Mapoly0213s0014



Description

HOMEOBOX PROTEIN TRANSCRIPTION FACTORS

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0006355 Regulation of transcription, DNA-dependent
OrthoMCL OG5_188795
PFAM PF05920 Homeobox KN domain
PANTHER PTHR11850 HOMEOBOX PROTEIN TRANSCRIPTION FACTORS
PANTHER PTHR11850:SF82

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBELL1 Homeodomain protein Public
MpHD22 transcription factor, HD Mapoly0213s0014.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0213s0014.1 scaffold_213:113788..120182  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0213s0014.1  

Gene structure:

mRNA scaffold_213:113788..120182  ( - strand )
three_prime_UTR scaffold_213:113788..113934  ( - strand )
CDS scaffold_213:113935..115044  ( - strand )
CDS scaffold_213:115241..115537  ( - strand )
CDS scaffold_213:115886..115946  ( - strand )
CDS scaffold_213:116130..116674  ( - strand )
CDS scaffold_213:116857..117907  ( - strand )
CDS scaffold_213:118093..119729  ( - strand )
five_prime_UTR scaffold_213:119730..120182  ( - strand )

Sequences:

Gene

>Mapoly0213s0014.1
GTATATGTATACAGAGGGTGATGTTGATACTTTTTTACTAGTCGAGCCACAGGCTGTGCATACATACAGGTATATGGTCCATCTGCCGAGCCAATATATGCACTTCATCACAACTCAACTACCGTGTCTCCACATAAATGGTCTTTTCCCTCCTCTTATATCGAAGACGAATTTATTGGTTCTAAAAAGTGAAGGGATCGTCAGCTTTTCATCTTTTCGCAGGACCAATCCAAGCGAATCGTTGAAAGTCAGTTCCTGGATAGTGATGTTCTGGCCTCTAGAGCACTGAACAGGAGATAGCTAAGTTTTGGTTTAATTCAGAGAACTTTCTGGGAGTTCGCACGACCTATGTGATGATGCCAATCATTTTTTTCCTGCACAGATACGCAACACGTGAAGCGGAGGCACAATCTCCAGGCTGTTGAAGCTGATGCTGGGAAAAAGATCAAAAGCATGAAATCAGAAGGTGATCCTGATGCACTTTCGGAGCGGACCTCTCGTTTTCTTCTCACCGGAATTTTAGGTGAAAAAGTGGTACCTCTCACAAAGCTCCTCGAGGACATCACTGCAGAATCGAATGAAGAGACAGCGTACAGTCACCTCCTCCGAAAAGGAAAAGCAACGCCTGCTTGCCTGAATCAGATCCGGAGCTCAGCAAATCGACCCATGTGTCCGGCTGAGCGTAGGGGTAGCTTGGTTCAGAAAGAAGGCCATTGTCTTGACTCTCAGACTCATTGTCTTGACTCTCAGACTGAAAGTGGTTTTCCAGCTAAGCACCAACCGGCGAAAAGCGCAGGTCGTGGGGGCGGACTTCCTACACATGATTCTGATCACGGGAAGAGATTTCATGCTCGAGGAGACCCAGAACAGCATATACATCAGTCTCAGGAGGTCAGGCCCTCAATAACGAGTCGGAGTGACGCAAGGGAATTCCAGACGGAGCGCAAAGTTGCAACTGAGGATCAGGGGCGACATGGGGAGCATCAAACTCAGCGACAGCCACTACGTCGAGATTTGAATGTTCAGAATGAGGGAATTTCAGTAACTCCGGCAGCGCATCAGCAAGCGGGACGTGAAGCTTTCCAGGGCGGATGTTCGACCTCAACCCAACACAATGAAGAGATACACCGAAAGTGCCAGAAGCAAGCTTCAGCAGACCAAGATCGTGGCCAGCATATCAATGCAGAATTTCTAGCAGTATTGATGGCTGCACACTATCAAGAGGCCTACTTGAAAGCTTCCCTAGCTGCAAAGTATCTGCAGGAATACCAAAATGCGAAACAATCTCAACATCTTCCTGCAGGTTCTCAAAAAGCTCACGTAGCTGAGCGTTTTTCCGAGGCTTATCAAGTTGCACTTGAACTTTCGCAGCTTCCTGTGAATCCCGAAAGTCAGAAGTCTCTGATGGAAGAATTTTACACCAACCTCAGTGCAGCTCCTGAGGCAGCGAGTGGAGGGAAATTTTCAGCCTCTCCCCCGACTCCCTACCTCCATCCTTTTTATGAAGGATCGGCGACCCCCCAGGGAGGAAGTTTCCCTGCACAATGTGAACCATCACATGGCCCACTCGTCCCATCTTCGCCACTGCCAAGTCCCCCGACTGGACCTGAACAAGATCGTTCAGACTCAACTGGTGGGCAATCACAACTGCCGCATGGACTCGGGCAGACTTTTCTCCACTTCTCGCAGCTTCCAAGTACGGCCGAGCATGCCAAGACAGTGACTGAGGAGGGGTCGGACCGAGTCATTGATGAACGAGATCAGAAACCTGCAGAAAGATCAGAGGTCTTTCCACATCACCCTCACATGTCCTTTGCGTGCCAAGGCAAGGTGATGACTCGGGGAGCGAAGGTTGAATCTGAAGCTCCATTTGTAGCCATCTTCCCCTTGTACAAACCTCCACCTCAGCCTCAGCCCAAGCCCGAGCCCCATTATGGAGGCAACGTCGGTAAACAGGTGGTCCAGGAGACGGGTGATCATGCTAGAGTAATGACCTCGCAAGGACCCCATTGGCTTTACAGCTCCGGACCCTCCATCGCTCAATGTCAGTCTCGACCTCCAAATGAGACCAAGGACGCTCGCATCCAAAGGTATGGAACTGATGCCACCTATACTTGAGCTCTCTGGTGTCCGATCTCTTTCTCAATAGGCTGAATATCCGATCCAACCGTGCATGGGACCGAACTGATTGAGCTGCCTGCCACTCAGTTCGTGGAACCATGACAGCAATCCTCAGTATTAGAAAAACTGATAATGGCTTTGGTTTGGGTAACAGGGAACAGGAAGCGCCACCTGGTACGCAAGGAGTGGGCTCGGAGCGGGAGACGTACTGTGATGGATCGGATGGAAAGAGATCTACGGGCTTCAAGCGGTGGAGCGCCCCACAGAACGGCGATGGAAGGGCACAGAATCCAATTCAGTTCGCAGTTGCTAATCAAGCGCCTCAGGGTGACGGCCCTCCACACCAGAGGGCTCCTCCTCATCCCCTCACTTTCGTGGATTTAGGAGATGCAAGCGAAGACGGCGAAAGCGTGCAGACGCCTTTGCCAGAAGATAAGGAATCTGATAGCGAACCTGAATCGGAGCGATTTGCGGGACAACCTAGAGATGAGGACACTGAAGTTGGCGCCAGGGTTGAGAGAAACGTGGAGGAATCGAAATCTGGAGCTGAAACTTTGCAAGAGTCAGGAGACGACGACGCGGGGGAACTCGAAGATGAGGAAAGGGAAAGGGAAGGGGAAGGGGAAGGGGAAGTCAAAAGTGAACGCAGATTCTACTTTTTTGATTTTACCAAAATCTGTGATAATCTGTACCCGCCGGATGTTACCACCAAAATGCTCAAAGACTTTGGGCTCAGATATTATCCAATGCGGTTTCGGGAGGATGAGAAGATCAGAGAGATAGAAGCGTTGTTTCGCGAGGTTTTATCTTTTTCGAGGCCGAAAAACGTCCCCGAGATTCCCATTGTTCCTTTTGATTTTCTAAGATCGCAGCGCTATTTTACTGAAATGGCGCAGCGTCCTGCGGCACGAAAATCTGCATCTGCAAGATCATCACAATCAACAGCAGCAGGCACTTCACATCCTGCTGCCCAGCTTTGGGCTGCCCTTATAGCCCAAAGGGCACGAGCCTTCAGAAGAGAGTGTTCGATACGCATCGAAAATCAAGGTATAGATTTGGCAGATTCGTTCACCGCGGATCAGCTTGACTACAAACCCGTCCACAGAGGCAGGAGCAGGGATGTCATGGCATGGTTGCGGAAGCCCAGAAGTCGTGGAGTTACATTGCATGACAGAAAAAAGATGTTTCGGGCTTACATTGATGAGGTAATGATCATGATTCTCGAAGTTGTTCGTACCATTTATGGAGATCTACTCACACAAAATGCGTACAAGTTCATTTACATCATTACTTTTCATGTACATCCTTTTCCATTTGTGAGACAATGTATCCCACTCGCAAGTATCAGCATTCTCACCGTGGTAAAAATCCGTGACTTCATATTCAGATCGATGACTGGTATTATGAATACCGCTCGACCTTGGAGAATATAAATGACGAGACGGATGATTCTTTTGGTCATTTTATCGGCAACATTTATACAGAATATCCACTCATGGAGTTATCGAGGCGTTTGCGAAGATACAGAGATACCTTCTTAGAGCATCTGGTCTGTGTGAAGAAGGTCCTTGGAGACTCAACAGCAGTTCCTGATTTCGACAAAAATATCAGAGACCGACTCATAGCCTGTCGCGTGAGGGCTGCAAAGAGGATGGCCAGAAAAGCCTTGATGGTGATCAGGAGGGCCCATGCACCTTATAAGAAGCGTATGATCAATGGATGTCATAAGATGATCGTAAAGCTCGAACCGAAGCAAGAAAACAGGATAGCAGAAGCTGTAAGGATTGCGGGCACAAACAATGGACCCAGGCGTCAGCAGCGCATGTACAGTGGGCGTCTAAATCTGAATTCCACTTGGAGACCGCAAAGAGGCCTCCCAGACAGAGCCGTCAGTGTTCTAAAGGCGTGGCTCTTCACTAACTTTTTACACCCGTAAGATCTTCGACCTTCATCTTCGCTCACAAGTTTGGTCAATCTTAGAAAGAAATCGCTCCACAGGTAGAGCTGAAGAAACTTCTGCAGATCAAAGAGATGCGTAGCACATGCATCCATAGATCACTAAGGTCTATCAGATGGATCCAAGTAATAGGCAACTGATGATGTTCAATGTACCAGATATCCTAAAGATGTGGATAAAGAATCGTTGGCCTCAGCGACGGGTTTGACGAGATCACAGGTGAGCAGACTAAGCTCTCGTTTGTTGGTACAATGTCAAGCTTGCAAACATCATTTCCTCATCTAGAAGTTTATCCCAAAGAGACACTATTTTGAACATAAGAACTTGATTTCTTGATGAACGACAGCCAGTTATGTTTAGCTTTTTCGCCTTCTTTTGTTGGATGAGAAAACTTCTGTACTTTTCAAAGAGTGTGATCTCAGTCGCATCCCATTTCCTCATCATTGTTTGAAATTTTCGATGATCTTCGTCACACATAGGGTGACTTTGAAAATACTTAATTTTTCCTGCACCTGATTCCTCACTTTGGTGCATGATAACGTAGAATACCTCCTTTCCAACGTGCAGGTTTCCAACTGGTTCATAAATGCTCGAGTACGAGTCTGGAAACCGATGATTGAAGCAATGTATCTCATGGACTTTCCAGAAGATCGACACAGATTCATTACAATGTCCAGGGCCAGGAAAGTTGATCATGGGCAGGAATTGGGAGATCGGAAACCGGGAACAAGCCGCTCTAGGTTTTTCCCATGCGTTGACGGTAGGACCAGGCGATCGAGGAAACGTCAATGTATATATCGTCCAGCTTCTCACAGTCTTGCTTTGGGTTCAAGAGTTCTTCCTTCATTTCTTCGGCATGCACAGGTATCTCCCATTATTCAAATACTACCAGATAATGCTTTATAGGTTTTTTCACCCAGTTTCCTTTTGAGAATGTTTCAAGGAGTTGTTTCCCCATATTTCTCAGTTCCAATTTCAGTCCTAACAAATGCAATGGATGATAACAATCTTTAGTTTTATTCATACACAGGCTTACCATTTTTCTCATTTTCCAATCCAGGCGAGTTCCCGGATGCGCCATCAAGCATCCCGTGCTTTTGCTCCTTACAGCAGGGAGATGTTGGCTCAGTTTCTTAGAAATGCTTCAGTCTGGAGGGCACAATTGGGAGAGAGCCGGCAGAATAGAGCGGAAGTCGAACACAGGTTCGCTATCCAGGGTCGAGCTGAAGTGGGAAACAGGTTCACCATTCAAAATCGAACTCAAGTCGAGCCCAAGTTCACCATTCAGAATCGAGCTCAAGTCGAGCCCAGGCTCACCGTCCAGGATCGAGCTCAAGTCGAATCCAGGTTCCCAATTCAGAATCGAGCACAAGTCGAACCCAGGCTCATCGTCCAGGATCGAGCTCAAGTCGAACCCAGGTTCCCCACTCAGAATCGAGCGCAAGTCGAACCCAGGGTCACCGTCCAGGATCGAACTCAAGTCGAACACAGTTTCATTATTCAGAATCAAGGTCAAGTCGAGCCCAGGCTCACCGTACAGGATCGAGATCAAGTCGAAACCAGGTTCCCCATTCAGAATCGAGCGCAAGTCGAACCCAGTGTCACCGTCCAGGATCGAGCTCAAGTCGAACACAGTTTCATTAGTCAAAATCGAGCTCCAGTCGAACCCAGGTTCACCATTCAGGATCGAGCTCAAGCAGAACCCAAGTTCACCTTCCCGAGTCAAGCGAAAGTCGAACCCAGGCTCACGATCCAAGATCGAGCTCAATTGGAACCCAGGTTCACTATCCAGGATCGAGCTCAAGTTGGAACGAGGTTCACCATCCAGGATCGAGCTCCAGTCGAAACCAGGTTCTCCATCCAGGATAGAGCTAAAGTCGATACTACGCTCACCATCAAGGATCTTCGAGCTGAACTCGAACCTAGGCTCACCAGCGAGAAAATCGACTACGACAATCACATCTCTCTGGAACTGCAGCTTGGTTCTGAAAGGACAAAAGCTCGACCAGAAAGCACGGGACCTCGCCTTAGATTTCAAGATGGACGTTTGTTAAGCGAGCGGATGCGAATTGGACATCACACGGAACCTCCAAAGGGAGAGATCCCGATGGACATCTTGAAATTCGAAGACCTAGAGAGGATTAGAAAAGGAAAGGGCATTGTGGAGTGACAAATCTTTGTATATGTAATTACTAAAAAGAATTGAAAACATAGAGTTCTATATTAGAAGATTTCTGTAAGAGATTCACTAGCAGAATTTTTCCTGTCTTATCTACGTTAGCTATTTATATCAAAATTTAGTGTGCATCTAACTTGT

