCCCATTCCTTCATCAGTCAGCTGCCTTTCGGTTATGACACACAAGTAAGTTGCATCCATCCAGTCCGCAAGGAAGCCCTGTAGGCAGATGGTTGACAAACTGGCATGGACAAGCATGAGCACCTCATGTCTCATGTCGCTGGCAAGAGGCCGACTATGAAGTTCATGAAGCTCCATGCGGAGATAACCGATAAAGGCTTCCAAGTTTGAGAACAAGTCCAGTTTTGAGTCTCAGCTCTAACCTGAAATAAGATAATTGCCTCGACAACAAAGCTGAATCTGCACTCAAGAAGAAAATGCCGCCTCGAGCAGGTCGGAGAGAGAGGCATTCAGCTATCAGGAGGGGAGAAGCAACGCTTGGCTATCGCCCGAGCGATGCTGCGGAATCCCAAAATTTTGCTGCTGGATGAGGCCACGAGTGCGCTCGATCCGGATTCCGAGCAGGTCGTTCAAGAAGCACTGGACCGCCTCATTGTCGGTCGTTCCACTATCGTCATAGCACACCAGCTTTCCACCATCCGAAATGCGGATTCCATTTCGGTGATAAGACAAGGGAAAGTCATCGAGACAGGAACCCACAATGCACTCATGAGCAAAGGAGAACGAGGAGTGTACGCCTTGCTCGCCAGGTTGCAGGAGGCGGGGCACCAACGAGGCCATGCTGGGCAGACACAGGCGACACAGTCCACGTATGTTCACATAAGATTGCCAACCCTGACCTTGTTGTTGAGTTGCCCTATCAAGCGAATGCTGAGACTCTGGACTTTGCTGCAAGCACGATCACACAGAGTGCACTGATCAAAATCTTTCGATGCATGTGCAGTCAGAGAACTTCAAATTCTCGAGAAGTCCCGTCAGTGGAGAGGAGAACCTCTTTCAATGAGTCGGAAATCAACCTCGAAGTGCAAGAGAAGAAGCCAGCCGATGTGGGATGTTCCCAGCCAGCACTGTGGCGAATGCTACGTCTGAATAAACCCGAGTGGCACTATGGCGTCCTGGGAGCCATTGGAGCAGTTTTGGCTGGGTGTGAATTTCCTCTGGTTGCTCTCACGATCGGCCAACTCTTAGTGACCTTTTATGTTCCGGACAAAGTGTACATGGAACAGCAGGTGCACAGATACACGCTGTTCTTCACGGGCGCGATCGGTGTTGTGGTGATCGCCAACATTCTGCAGCACTATTTCTTCGCTGCCATGGGAGAATGCCTCACCAAGCGCATCAGAGAGATGATGTTTACAGGTGCGTGTTCTCCTCCTCGTCTACGAAGATTCGGAGAGCGAAAAGGTCATGACGACCGAACATGGCTGAATATGTCCTCATTTCCGCAATTCCTTTTTCCCGTGGAGAGAAAGTGAACTAACGCTGGGGGATGGTGCAGGAATACTACGCAATGAAATCGGATGGTTCGACAAAGATCAGAGCAACAGCTGCATGCTGGCCTCACGACTGTCCGTAGACGCAGCCTCGGTCCGGGCTGGCATCGGAGATCGCATCTGCACCGTGATGCAAAACATGTCGTTGGTCATCACAGCTTTCGTCATCGCCTTCATCCTCGAGTGGCGAGTGGCATCGGTCATGGTTGCCACATTTCCTCTACTCATAGTCGCCTTGGTCGGCGAGGTGAGCACTCCCCCAGCAGCCTGAAGCCTCACAACCTCTCTCTCTCTCATTGCATTCAGAAAGTAAGTAAGTAGGCTAGGCATTGCACGAAATTCAAGCACGGCCGCTGACAGTTTAACCGATTCAAGCACGAATTTCAAGCAATTCAAGCACGAAATTCAAGCATGACAGTCGAGTCCGGGTGTGGGGTGTGCAGAACTTCTTCCTGAAGGGATTCGGGGGAGATTTGCCCAAGGCGTACGCGAGAGCAGGGATGGTGGTGGGCGAGGCGGTGGGCAACATCCGCACGGTGGCGGCGTTCTGCGCCGAGGAGAAGGTGCTGGAGCTGTTCGAGAGGGAGCTGCAGGTGCCGAGGAAGAAGACCTTCGTCAAGGCGCAGGTGTCGGGGCTCGGCTACGGCATCTCGCAGTTCTTCATGTACAGCTCGTACGCGCTGGCGCTCTGGTACTCGTCCACGCTCGTGAAGAAGGGCGAGACGGCGTTCGGCAACGCCATCAAGATCATCATGGTGCTCATCTTCGCCGCCTTCGGCGTGGCCGAGACCATCGCCATGGCGCCAGACTTCGTCAAGGCCGGCCAGGCGCTGGGCTCCATCTTCCAGATCCTCGACCGCGAGACGGAGATCAACCCCGACGACCCCGAGTCCGAGATGGTGACCGAGGTGCTGGGCGAGATCGAGTTTCGCCATGTCGCCTTCAGCTACCCGATGCGCCCCGAGGTGTCGGTGTTCAAGGACTTCAACCTGCGCGTGCGCGCGGGCAAGAGCTTGGCGCTCGTGGGCGCCAGTGGCTCCGGCAAGAGCTCGGTGGTGGCGCTAATCCAGCGCTTCTACGACCCGTCCTGGGGCCGTGTGCTGATCGACGGCAAGGACATAAAAAAGCTCAACCTGCGAGCTCTGCGCCGGCACATCGGCTACGTGCAGCAGGAGCCGCCGCTCTTCGCCAGCAGCATCTACGACAACATCGTGTATGGCAAGGAGGAGGCGACCGAGGGCGAGGTCGTGCAGGCCTCGAAGACGGCCAATGCGCACAATTTCATCAGCGCTCTGCCCGAGGGCTACCGAACCGAGGTGGGCGACCGGGGCGTGCAGCTGAGCGGCGGCCAGAAGCAGCGAGTGGCCATCGCCCGAGCCGTGATCAAGAACCCCGAGATTCTGCTGCTGGACGAGGCCACCAGCGCTCTGGACGCGCAGTCCGAGCGCCTGATCCAAGAAGCTCTGGACCGCATCGTGTCCAACCGCACCACGGTCGTCATCGCGCACCGCCTCAGCACCATTCGGCACGCCGATGTGATCGCCGTGATGAAGGACGGGCAGATCATCGAGCAGGGCACTCACCGTGAGCTCCTGAACATGAGTTGCGTCTATGCCAATCTGATTCAGTTACAACAGCACCGCCACAGCCAACAGATTGTCGACATGTCCCTCGACACGTAGCGCGGCTGTCCTCTCCATCATCCTCCTTCTGCCATGAGACGTTTGTACTTGTACCTTCTGCCGACCCAGCCCTCACCTTCGCGTTCCTCCATTTCTCAGCTGCAACTCTCCAATGCTGGTCAATAAATTCTGAATCCAATTTTCACCTCCCAATCAACGCTCCGTCAATTCGCTTCCTCGTGCAAGTTACGTGAATGCCACAGACATCCGACCCTTATGATGAGCTCCCAACCGAAGCACACGAGAATCTGCGGCGTGTGCCAGGCCAAAGGACCACGTCTCCGTTCAGTTCAACCATGCTCAACATCGTCGCTGGTCTGTCACAGCCACTCACCCAAAAGCACACGTCTCGTGCTCGTGCCGAATTACAACTCGAGCGTGACGTTTGACCATGTCATGAGACGGACAAACGACGACTGCGAAATGTTCTCGTTCTCAGACGAGGCTCGACAGAAAAAATCAATGTTGGAAACAGCGAAATCACATCCAACTGAGGCTGAAACGAGCTGCAACTGATCTCAGTGTGAAAACGAAAGGACATACTCTGGACACATCTGGACCGATCTCTGCGGTGAACCTCACACAAAGACTGCTGCTTCTGAACAGCTCAGTGACAGACCTCCTCAGAGGGGAAAGAGAGAGAGAGCCATGGGTAAATGTATCTTCGAGATATGACAAATCCGGTTTGGAATGGAGCTAAGAAAAATTCGTGCACGACGGATATCGAGCTTGCTCATTACCGGAACCAGGGGTACGACTTTGAGATTGTACAAACTTCCTTCATCCAGAACACATTCTGAAAATTCATCGAGGAAATAGTTCCCCTCTGTTATTTTAGGTGGTGTTGTTTACTCGAATTTCAGGTCAGGCCATGCATCAGCAGTGAGAATCTTCGAAGTGAAGTCTACTTGAGCGCAATTCTTGTCAAACAATACTTCAAAGAGAACAGTAAACTTTGTTTGTTGGACGAATTTGTCCTCGCTCTGTGGTCTTTGCTGGTTGAATGCGACAAGCAGCCAAAATTCCAACCATTTAAGACA