mRNA

>Mapoly0213s0014.1
GTATATGTATACAGAGGGTGATGTTGATACTTTTTTACTAGTCGAGCCACAGGCTGTGCATACATACAGGTATATGGTCCATCTGCCGAGCCAATATATGCACTTCATCACAACTCAACTACCGTGTCTCCACATAAATGGTCTTTTCCCTCCTCTTATATCGAAGACGAATTTATTGGTTCTAAAAAGTGAAGGGATCGTCAGCTTTTCATCTTTTCGCAGGACCAATCCAAGCGAATCGTTGAAAGTCAGTTCCTGGATAGTGATGTTCTGGCCTCTAGAGCACTGAACAGGAGATAGCTAAGTTTTGGTTTAATTCAGAGAACTTTCTGGGAGTTCGCACGACCTATGTGATGATGCCAATCATTTTTTTCCTGCACAGATACGCAACACGTGAAGCGGAGGCACAATCTCCAGGCTGTTGAAGCTGATGCTGGGAAAAAGATCAAAAGCATGAAATCAGAAGGTGATCCTGATGCACTTTCGGAGCGGACCTCTCGTTTTCTTCTCACCGGAATTTTAGGTGAAAAAGTGGTACCTCTCACAAAGCTCCTCGAGGACATCACTGCAGAATCGAATGAAGAGACAGCGTACAGTCACCTCCTCCGAAAAGGAAAAGCAACGCCTGCTTGCCTGAATCAGATCCGGAGCTCAGCAAATCGACCCATGTGTCCGGCTGAGCGTAGGGGTAGCTTGGTTCAGAAAGAAGGCCATTGTCTTGACTCTCAGACTCATTGTCTTGACTCTCAGACTGAAAGTGGTTTTCCAGCTAAGCACCAACCGGCGAAAAGCGCAGGTCGTGGGGGCGGACTTCCTACACATGATTCTGATCACGGGAAGAGATTTCATGCTCGAGGAGACCCAGAACAGCATATACATCAGTCTCAGGAGGTCAGGCCCTCAATAACGAGTCGGAGTGACGCAAGGGAATTCCAGACGGAGCGCAAAGTTGCAACTGAGGATCAGGGGCGACATGGGGAGCATCAAACTCAGCGACAGCCACTACGTCGAGATTTGAATGTTCAGAATGAGGGAATTTCAGTAACTCCGGCAGCGCATCAGCAAGCGGGACGTGAAGCTTTCCAGGGCGGATGTTCGACCTCAACCCAACACAATGAAGAGATACACCGAAAGTGCCAGAAGCAAGCTTCAGCAGACCAAGATCGTGGCCAGCATATCAATGCAGAATTTCTAGCAGTATTGATGGCTGCACACTATCAAGAGGCCTACTTGAAAGCTTCCCTAGCTGCAAAGTATCTGCAGGAATACCAAAATGCGAAACAATCTCAACATCTTCCTGCAGGTTCTCAAAAAGCTCACGTAGCTGAGCGTTTTTCCGAGGCTTATCAAGTTGCACTTGAACTTTCGCAGCTTCCTGTGAATCCCGAAAGTCAGAAGTCTCTGATGGAAGAATTTTACACCAACCTCAGTGCAGCTCCTGAGGCAGCGAGTGGAGGGAAATTTTCAGCCTCTCCCCCGACTCCCTACCTCCATCCTTTTTATGAAGGATCGGCGACCCCCCAGGGAGGAAGTTTCCCTGCACAATGTGAACCATCACATGGCCCACTCGTCCCATCTTCGCCACTGCCAAGTCCCCCGACTGGACCTGAACAAGATCGTTCAGACTCAACTGGTGGGCAATCACAACTGCCGCATGGACTCGGGCAGACTTTTCTCCACTTCTCGCAGCTTCCAAGTACGGCCGAGCATGCCAAGACAGTGACTGAGGAGGGGTCGGACCGAGTCATTGATGAACGAGATCAGAAACCTGCAGAAAGATCAGAGGTCTTTCCACATCACCCTCACATGTCCTTTGCGTGCCAAGGCAAGGTGATGACTCGGGGAGCGAAGGTTGAATCTGAAGCTCCATTTGTAGCCATCTTCCCCTTGTACAAACCTCCACCTCAGCCTCAGCCCAAGCCCGAGCCCCATTATGGAGGCAACGTCGGTAAACAGGTGGTCCAGGAGACGGGTGATCATGCTAGAGTAATGACCTCGCAAGGACCCCATTGGCTTTACAGCTCCGGACCCTCCATCGCTCAATGTCAGTCTCGACCTCCAAATGAGACCAAGGACGCTCGCATCCAAAGGGAACAGGAAGCGCCACCTGGTACGCAAGGAGTGGGCTCGGAGCGGGAGACGTACTGTGATGGATCGGATGGAAAGAGATCTACGGGCTTCAAGCGGTGGAGCGCCCCACAGAACGGCGATGGAAGGGCACAGAATCCAATTCAGTTCGCAGTTGCTAATCAAGCGCCTCAGGGTGACGGCCCTCCACACCAGAGGGCTCCTCCTCATCCCCTCACTTTCGTGGATTTAGGAGATGCAAGCGAAGACGGCGAAAGCGTGCAGACGCCTTTGCCAGAAGATAAGGAATCTGATAGCGAACCTGAATCGGAGCGATTTGCGGGACAACCTAGAGATGAGGACACTGAAGTTGGCGCCAGGGTTGAGAGAAACGTGGAGGAATCGAAATCTGGAGCTGAAACTTTGCAAGAGTCAGGAGACGACGACGCGGGGGAACTCGAAGATGAGGAAAGGGAAAGGGAAGGGGAAGGGGAAGGGGAAGTCAAAAGTGAACGCAGATTCTACTTTTTTGATTTTACCAAAATCTGTGATAATCTGTACCCGCCGGATGTTACCACCAAAATGCTCAAAGACTTTGGGCTCAGATATTATCCAATGCGGTTTCGGGAGGATGAGAAGATCAGAGAGATAGAAGCGTTGTTTCGCGAGGTTTTATCTTTTTCGAGGCCGAAAAACGTCCCCGAGATTCCCATTGTTCCTTTTGATTTTCTAAGATCGCAGCGCTATTTTACTGAAATGGCGCAGCGTCCTGCGGCACGAAAATCTGCATCTGCAAGATCATCACAATCAACAGCAGCAGGCACTTCACATCCTGCTGCCCAGCTTTGGGCTGCCCTTATAGCCCAAAGGGCACGAGCCTTCAGAAGAGAGTGTTCGATACGCATCGAAAATCAAGGTATAGATTTGGCAGATTCGTTCACCGCGGATCAGCTTGACTACAAACCCGTCCACAGAGGCAGGAGCAGGGATGTCATGGCATGGTTGCGGAAGCCCAGAAGTCGTGGAGTTACATTGCATGACAGAAAAAAGATGTTTCGGGCTTACATTGATGAGATCGATGACTGGTATTATGAATACCGCTCGACCTTGGAGAATATAAATGACGAGACGGATGATTCTTTTGGTCATTTTATCGGCAACATTTATACAGAATATCCACTCATGGAGTTATCGAGGCGTTTGCGAAGATACAGAGATACCTTCTTAGAGCATCTGGTCTGTGTGAAGAAGGTCCTTGGAGACTCAACAGCAGTTCCTGATTTCGACAAAAATATCAGAGACCGACTCATAGCCTGTCGCGTGAGGGCTGCAAAGAGGATGGCCAGAAAAGCCTTGATGGTGATCAGGAGGGCCCATGCACCTTATAAGAAGCGTATGATCAATGGATGTCATAAGATGATCGTAAAGCTCGAACCGAAGCAAGAAAACAGGATAGCAGAAGCTGTAAGGATTGCGGGCACAAACAATGGACCCAGGCGTCAGCAGCGCATGTACAGTGGGCGTCTAAATCTGAATTCCACTTGGAGACCGCAAAGAGGCCTCCCAGACAGAGCCGTCAGTGTTCTAAAGGCGTGGCTCTTCACTAACTTTTTACACCCATATCCTAAAGATGTGGATAAAGAATCGTTGGCCTCAGCGACGGGTTTGACGAGATCACAGGTTTCCAACTGGTTCATAAATGCTCGAGTACGAGTCTGGAAACCGATGATTGAAGCAATGTATCTCATGGACTTTCCAGAAGATCGACACAGATTCATTACAATGTCCAGGGCCAGGAAAGTTGATCATGGGCAGGAATTGGGAGATCGGAAACCGGGAACAAGCCGCTCTAGGTTTTTCCCATGCGTTGACGGTAGGACCAGGCGATCGAGGAAACGTCAATGTATATATCGTCCAGCTTCTCACAGTCTTGCTTTGGGTTCAAGAGTTCTTCCTTCATTTCTTCGGCATGCACAGGCGAGTTCCCGGATGCGCCATCAAGCATCCCGTGCTTTTGCTCCTTACAGCAGGGAGATGTTGGCTCAGTTTCTTAGAAATGCTTCAGTCTGGAGGGCACAATTGGGAGAGAGCCGGCAGAATAGAGCGGAAGTCGAACACAGGTTCGCTATCCAGGGTCGAGCTGAAGTGGGAAACAGGTTCACCATTCAAAATCGAACTCAAGTCGAGCCCAAGTTCACCATTCAGAATCGAGCTCAAGTCGAGCCCAGGCTCACCGTCCAGGATCGAGCTCAAGTCGAATCCAGGTTCCCAATTCAGAATCGAGCACAAGTCGAACCCAGGCTCATCGTCCAGGATCGAGCTCAAGTCGAACCCAGGTTCCCCACTCAGAATCGAGCGCAAGTCGAACCCAGGGTCACCGTCCAGGATCGAACTCAAGTCGAACACAGTTTCATTATTCAGAATCAAGGTCAAGTCGAGCCCAGGCTCACCGTACAGGATCGAGATCAAGTCGAAACCAGGTTCCCCATTCAGAATCGAGCGCAAGTCGAACCCAGTGTCACCGTCCAGGATCGAGCTCAAGTCGAACACAGTTTCATTAGTCAAAATCGAGCTCCAGTCGAACCCAGGTTCACCATTCAGGATCGAGCTCAAGCAGAACCCAAGTTCACCTTCCCGAGTCAAGCGAAAGTCGAACCCAGGCTCACGATCCAAGATCGAGCTCAATTGGAACCCAGGTTCACTATCCAGGATCGAGCTCAAGTTGGAACGAGGTTCACCATCCAGGATCGAGCTCCAGTCGAAACCAGGTTCTCCATCCAGGATAGAGCTAAAGTCGATACTACGCTCACCATCAAGGATCTTCGAGCTGAACTCGAACCTAGGCTCACCAGCGAGAAAATCGACTACGACAATCACATCTCTCTGGAACTGCAGCTTGGTTCTGAAAGGACAAAAGCTCGACCAGAAAGCACGGGACCTCGCCTTAGATTTCAAGATGGACGTTTGTTAAGCGAGCGGATGCGAATTGGACATCACACGGAACCTCCAAAGGGAGAGATCCCGATGGACATCTTGAAATTCGAAGACCTAGAGAGGATTAGAAAAGGAAAGGGCATTGTGGAGTGACAAATCTTTGTATATGTAATTACTAAAAAGAATTGAAAACATAGAGTTCTATATTAGAAGATTTCTGTAAGAGATTCACTAGCAGAATTTTTCCTGTCTTATCTACGTTAGCTATTTATATCAAAATTTAGTGTGCATCTAACTTGT