mRNA

>Mapoly0182s0009.1
GAGAAGCAGCTGAACGAGGAGCCCGTTGCAACTATAAACTAACTGCTGCTGCGACTGCGGTCGGCGTCTCTCTCTCGGTTCTGCTCTTCTCTTCTCCCTTGTCTGCTAATCGAATTCTTGCTCGACCGGTCCCGATCCTTCCTTCCTTCAATGTCGGGGCCGTTCGGACCAGGCGAGTCAGGAGCACCGATCGAGCTTCCTTCCATTCTGCTGTTCTTGCCCGGCCTCGCGAATTTCTCTGACCAAATTTCGGCCTCGTGCTCGCTCGAACGATTTGCGCCAGTTCACCGATTTTCCGGACTCTGACAAGGGAAACGATGGACTCTGGACTCTGGACTCGGATCATCCGGAGCCTGACGAAATACTGAGGTGTAAACAAACGAACGCACGTGAGGGGATGGGTGGGTGAATGAGTCGAGGCAGAATCGTTCAGCAGGACACGATGCGCTTGGAGCCTCGCCTTTGATGGGAAGTCTCCAAAGATCGATCAATTGTGAGATTTCGCGAGCGCCTGCCCGATCGCTCGTGAGCAGTTCCCACCGAGTTAGAGATCGAGATGTTTGAGATCGTGGAACGACTTCTGAGCATGCTTCTCAGTTCGCTTCTCTGGCCCGTGTCTGTCAAGGACAGATGAAACTGCCGTGGGTTCCTCTGAGCGTCATGAAGGGCGTGGCAGGTCTCGCTGCCGCCGTCGAGTGCACCTCCAACCGCCCCTACAGAGCATGCGGAAGTCACCTGGACTGCTGCAGGATGCCCTTGCATTAACGAACTCTGCCCTCGCTTCCGAAATCCTCATCGCCCGTCTTCGTGCACGAGTGTCTGCGAGGCAAGATTCCAGAGCTGCAAAGTCCAGTGGCTCGGATTTGCAGACCAGCTGCAACTGAAATGGCTCGAACGGGAGAAGCGAGCATTGATCTCTACGAAGCTGATTTGGAGAATTGCTGGAAGATCGACGGCAGCGAACTGAGTCTGGACAAATCACCGAGTCTCAGAAAGGGAGTGGACGCACTGCCTGCATTGGCCATAACAGCCCATCATGAACTGGAAGATCCGACTGCGTCGCTTCCCACTTCTACCAGCGATCTGGACGAATGTTGTGGAGTTGGCGAGGCATTGACAGTGGCTGAATTCGAGTCCCTTGACCAACACGGGAAGCGAGACAGCGGGCTCGGGGCGTGCGAGCGCGACAAGGAAAGTGGGGCAGCTGCCGATGAGAAAATCCACCAGGTTTCCTTTTACAGGCTCTTCTCATTTGCCGATGGTGTGGACTACTTGCTCATGGGCTTCGGGACGCTCGGAGCTTGCACTCATGGAGTGGCTGTTCCTGTCTTCTTCATTTTCTTCGGCAGGCTCATCGACGCATTCGGAGCCAACTACAACAATCCCTTCCGAATGGGCCATGAGGTTTCCAAGTACTCTTTGTACCTGTTCTACTTGGGACTCGTCGTCATGGGCGCATCCTGGCTAGAGGTGTGGTGCTGGATGCAGACAGGCGAGAGACAATCAGCTCGGATGCGAAGCATGTACTTGAAAGCGGTTCTCAGTCAGAATATGACCTACTTTGACACAAGAGGAACGACGAATGAAATCGCCACTCGCATAGCAAATGACACTGCCCTCGTGCAGGATGCCATCAGTGAAAAGGCAGGGAACTTCCTGCACTTCACGGCGAAATTCATAGTGGCCTTCGCAGTGGGCTTCTGCTCAGTTTGGCAACTCTCACTGATCACTCTGGCAGTAGTGCCTGCCATTGTGATGTCCGGTGCTGCTTACACTGTGATAATGACTGGACATGCGACCAAGGGACAGAAGGCGTACGAAGAGGCTGGGAAGGTGGCAGAACAGGTGATAGCTCAAGTGCGGACAGTTTACTCCTTCGTTGGAGAGGCAAGGGCTGTCAAGGATTACTCGACTGCACTTCAGACGACGTTGATCCTCGGCAAGAAATGCGGAATGACCAAAGGTGTGGGCCTAGGAGTCACATACGGTCTGTGCGTGGGAGCATGGGCTCTGCTGCTCTGGTACTCCGGTGTCTTGGTCCGTCACGGAACGACTAATGGTGGCAAGGCATTCACCACCATTCTCAACGTCATCGTGGGTGGAATAGCTCTGGGTCAAGCCGCCCCAAATTTGACCGCCTTCTCGAAAGGAAGGGCAGCAGCGTACAACATCCTGGAAATTCTCAAAAGGGGGCCGCCTCAAGACGAGCAGGCGGAAGACGAGGGCCTGACTCTGGAGAACGTCGAGGGCCGTATCGAGTTTCGGAATGTTTGCTTCAACTATCCATCTCGACCCACTATGCCTGTGTTTCAGAACTTCTGCTTGCAACTTCCAGCCGGGAAGACTGTGGCCCTTGTGGGCACCAGTGGCTGCGGCAAGAGCACCGTGGTCTCACTCCTCGAACGCTTCTATGATCCGAACTCAGGGGAAGTTTTGCTCGATGGTCACAACCTCAAGACTTTGCGACTCAAATGGCTTAGAGCTCAAATAGGACTCGTGAATCAGGAGCCCGCGCTCTTCGCAACATCGATCAGAGAAAACCTGCTGTATGGTAAGAACGATGCAACCGCCGAAGAGATCGTCGAAGCTGCCAAAGCCTCGAATTCCCATTCCTTCATCAGTCAGCTGCCTTTCGGTTATGACACACAAGTCGGAGAGAGAGGCATTCAGCTATCAGGAGGGGAGAAGCAACGCTTGGCTATCGCCCGAGCGATGCTGCGGAATCCCAAAATTTTGCTGCTGGATGAGGCCACGAGTGCGCTCGATCCGGATTCCGAGCAGGTCGTTCAAGAAGCACTGGACCGCCTCATTGTCGGTCGTTCCACTATCGTCATAGCACACCAGCTTTCCACCATCCGAAATGCGGATTCCATTTCGGTGATAAGACAAGGGAAAGTCATCGAGACAGGAACCCACAATGCACTCATGAGCAAAGGAGAACGAGGAGTGTACGCCTTGCTCGCCAGGTTGCAGGAGGCGGGGCACCAACGAGGCCATGCTGGGCAGACACAGGCGACACAGTCCACTCAGAGAACTTCAAATTCTCGAGAAGTCCCGTCAGTGGAGAGGAGAACCTCTTTCAATGAGTCGGAAATCAACCTCGAAGTGCAAGAGAAGAAGCCAGCCGATGTGGGATGTTCCCAGCCAGCACTGTGGCGAATGCTACGTCTGAATAAACCCGAGTGGCACTATGGCGTCCTGGGAGCCATTGGAGCAGTTTTGGCTGGGTGTGAATTTCCTCTGGTTGCTCTCACGATCGGCCAACTCTTAGTGACCTTTTATGTTCCGGACAAAGTGTACATGGAACAGCAGGTGCACAGATACACGCTGTTCTTCACGGGCGCGATCGGTGTTGTGGTGATCGCCAACATTCTGCAGCACTATTTCTTCGCTGCCATGGGAGAATGCCTCACCAAGCGCATCAGAGAGATGATGTTTACAGGAATACTACGCAATGAAATCGGATGGTTCGACAAAGATCAGAGCAACAGCTGCATGCTGGCCTCACGACTGTCCGTAGACGCAGCCTCGGTCCGGGCTGGCATCGGAGATCGCATCTGCACCGTGATGCAAAACATGTCGTTGGTCATCACAGCTTTCGTCATCGCCTTCATCCTCGAGTGGCGAGTGGCATCGGTCATGGTTGCCACATTTCCTCTACTCATAGTCGCCTTGGTCGGCGAGAACTTCTTCCTGAAGGGATTCGGGGGAGATTTGCCCAAGGCGTACGCGAGAGCAGGGATGGTGGTGGGCGAGGCGGTGGGCAACATCCGCACGGTGGCGGCGTTCTGCGCCGAGGAGAAGGTGCTGGAGCTGTTCGAGAGGGAGCTGCAGGTGCCGAGGAAGAAGACCTTCGTCAAGGCGCAGGTGTCGGGGCTCGGCTACGGCATCTCGCAGTTCTTCATGTACAGCTCGTACGCGCTGGCGCTCTGGTACTCGTCCACGCTCGTGAAGAAGGGCGAGACGGCGTTCGGCAACGCCATCAAGATCATCATGGTGCTCATCTTCGCCGCCTTCGGCGTGGCCGAGACCATCGCCATGGCGCCAGACTTCGTCAAGGCCGGCCAGGCGCTGGGCTCCATCTTCCAGATCCTCGACCGCGAGACGGAGATCAACCCCGACGACCCCGAGTCCGAGATGGTGACCGAGGTGCTGGGCGAGATCGAGTTTCGCCATGTCGCCTTCAGCTACCCGATGCGCCCCGAGGTGTCGGTGTTCAAGGACTTCAACCTGCGCGTGCGCGCGGGCAAGAGCTTGGCGCTCGTGGGCGCCAGTGGCTCCGGCAAGAGCTCGGTGGTGGCGCTAATCCAGCGCTTCTACGACCCGTCCTGGGGCCGTGTGCTGATCGACGGCAAGGACATAAAAAAGCTCAACCTGCGAGCTCTGCGCCGGCACATCGGCTACGTGCAGCAGGAGCCGCCGCTCTTCGCCAGCAGCATCTACGACAACATCGTGTATGGCAAGGAGGAGGCGACCGAGGGCGAGGTCGTGCAGGCCTCGAAGACGGCCAATGCGCACAATTTCATCAGCGCTCTGCCCGAGGGCTACCGAACCGAGGTGGGCGACCGGGGCGTGCAGCTGAGCGGCGGCCAGAAGCAGCGAGTGGCCATCGCCCGAGCCGTGATCAAGAACCCCGAGATTCTGCTGCTGGACGAGGCCACCAGCGCTCTGGACGCGCAGTCCGAGCGCCTGATCCAAGAAGCTCTGGACCGCATCGTGTCCAACCGCACCACGGTCGTCATCGCGCACCGCCTCAGCACCATTCGGCACGCCGATGTGATCGCCGTGATGAAGGACGGGCAGATCATCGAGCAGGGCACTCACCGTGAGCTCCTGAACATGAGTTGCGTCTATGCCAATCTGATTCAGTTACAACAGCACCGCCACAGCCAACAGATTGTCGACATGTCCCTCGACACGTAGCGCGGCTGTCCTCTCCATCATCCTCCTTCTGCCATGAGACGTTTGTACTTGTACCTTCTGCCGACCCAGCCCTCACCTTCGCGTTCCTCCATTTCTCAGCTGCAACTCTCCAATGCTGGTCAATAAATTCTGAATCCAATTTTCACCTCCCAATCAACGCTCCGTCAATTCGCTTCCTCGTGCAAGTTACGTGAATGCCACAGACATCCGACCCTTATGATGAGCTCCCAACCGAAGCACACGAGAATCTGCGGCGTGTGCCAGGCCAAAGGACCACGTCTCCGTTCAGTTCAACCATGCTCAACATCGTCGCTGGTCTGTCACAGCCACTCACCCAAAAGCACACGTCTCGTGCTCGTGCCGAATTACAACTCGAGCGTGACGTTTGACCATGTCATGAGACGGACAAACGACGACTGCGAAATGTTCTCGTTCTCAGACGAGGCTCGACAGAAAAAATCAATGTTGGAAACAGCGAAATCACATCCAACTGAGGCTGAAACGAGCTGCAACTGATCTCAGTGTGAAAACGAAAGGACATACTCTGGACACATCTGGACCGATCTCTGCGGTGAACCTCACACAAAGACTGCTGCTTCTGAACAGCTCAGTGACAGACCTCCTCAGAGGGGAAAGAGAGAGAGAGCCATGGGTAAATGTATCTTCGAGATATGACAAATCCGGTTTGGAATGGAGCTAAGAAAAATTCGTGCACGACGGATATCGAGCTTGCTCATTACCGGAACCAGGGGTACGACTTTGAGATTGTACAAACTTCCTTCATCCAGAACACATTCTGAAAATTCATCGAGGAAATAGTTCCCCTCTGTTATTTTAGGTGGTGTTGTTTACTCGAATTTCAGGTCAGGCCATGCATCAGCAGTGAGAATCTTCGAAGTGAAGTCTACTTGAGCGCAATTCTTGTCAAACAATACTTCAAAGAGAACAGTAAACTTTGTTTGTTGGACGAATTTGTCCTCGCTCTGTGGTCTTTGCTGGTTGAATGCGACAAGCAGCCAAAATTCCAACCATTTAAGACA

CDS

>Mapoly0182s0009.1
ATGGCTCGAACGGGAGAAGCGAGCATTGATCTCTACGAAGCTGATTTGGAGAATTGCTGGAAGATCGACGGCAGCGAACTGAGTCTGGACAAATCACCGAGTCTCAGAAAGGGAGTGGACGCACTGCCTGCATTGGCCATAACAGCCCATCATGAACTGGAAGATCCGACTGCGTCGCTTCCCACTTCTACCAGCGATCTGGACGAATGTTGTGGAGTTGGCGAGGCATTGACAGTGGCTGAATTCGAGTCCCTTGACCAACACGGGAAGCGAGACAGCGGGCTCGGGGCGTGCGAGCGCGACAAGGAAAGTGGGGCAGCTGCCGATGAGAAAATCCACCAGGTTTCCTTTTACAGGCTCTTCTCATTTGCCGATGGTGTGGACTACTTGCTCATGGGCTTCGGGACGCTCGGAGCTTGCACTCATGGAGTGGCTGTTCCTGTCTTCTTCATTTTCTTCGGCAGGCTCATCGACGCATTCGGAGCCAACTACAACAATCCCTTCCGAATGGGCCATGAGGTTTCCAAGTACTCTTTGTACCTGTTCTACTTGGGACTCGTCGTCATGGGCGCATCCTGGCTAGAGGTGTGGTGCTGGATGCAGACAGGCGAGAGACAATCAGCTCGGATGCGAAGCATGTACTTGAAAGCGGTTCTCAGTCAGAATATGACCTACTTTGACACAAGAGGAACGACGAATGAAATCGCCACTCGCATAGCAAATGACACTGCCCTCGTGCAGGATGCCATCAGTGAAAAGGCAGGGAACTTCCTGCACTTCACGGCGAAATTCATAGTGGCCTTCGCAGTGGGCTTCTGCTCAGTTTGGCAACTCTCACTGATCACTCTGGCAGTAGTGCCTGCCATTGTGATGTCCGGTGCTGCTTACACTGTGATAATGACTGGACATGCGACCAAGGGACAGAAGGCGTACGAAGAGGCTGGGAAGGTGGCAGAACAGGTGATAGCTCAAGTGCGGACAGTTTACTCCTTCGTTGGAGAGGCAAGGGCTGTCAAGGATTACTCGACTGCACTTCAGACGACGTTGATCCTCGGCAAGAAATGCGGAATGACCAAAGGTGTGGGCCTAGGAGTCACATACGGTCTGTGCGTGGGAGCATGGGCTCTGCTGCTCTGGTACTCCGGTGTCTTGGTCCGTCACGGAACGACTAATGGTGGCAAGGCATTCACCACCATTCTCAACGTCATCGTGGGTGGAATAGCTCTGGGTCAAGCCGCCCCAAATTTGACCGCCTTCTCGAAAGGAAGGGCAGCAGCGTACAACATCCTGGAAATTCTCAAAAGGGGGCCGCCTCAAGACGAGCAGGCGGAAGACGAGGGCCTGACTCTGGAGAACGTCGAGGGCCGTATCGAGTTTCGGAATGTTTGCTTCAACTATCCATCTCGACCCACTATGCCTGTGTTTCAGAACTTCTGCTTGCAACTTCCAGCCGGGAAGACTGTGGCCCTTGTGGGCACCAGTGGCTGCGGCAAGAGCACCGTGGTCTCACTCCTCGAACGCTTCTATGATCCGAACTCAGGGGAAGTTTTGCTCGATGGTCACAACCTCAAGACTTTGCGACTCAAATGGCTTAGAGCTCAAATAGGACTCGTGAATCAGGAGCCCGCGCTCTTCGCAACATCGATCAGAGAAAACCTGCTGTATGGTAAGAACGATGCAACCGCCGAAGAGATCGTCGAAGCTGCCAAAGCCTCGAATTCCCATTCCTTCATCAGTCAGCTGCCTTTCGGTTATGACACACAAGTCGGAGAGAGAGGCATTCAGCTATCAGGAGGGGAGAAGCAACGCTTGGCTATCGCCCGAGCGATGCTGCGGAATCCCAAAATTTTGCTGCTGGATGAGGCCACGAGTGCGCTCGATCCGGATTCCGAGCAGGTCGTTCAAGAAGCACTGGACCGCCTCATTGTCGGTCGTTCCACTATCGTCATAGCACACCAGCTTTCCACCATCCGAAATGCGGATTCCATTTCGGTGATAAGACAAGGGAAAGTCATCGAGACAGGAACCCACAATGCACTCATGAGCAAAGGAGAACGAGGAGTGTACGCCTTGCTCGCCAGGTTGCAGGAGGCGGGGCACCAACGAGGCCATGCTGGGCAGACACAGGCGACACAGTCCACTCAGAGAACTTCAAATTCTCGAGAAGTCCCGTCAGTGGAGAGGAGAACCTCTTTCAATGAGTCGGAAATCAACCTCGAAGTGCAAGAGAAGAAGCCAGCCGATGTGGGATGTTCCCAGCCAGCACTGTGGCGAATGCTACGTCTGAATAAACCCGAGTGGCACTATGGCGTCCTGGGAGCCATTGGAGCAGTTTTGGCTGGGTGTGAATTTCCTCTGGTTGCTCTCACGATCGGCCAACTCTTAGTGACCTTTTATGTTCCGGACAAAGTGTACATGGAACAGCAGGTGCACAGATACACGCTGTTCTTCACGGGCGCGATCGGTGTTGTGGTGATCGCCAACATTCTGCAGCACTATTTCTTCGCTGCCATGGGAGAATGCCTCACCAAGCGCATCAGAGAGATGATGTTTACAGGAATACTACGCAATGAAATCGGATGGTTCGACAAAGATCAGAGCAACAGCTGCATGCTGGCCTCACGACTGTCCGTAGACGCAGCCTCGGTCCGGGCTGGCATCGGAGATCGCATCTGCACCGTGATGCAAAACATGTCGTTGGTCATCACAGCTTTCGTCATCGCCTTCATCCTCGAGTGGCGAGTGGCATCGGTCATGGTTGCCACATTTCCTCTACTCATAGTCGCCTTGGTCGGCGAGAACTTCTTCCTGAAGGGATTCGGGGGAGATTTGCCCAAGGCGTACGCGAGAGCAGGGATGGTGGTGGGCGAGGCGGTGGGCAACATCCGCACGGTGGCGGCGTTCTGCGCCGAGGAGAAGGTGCTGGAGCTGTTCGAGAGGGAGCTGCAGGTGCCGAGGAAGAAGACCTTCGTCAAGGCGCAGGTGTCGGGGCTCGGCTACGGCATCTCGCAGTTCTTCATGTACAGCTCGTACGCGCTGGCGCTCTGGTACTCGTCCACGCTCGTGAAGAAGGGCGAGACGGCGTTCGGCAACGCCATCAAGATCATCATGGTGCTCATCTTCGCCGCCTTCGGCGTGGCCGAGACCATCGCCATGGCGCCAGACTTCGTCAAGGCCGGCCAGGCGCTGGGCTCCATCTTCCAGATCCTCGACCGCGAGACGGAGATCAACCCCGACGACCCCGAGTCCGAGATGGTGACCGAGGTGCTGGGCGAGATCGAGTTTCGCCATGTCGCCTTCAGCTACCCGATGCGCCCCGAGGTGTCGGTGTTCAAGGACTTCAACCTGCGCGTGCGCGCGGGCAAGAGCTTGGCGCTCGTGGGCGCCAGTGGCTCCGGCAAGAGCTCGGTGGTGGCGCTAATCCAGCGCTTCTACGACCCGTCCTGGGGCCGTGTGCTGATCGACGGCAAGGACATAAAAAAGCTCAACCTGCGAGCTCTGCGCCGGCACATCGGCTACGTGCAGCAGGAGCCGCCGCTCTTCGCCAGCAGCATCTACGACAACATCGTGTATGGCAAGGAGGAGGCGACCGAGGGCGAGGTCGTGCAGGCCTCGAAGACGGCCAATGCGCACAATTTCATCAGCGCTCTGCCCGAGGGCTACCGAACCGAGGTGGGCGACCGGGGCGTGCAGCTGAGCGGCGGCCAGAAGCAGCGAGTGGCCATCGCCCGAGCCGTGATCAAGAACCCCGAGATTCTGCTGCTGGACGAGGCCACCAGCGCTCTGGACGCGCAGTCCGAGCGCCTGATCCAAGAAGCTCTGGACCGCATCGTGTCCAACCGCACCACGGTCGTCATCGCGCACCGCCTCAGCACCATTCGGCACGCCGATGTGATCGCCGTGATGAAGGACGGGCAGATCATCGAGCAGGGCACTCACCGTGAGCTCCTGAACATGAGTTGCGTCTATGCCAATCTGATTCAGTTACAACAGCACCGCCACAGCCAACAGATTGTCGACATGTCCCTCGACACGTAG

Protein

>Mapoly0182s0009.1
MARTGEASIDLYEADLENCWKIDGSELSLDKSPSLRKGVDALPALAITAHHELEDPTASLPTSTSDLDECCGVGEALTVAEFESLDQHGKRDSGLGACERDKESGAAADEKIHQVSFYRLFSFADGVDYLLMGFGTLGACTHGVAVPVFFIFFGRLIDAFGANYNNPFRMGHEVSKYSLYLFYLGLVVMGASWLEVWCWMQTGERQSARMRSMYLKAVLSQNMTYFDTRGTTNEIATRIANDTALVQDAISEKAGNFLHFTAKFIVAFAVGFCSVWQLSLITLAVVPAIVMSGAAYTVIMTGHATKGQKAYEEAGKVAEQVIAQVRTVYSFVGEARAVKDYSTALQTTLILGKKCGMTKGVGLGVTYGLCVGAWALLLWYSGVLVRHGTTNGGKAFTTILNVIVGGIALGQAAPNLTAFSKGRAAAYNILEILKRGPPQDEQAEDEGLTLENVEGRIEFRNVCFNYPSRPTMPVFQNFCLQLPAGKTVALVGTSGCGKSTVVSLLERFYDPNSGEVLLDGHNLKTLRLKWLRAQIGLVNQEPALFATSIRENLLYGKNDATAEEIVEAAKASNSHSFISQLPFGYDTQVGERGIQLSGGEKQRLAIARAMLRNPKILLLDEATSALDPDSEQVVQEALDRLIVGRSTIVIAHQLSTIRNADSISVIRQGKVIETGTHNALMSKGERGVYALLARLQEAGHQRGHAGQTQATQSTQRTSNSREVPSVERRTSFNESEINLEVQEKKPADVGCSQPALWRMLRLNKPEWHYGVLGAIGAVLAGCEFPLVALTIGQLLVTFYVPDKVYMEQQVHRYTLFFTGAIGVVVIANILQHYFFAAMGECLTKRIREMMFTGILRNEIGWFDKDQSNSCMLASRLSVDAASVRAGIGDRICTVMQNMSLVITAFVIAFILEWRVASVMVATFPLLIVALVGENFFLKGFGGDLPKAYARAGMVVGEAVGNIRTVAAFCAEEKVLELFERELQVPRKKTFVKAQVSGLGYGISQFFMYSSYALALWYSSTLVKKGETAFGNAIKIIMVLIFAAFGVAETIAMAPDFVKAGQALGSIFQILDRETEINPDDPESEMVTEVLGEIEFRHVAFSYPMRPEVSVFKDFNLRVRAGKSLALVGASGSGKSSVVALIQRFYDPSWGRVLIDGKDIKKLNLRALRRHIGYVQQEPPLFASSIYDNIVYGKEEATEGEVVQASKTANAHNFISALPEGYRTEVGDRGVQLSGGQKQRVAIARAVIKNPEILLLDEATSALDAQSERLIQEALDRIVSNRTTVVIAHRLSTIRHADVIAVMKDGQIIEQGTHRELLNMSCVYANLIQLQQHRHSQQIVDMSLDT

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>