CDS

>Mapoly0213s0014.1
ATGAAATCAGAAGGTGATCCTGATGCACTTTCGGAGCGGACCTCTCGTTTTCTTCTCACCGGAATTTTAGGTGAAAAAGTGGTACCTCTCACAAAGCTCCTCGAGGACATCACTGCAGAATCGAATGAAGAGACAGCGTACAGTCACCTCCTCCGAAAAGGAAAAGCAACGCCTGCTTGCCTGAATCAGATCCGGAGCTCAGCAAATCGACCCATGTGTCCGGCTGAGCGTAGGGGTAGCTTGGTTCAGAAAGAAGGCCATTGTCTTGACTCTCAGACTCATTGTCTTGACTCTCAGACTGAAAGTGGTTTTCCAGCTAAGCACCAACCGGCGAAAAGCGCAGGTCGTGGGGGCGGACTTCCTACACATGATTCTGATCACGGGAAGAGATTTCATGCTCGAGGAGACCCAGAACAGCATATACATCAGTCTCAGGAGGTCAGGCCCTCAATAACGAGTCGGAGTGACGCAAGGGAATTCCAGACGGAGCGCAAAGTTGCAACTGAGGATCAGGGGCGACATGGGGAGCATCAAACTCAGCGACAGCCACTACGTCGAGATTTGAATGTTCAGAATGAGGGAATTTCAGTAACTCCGGCAGCGCATCAGCAAGCGGGACGTGAAGCTTTCCAGGGCGGATGTTCGACCTCAACCCAACACAATGAAGAGATACACCGAAAGTGCCAGAAGCAAGCTTCAGCAGACCAAGATCGTGGCCAGCATATCAATGCAGAATTTCTAGCAGTATTGATGGCTGCACACTATCAAGAGGCCTACTTGAAAGCTTCCCTAGCTGCAAAGTATCTGCAGGAATACCAAAATGCGAAACAATCTCAACATCTTCCTGCAGGTTCTCAAAAAGCTCACGTAGCTGAGCGTTTTTCCGAGGCTTATCAAGTTGCACTTGAACTTTCGCAGCTTCCTGTGAATCCCGAAAGTCAGAAGTCTCTGATGGAAGAATTTTACACCAACCTCAGTGCAGCTCCTGAGGCAGCGAGTGGAGGGAAATTTTCAGCCTCTCCCCCGACTCCCTACCTCCATCCTTTTTATGAAGGATCGGCGACCCCCCAGGGAGGAAGTTTCCCTGCACAATGTGAACCATCACATGGCCCACTCGTCCCATCTTCGCCACTGCCAAGTCCCCCGACTGGACCTGAACAAGATCGTTCAGACTCAACTGGTGGGCAATCACAACTGCCGCATGGACTCGGGCAGACTTTTCTCCACTTCTCGCAGCTTCCAAGTACGGCCGAGCATGCCAAGACAGTGACTGAGGAGGGGTCGGACCGAGTCATTGATGAACGAGATCAGAAACCTGCAGAAAGATCAGAGGTCTTTCCACATCACCCTCACATGTCCTTTGCGTGCCAAGGCAAGGTGATGACTCGGGGAGCGAAGGTTGAATCTGAAGCTCCATTTGTAGCCATCTTCCCCTTGTACAAACCTCCACCTCAGCCTCAGCCCAAGCCCGAGCCCCATTATGGAGGCAACGTCGGTAAACAGGTGGTCCAGGAGACGGGTGATCATGCTAGAGTAATGACCTCGCAAGGACCCCATTGGCTTTACAGCTCCGGACCCTCCATCGCTCAATGTCAGTCTCGACCTCCAAATGAGACCAAGGACGCTCGCATCCAAAGGGAACAGGAAGCGCCACCTGGTACGCAAGGAGTGGGCTCGGAGCGGGAGACGTACTGTGATGGATCGGATGGAAAGAGATCTACGGGCTTCAAGCGGTGGAGCGCCCCACAGAACGGCGATGGAAGGGCACAGAATCCAATTCAGTTCGCAGTTGCTAATCAAGCGCCTCAGGGTGACGGCCCTCCACACCAGAGGGCTCCTCCTCATCCCCTCACTTTCGTGGATTTAGGAGATGCAAGCGAAGACGGCGAAAGCGTGCAGACGCCTTTGCCAGAAGATAAGGAATCTGATAGCGAACCTGAATCGGAGCGATTTGCGGGACAACCTAGAGATGAGGACACTGAAGTTGGCGCCAGGGTTGAGAGAAACGTGGAGGAATCGAAATCTGGAGCTGAAACTTTGCAAGAGTCAGGAGACGACGACGCGGGGGAACTCGAAGATGAGGAAAGGGAAAGGGAAGGGGAAGGGGAAGGGGAAGTCAAAAGTGAACGCAGATTCTACTTTTTTGATTTTACCAAAATCTGTGATAATCTGTACCCGCCGGATGTTACCACCAAAATGCTCAAAGACTTTGGGCTCAGATATTATCCAATGCGGTTTCGGGAGGATGAGAAGATCAGAGAGATAGAAGCGTTGTTTCGCGAGGTTTTATCTTTTTCGAGGCCGAAAAACGTCCCCGAGATTCCCATTGTTCCTTTTGATTTTCTAAGATCGCAGCGCTATTTTACTGAAATGGCGCAGCGTCCTGCGGCACGAAAATCTGCATCTGCAAGATCATCACAATCAACAGCAGCAGGCACTTCACATCCTGCTGCCCAGCTTTGGGCTGCCCTTATAGCCCAAAGGGCACGAGCCTTCAGAAGAGAGTGTTCGATACGCATCGAAAATCAAGGTATAGATTTGGCAGATTCGTTCACCGCGGATCAGCTTGACTACAAACCCGTCCACAGAGGCAGGAGCAGGGATGTCATGGCATGGTTGCGGAAGCCCAGAAGTCGTGGAGTTACATTGCATGACAGAAAAAAGATGTTTCGGGCTTACATTGATGAGATCGATGACTGGTATTATGAATACCGCTCGACCTTGGAGAATATAAATGACGAGACGGATGATTCTTTTGGTCATTTTATCGGCAACATTTATACAGAATATCCACTCATGGAGTTATCGAGGCGTTTGCGAAGATACAGAGATACCTTCTTAGAGCATCTGGTCTGTGTGAAGAAGGTCCTTGGAGACTCAACAGCAGTTCCTGATTTCGACAAAAATATCAGAGACCGACTCATAGCCTGTCGCGTGAGGGCTGCAAAGAGGATGGCCAGAAAAGCCTTGATGGTGATCAGGAGGGCCCATGCACCTTATAAGAAGCGTATGATCAATGGATGTCATAAGATGATCGTAAAGCTCGAACCGAAGCAAGAAAACAGGATAGCAGAAGCTGTAAGGATTGCGGGCACAAACAATGGACCCAGGCGTCAGCAGCGCATGTACAGTGGGCGTCTAAATCTGAATTCCACTTGGAGACCGCAAAGAGGCCTCCCAGACAGAGCCGTCAGTGTTCTAAAGGCGTGGCTCTTCACTAACTTTTTACACCCATATCCTAAAGATGTGGATAAAGAATCGTTGGCCTCAGCGACGGGTTTGACGAGATCACAGGTTTCCAACTGGTTCATAAATGCTCGAGTACGAGTCTGGAAACCGATGATTGAAGCAATGTATCTCATGGACTTTCCAGAAGATCGACACAGATTCATTACAATGTCCAGGGCCAGGAAAGTTGATCATGGGCAGGAATTGGGAGATCGGAAACCGGGAACAAGCCGCTCTAGGTTTTTCCCATGCGTTGACGGTAGGACCAGGCGATCGAGGAAACGTCAATGTATATATCGTCCAGCTTCTCACAGTCTTGCTTTGGGTTCAAGAGTTCTTCCTTCATTTCTTCGGCATGCACAGGCGAGTTCCCGGATGCGCCATCAAGCATCCCGTGCTTTTGCTCCTTACAGCAGGGAGATGTTGGCTCAGTTTCTTAGAAATGCTTCAGTCTGGAGGGCACAATTGGGAGAGAGCCGGCAGAATAGAGCGGAAGTCGAACACAGGTTCGCTATCCAGGGTCGAGCTGAAGTGGGAAACAGGTTCACCATTCAAAATCGAACTCAAGTCGAGCCCAAGTTCACCATTCAGAATCGAGCTCAAGTCGAGCCCAGGCTCACCGTCCAGGATCGAGCTCAAGTCGAATCCAGGTTCCCAATTCAGAATCGAGCACAAGTCGAACCCAGGCTCATCGTCCAGGATCGAGCTCAAGTCGAACCCAGGTTCCCCACTCAGAATCGAGCGCAAGTCGAACCCAGGGTCACCGTCCAGGATCGAACTCAAGTCGAACACAGTTTCATTATTCAGAATCAAGGTCAAGTCGAGCCCAGGCTCACCGTACAGGATCGAGATCAAGTCGAAACCAGGTTCCCCATTCAGAATCGAGCGCAAGTCGAACCCAGTGTCACCGTCCAGGATCGAGCTCAAGTCGAACACAGTTTCATTAGTCAAAATCGAGCTCCAGTCGAACCCAGGTTCACCATTCAGGATCGAGCTCAAGCAGAACCCAAGTTCACCTTCCCGAGTCAAGCGAAAGTCGAACCCAGGCTCACGATCCAAGATCGAGCTCAATTGGAACCCAGGTTCACTATCCAGGATCGAGCTCAAGTTGGAACGAGGTTCACCATCCAGGATCGAGCTCCAGTCGAAACCAGGTTCTCCATCCAGGATAGAGCTAAAGTCGATACTACGCTCACCATCAAGGATCTTCGAGCTGAACTCGAACCTAGGCTCACCAGCGAGAAAATCGACTACGACAATCACATCTCTCTGGAACTGCAGCTTGGTTCTGAAAGGACAAAAGCTCGACCAGAAAGCACGGGACCTCGCCTTAGATTTCAAGATGGACGTTTGTTAAGCGAGCGGATGCGAATTGGACATCACACGGAACCTCCAAAGGGAGAGATCCCGATGGACATCTTGAAATTCGAAGACCTAGAGAGGATTAGAAAAGGAAAGGGCATTGTGGAGTGA

Protein

>Mapoly0213s0014.1
MKSEGDPDALSERTSRFLLTGILGEKVVPLTKLLEDITAESNEETAYSHLLRKGKATPACLNQIRSSANRPMCPAERRGSLVQKEGHCLDSQTHCLDSQTESGFPAKHQPAKSAGRGGGLPTHDSDHGKRFHARGDPEQHIHQSQEVRPSITSRSDAREFQTERKVATEDQGRHGEHQTQRQPLRRDLNVQNEGISVTPAAHQQAGREAFQGGCSTSTQHNEEIHRKCQKQASADQDRGQHINAEFLAVLMAAHYQEAYLKASLAAKYLQEYQNAKQSQHLPAGSQKAHVAERFSEAYQVALELSQLPVNPESQKSLMEEFYTNLSAAPEAASGGKFSASPPTPYLHPFYEGSATPQGGSFPAQCEPSHGPLVPSSPLPSPPTGPEQDRSDSTGGQSQLPHGLGQTFLHFSQLPSTAEHAKTVTEEGSDRVIDERDQKPAERSEVFPHHPHMSFACQGKVMTRGAKVESEAPFVAIFPLYKPPPQPQPKPEPHYGGNVGKQVVQETGDHARVMTSQGPHWLYSSGPSIAQCQSRPPNETKDARIQREQEAPPGTQGVGSERETYCDGSDGKRSTGFKRWSAPQNGDGRAQNPIQFAVANQAPQGDGPPHQRAPPHPLTFVDLGDASEDGESVQTPLPEDKESDSEPESERFAGQPRDEDTEVGARVERNVEESKSGAETLQESGDDDAGELEDEEREREGEGEGEVKSERRFYFFDFTKICDNLYPPDVTTKMLKDFGLRYYPMRFREDEKIREIEALFREVLSFSRPKNVPEIPIVPFDFLRSQRYFTEMAQRPAARKSASARSSQSTAAGTSHPAAQLWAALIAQRARAFRRECSIRIENQGIDLADSFTADQLDYKPVHRGRSRDVMAWLRKPRSRGVTLHDRKKMFRAYIDEIDDWYYEYRSTLENINDETDDSFGHFIGNIYTEYPLMELSRRLRRYRDTFLEHLVCVKKVLGDSTAVPDFDKNIRDRLIACRVRAAKRMARKALMVIRRAHAPYKKRMINGCHKMIVKLEPKQENRIAEAVRIAGTNNGPRRQQRMYSGRLNLNSTWRPQRGLPDRAVSVLKAWLFTNFLHPYPKDVDKESLASATGLTRSQVSNWFINARVRVWKPMIEAMYLMDFPEDRHRFITMSRARKVDHGQELGDRKPGTSRSRFFPCVDGRTRRSRKRQCIYRPASHSLALGSRVLPSFLRHAQASSRMRHQASRAFAPYSREMLAQFLRNASVWRAQLGESRQNRAEVEHRFAIQGRAEVGNRFTIQNRTQVEPKFTIQNRAQVEPRLTVQDRAQVESRFPIQNRAQVEPRLIVQDRAQVEPRFPTQNRAQVEPRVTVQDRTQVEHSFIIQNQGQVEPRLTVQDRDQVETRFPIQNRAQVEPSVTVQDRAQVEHSFISQNRAPVEPRFTIQDRAQAEPKFTFPSQAKVEPRLTIQDRAQLEPRFTIQDRAQVGTRFTIQDRAPVETRFSIQDRAKVDTTLTIKDLRAELEPRLTSEKIDYDNHISLELQLGSERTKARPESTGPRLRFQDGRLLSERMRIGHHTEPPKGEIPMDILKFEDLERIRKGKGIVE

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>