Mapoly0232s0001



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
PFAM PF00010 Helix-loop-helix DNA-binding domain

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH31 transcription factor, bHLH Mapoly0232s0001.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0232s0001.1 scaffold_232:1..5852  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0232s0001.2 scaffold_232:1..5852  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0232s0001.3 scaffold_232:1..5151  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0232s0001.1  

Gene structure:

mRNA scaffold_232:1..5852  ( + strand )
five_prime_UTR scaffold_232:1..768  ( + strand )
five_prime_UTR scaffold_232:859..3029  ( + strand )
CDS scaffold_232:3030..3986  ( + strand )
CDS scaffold_232:4397..4876  ( + strand )
CDS scaffold_232:5239..5310  ( + strand )
three_prime_UTR scaffold_232:5311..5852  ( + strand )

Sequences:

Gene

>Mapoly0232s0001.1
GGACGGCCCGACGATGCGCAAACGAGGGTCACATCTCGGGGAATCTATCTTCTCCGGAGCGCGAGGACGCCTCGCCTGCTCAGTCCGTTTCATTCGATCGCCCCCAACCCAACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTTCCTTCTCGTTCTCGCCATCCCACTCCACCGTACCCGTCCCTGCCCGTCCTTCTGCTGCTGAAAAAGGAAAAGGTTAGGTGGGAAGTACGATTTAATAGCAGTGGGCCCGGAATTGAGAATACCAAAAGCAGAGCACCGAAGAGGCCGTCCGTCGGACTGGGCAGAGCAGAGACGCACTGTGCGAGCGAGCGAGCGAGCGAGCGAACGAGAGCACTGTTCCAGTAGGTTGTACCTTGGGGGCTCGTACAGCATACACTACGTTCTCTCGTCTTGATCGTCGTAAAGCAGAGAGACTACTACCCTTTGGCGCTGTCTGGCTCTAGATCTGAACCTGCTCCCGCTGCAGTTCGATCTCGGGCTTCTACTGTGACATCGAGATGGTCAAGCTTAAAGACATGCTCTAGTCCGACTGTCATCTCGCTGCACGGACAAGCAAATACTGTCACAGAAGTACGGGCTCCCGAACTTCACGGGATTTATGACGAGCGACCAATCAATGACATCGGCATTTTCTCCCTGCACGTCAATCGATTTCTGACTCCAATCGGCTGCAGGCTCGGCTGCAGATCTCCTGGTTCACAGACGCCGACTCTCGAAAAGTGGCCAGCGGCTGATCCTCGAGTGTAAGTAAAGCACCAGCCCCCCAACCAGAGCTTCCTTTCCTGTATTGGCCAGCTGACATTGTGCAATACCGTCAACTTTCGCTCGTTCAGCAGGCGCAGGTTTTGACCAGCTAATCGTGGACGTGTGGACCGAGCGTAGAATATGCCGTTCCATGGCCCATTGCACCATAACTCTGCAGCCGACGTGACTAAGTTGGCGTTTGCAAACGGAGTCCGTCCGCCCGGCGTCGCCGTAATGGCGATGTTAGCTGCGAGCGAGGGATGCTGAGACCGGGGGAGTCCAATTAGAGGCCAATTAGGACCGTAGCTGCTGCAGTCGCGAGTACGTACGAGTCCGAGCATCAACATGACGCACGCAAAGCTAGCCCTGCAACCATCTTTTGCCTCTTATCTAGACGGAGCCCAGCAGTACAGTTGGCCGAGGCGTATGGAATCTGATCCGCTGTGCTCTGGGTCGGAAGAAGCCACGGAGTATCGCATCAGTGGAGGCCGGATTAGACTTTGACTGGAGAGGGCAAACTATCTTCTCGAAGTCTATCGAGACTTCGGCTCGGCCGCGAAGCTGAGCAGTGTGTAAGAACCGTACTTGATTGCAGAATCTTCTTCTGGATCAAGTCTGAGTTTCCGGAGCAAAATCTCAAAGCTGGACCTGTATGCCAATGTAACTCCTCTTACACTGTACTGCATCACTCGCACTCGATCTCGCTCTCGCTGATAAAGCTAGGGCAGACTTTGATAGTCAGACAAACCCCGCTATCCTCTAGCAAGAAACCTCAATCCGCAGACCAAAAAGAAATCGAGGGAGGTGAAAATTCCGTCCGATAATCCAGCGGCGGCTCCATCCATGGGGGATCGCCGAATTTGCACTGGTACACGCAACACTCCTGAAGAGGATAACTAATTCGGGACCGCTGTGGGCAGCCAAATTTTACTCATGTTTTGTTCTTGCGCATGGTTTGGATCGCTGAACGGAGGAGCGATTATCGAGTCTCACCCGTCGACAGCTTTGCTCACTTACCGCTGAAGATTTGCAATTATCAGTACATCACTGTAGAATTCGGAACGCATCGAAACGGCTGGTGGACTTCTCGTACCCGGAATCTGAAGACAGTGAGAAGTAAAACGCCCTGTGGCCTGAGCAGGACTCTGGACTGGGCTGGGCTTTATTGGACTTGAGTCCGGACTGCCACAGCGCTATGGTAGCCCGGCGCAGGATTATGGGCGGATGATCTGAACTGCTGAGGTTGACATGGTAGCATAGGAGCATAGGTACTGACTGTATGATTGAGCTCAGACGTCTTGCGCAGTACATGGCCGCCCGTCCGAAAATGAGAACATCTGCATCCGCGCTAAAGAACTGCCTTACCCTGATAGCCAGAAGCGACACCACAGCAAAGCACCGCATATGAAACCTTGAGGTATCATTACACGAGCGAGATAGAGATGGGAGCCAAACAGTCGTCACAGCGACGCTGCACGGACTGGAGTATAATGTATTTGGAAGCTCGTCCCACACTCGCTTGCTCACAGAATCGGCAGAGAGGACGTACGCCACGCCATCAGCTCTTCTGAGGAACCGTCCTCTTCTGAGGATGGTCTTCGCTGTGGGGATGTTTGGCCCTCGCCTTGTCGCCGGTGCCGACGATGTCAATCCGACGACCTACTCGCTCACTTTATGCATTATCAGCATGTACAAACATCCAACTTGACTTACTCAGGCTCAGCCAGGTTCTGAGCCCGAGAAATATCCCTTTTCACCAGTATGTTCGAAAGTTTCCCGGGTTCACCACATGGCTCCATCTGGAAATCCGCAAGAGGAACTCGCTCGGCTGACAGTCAGCGGCCGAGGGAAAGGGAAAGGCAAAAGCTCGGAACCCCCAGTGGCCATGATACTAGGGGCCAGGGTGAGGCATGTGCCACTCTTCTGCTCCTAAGTCTAGAGTGCACGCATATGGTCGCAGCCCAGTTCCCTCACCTCGAGGATCAAAACTAGCGGGAGTAAGTATCATGCAATTGCTCACGAGGCCCAGCCAGCACTTTGATAATGTTCTGTTGTCTGATTTAAAGCAGTAACTGTTAACGTGGACTCTCGCCCGAGGCCATTAGCAAAGCGGGAAACCTTCAGGCTCCAGGGGAGTAAGCACAGTACGAGAAGTAGAACTCGGACTTCTACTGCTCAGGTCAGCTCTGTACAGCTGAAGGGTTTGAAGCTGCAAGCCCTGGATGCGGATTAACAGGCATTAGGTATCCGTTTGCTGCGCATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAGTAAGTTCCCCTGTACATTTTTCAAGCTCATTTGGTTTCCTTACAGAATCTTTACACATACTGATTTGGCGGATTGCGTACTGTCGACCACATAAAAGCGGATCTGAAGCCCTGCTTAGCACTCATGCGAATGACTCAGAGCCGTGAGAAAATATGCCTCTTGGAAACTGGAGGATTGTGATGCGCATATTGCGTCAATAGAAATCAAGCTCTAGTGCTTGTTCACAATCAGTATGCAAGGATGACAGAAGTTGCGGTTCTGATAACATCTTACTCTGTAGTCAGGTTTATATGCTCCTTTTCGCGACATTGTCCACATGATATTCTCACACGAAATACACAGAGTGTGGCATCTCCTACTGGGCAGTCGAATTTTGTATCGACAAACTAACAAGTTCAAGTTTTTACAGAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGGTACCGACACAAATCCATGATCCAGTGTTGACGAACTTCTTCGATTTCTTTCAAGAATGTCTTCTTCCTGGTAACACTGATTGATGAATTGAACACAAATTTTGAAATGTAGAGCTGAGGTCTACAACAAAACCAACTTTCGCTTCGTTGTAACGATTGGCTAGCTTTTGAGCATGTATCCTCCGCCAGGAAGGTTATAGCGGCTGTCTTTGCAGCTCCAGTGTAAGAATCTTAGACTCCAGTACTTAGAGGCTATTGAGCAGTATGCCGTCTGCCAACTTTCTTGACAGTTCACTTGTCGGCAAGAAACAAAAGTACTTGATTCCAGCTCATTACTGATTGTTCGTGCTAATGTTATGCAGCACAATAAGGCGTCTGGTGACACTCCTAGCGGGCAAATGATAGAAGACGTTCTGAAGTCTCTACTGAAGTAGGTGTCGAAAACGAGGACTTTGTGTACAATACTATGCATGCATCAATAAGCAATTGCCACTGTTTGTGATTCGACTGGTCAGCTTGAACGTTTAAAAACACAAAACTGATAGCTTATTTTTGTTTGGATTTGCTCGAGCCATGCTGAATCTTTTCAACAGTATTTCACGATGGAAGAGATTAAATCCAGAAGTTTTCCTTGACTATGAAATCGACTCGATTTTCTCGAACATGGTTCTAGAAAACGGTTTCGTGGTTCATGGCTAGCTTTGGATGACTTTATAGAATTCGGTATGTAGATGAGCAGTTTTTGAGGATTTGTTTTCTATAACACATGCTTAATGCTAGGCCTCCATTAACATCAATGTAATGGCCACGAAGCAACTATTGCTAGTCGACCCTGTACTGAAAAGGTTCGATGAAGTGTCCAAAGGTTATGAGACTCAGCTCCTTGTAGAGGCTGATTGAGGAGAAGCTAATGTATGACGCCGTTGGAACTATCGAATAATTTTGTATTAAAAGTTTGACATCATGCTTGTTCATA

mRNA

>Mapoly0232s0001.1
GGACGGCCCGACGATGCGCAAACGAGGGTCACATCTCGGGGAATCTATCTTCTCCGGAGCGCGAGGACGCCTCGCCTGCTCAGTCCGTTTCATTCGATCGCCCCCAACCCAACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTTCCTTCTCGTTCTCGCCATCCCACTCCACCGTACCCGTCCCTGCCCGTCCTTCTGCTGCTGAAAAAGGAAAAGGTTAGGTGGGAAGTACGATTTAATAGCAGTGGGCCCGGAATTGAGAATACCAAAAGCAGAGCACCGAAGAGGCCGTCCGTCGGACTGGGCAGAGCAGAGACGCACTGTGCGAGCGAGCGAGCGAGCGAGCGAACGAGAGCACTGTTCCAGTAGGTTGTACCTTGGGGGCTCGTACAGCATACACTACGTTCTCTCGTCTTGATCGTCGTAAAGCAGAGAGACTACTACCCTTTGGCGCTGTCTGGCTCTAGATCTGAACCTGCTCCCGCTGCAGTTCGATCTCGGGCTTCTACTGTGACATCGAGATGGTCAAGCTTAAAGACATGCTCTAGTCCGACTGTCATCTCGCTGCACGGACAAGCAAATACTGTCACAGAAGTACGGGCTCCCGAACTTCACGGGATTTATGACGAGCGACCAATCAATGACATCGGCATTTTCTCCCTGCACGTCAATCGATTTCTGACTCCAATCGGCTGCAGGCTCGGCTGCAGATCTCCTGGTTCACAGACGCCGACTCTCGAAAAGTGGCCAGCGGCTGATCCTCGAGTCAGGCGCAGGTTTTGACCAGCTAATCGTGGACGTGTGGACCGAGCGTAGAATATGCCGTTCCATGGCCCATTGCACCATAACTCTGCAGCCGACGTGACTAAGTTGGCGTTTGCAAACGGAGTCCGTCCGCCCGGCGTCGCCGTAATGGCGATGTTAGCTGCGAGCGAGGGATGCTGAGACCGGGGGAGTCCAATTAGAGGCCAATTAGGACCGTAGCTGCTGCAGTCGCGAGTACGTACGAGTCCGAGCATCAACATGACGCACGCAAAGCTAGCCCTGCAACCATCTTTTGCCTCTTATCTAGACGGAGCCCAGCAGTACAGTTGGCCGAGGCGTATGGAATCTGATCCGCTGTGCTCTGGGTCGGAAGAAGCCACGGAGTATCGCATCAGTGGAGGCCGGATTAGACTTTGACTGGAGAGGGCAAACTATCTTCTCGAAGTCTATCGAGACTTCGGCTCGGCCGCGAAGCTGAGCAGTGTGTAAGAACCGTACTTGATTGCAGAATCTTCTTCTGGATCAAGTCTGAGTTTCCGGAGCAAAATCTCAAAGCTGGACCTGTATGCCAATGTAACTCCTCTTACACTGTACTGCATCACTCGCACTCGATCTCGCTCTCGCTGATAAAGCTAGGGCAGACTTTGATAGTCAGACAAACCCCGCTATCCTCTAGCAAGAAACCTCAATCCGCAGACCAAAAAGAAATCGAGGGAGGTGAAAATTCCGTCCGATAATCCAGCGGCGGCTCCATCCATGGGGGATCGCCGAATTTGCACTGGTACACGCAACACTCCTGAAGAGGATAACTAATTCGGGACCGCTGTGGGCAGCCAAATTTTACTCATGTTTTGTTCTTGCGCATGGTTTGGATCGCTGAACGGAGGAGCGATTATCGAGTCTCACCCGTCGACAGCTTTGCTCACTTACCGCTGAAGATTTGCAATTATCAGTACATCACTGTAGAATTCGGAACGCATCGAAACGGCTGGTGGACTTCTCGTACCCGGAATCTGAAGACAGTGAGAAGTAAAACGCCCTGTGGCCTGAGCAGGACTCTGGACTGGGCTGGGCTTTATTGGACTTGAGTCCGGACTGCCACAGCGCTATGGTAGCCCGGCGCAGGATTATGGGCGGATGATCTGAACTGCTGAGGTTGACATGGTAGCATAGGAGCATAGGTACTGACTGTATGATTGAGCTCAGACGTCTTGCGCAGTACATGGCCGCCCGTCCGAAAATGAGAACATCTGCATCCGCGCTAAAGAACTGCCTTACCCTGATAGCCAGAAGCGACACCACAGCAAAGCACCGCATATGAAACCTTGAGGTATCATTACACGAGCGAGATAGAGATGGGAGCCAAACAGTCGTCACAGCGACGCTGCACGGACTGGAGTATAATGTATTTGGAAGCTCGTCCCACACTCGCTTGCTCACAGAATCGGCAGAGAGGACGTACGCCACGCCATCAGCTCTTCTGAGGAACCGTCCTCTTCTGAGGATGGTCTTCGCTGTGGGGATGTTTGGCCCTCGCCTTGTCGCCGGTGCCGACGATGTCAATCCGACGACCTACTCGCTCACTTTATGCATTATCAGCATGTACAAACATCCAACTTGACTTACTCAGGCTCAGCCAGGTTCTGAGCCCGAGAAATATCCCTTTTCACCAGTATGTTCGAAAGTTTCCCGGGTTCACCACATGGCTCCATCTGGAAATCCGCAAGAGGAACTCGCTCGGCTGACAGTCAGCGGCCGAGGGAAAGGGAAAGGCAAAAGCTCGGAACCCCCAGTGGCCATGATACTAGGGGCCAGGGTGAGGCATGTGCCACTCTTCTGCTCCTAAGTCTAGAGTGCACGCATATGGTCGCAGCCCAGTTCCCTCACCTCGAGGATCAAAACTAGCGGGAGTAAGTATCATGCAATTGCTCACGAGGCCCAGCCAGCACTTTGATAATGTTCTGTTGTCTGATTTAAAGCAGTAACTGTTAACGTGGACTCTCGCCCGAGGCCATTAGCAAAGCGGGAAACCTTCAGGCTCCAGGGGAGTAAGCACAGTACGAGAAGTAGAACTCGGACTTCTACTGCTCAGGTCAGCTCTGTACAGCTGAAGGGTTTGAAGCTGCAAGCCCTGGATGCGGATTAACAGGCATTAGGTATCCGTTTGCTGCGCATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGCACAATAAGGCGTCTGGTGACACTCCTAGCGGGCAAATGATAGAAGACGTTCTGAAGTCTCTACTGAAGTAGGTGTCGAAAACGAGGACTTTGTGTACAATACTATGCATGCATCAATAAGCAATTGCCACTGTTTGTGATTCGACTGGTCAGCTTGAACGTTTAAAAACACAAAACTGATAGCTTATTTTTGTTTGGATTTGCTCGAGCCATGCTGAATCTTTTCAACAGTATTTCACGATGGAAGAGATTAAATCCAGAAGTTTTCCTTGACTATGAAATCGACTCGATTTTCTCGAACATGGTTCTAGAAAACGGTTTCGTGGTTCATGGCTAGCTTTGGATGACTTTATAGAATTCGGTATGTAGATGAGCAGTTTTTGAGGATTTGTTTTCTATAACACATGCTTAATGCTAGGCCTCCATTAACATCAATGTAATGGCCACGAAGCAACTATTGCTAGTCGACCCTGTACTGAAAAGGTTCGATGAAGTGTCCAAAGGTTATGAGACTCAGCTCCTTGTAGAGGCTGATTGAGGAGAAGCTAATGTATGACGCCGTTGGAACTATCGAATAATTTTGTATTAAAAGTTTGACATCATGCTTGTTCATA

CDS

>Mapoly0232s0001.1
ATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGCACAATAAGGCGTCTGGTGACACTCCTAGCGGGCAAATGATAGAAGACGTTCTGAAGTCTCTACTGAAGTAG

Protein

>Mapoly0232s0001.1
MLDAFVVTCHKQMIPWTDLGRVRCNNAHASFVHAITAHFEADRQLTCGMGMNKVQIGNGRTPTVFTPWTSHAPLEATSFVAESGTYSQPTYAHGGAGDSWPSFTFSPEQIDYRQAPVSVPESSPSTPPLLYDTVTLGPIIDCSGVADLILDKGSTPFFKDKEKETTPSARIILPAAAASVTGNATAIPPKLQLGPVATQNHASVATDCQRLLQLGKDDQVKKSDLLSAGANWEFSERVPPDPNRNQASTLDKEAKSKASTEQRKIATMHEGYLKNYKKDRLPNVVTLQKSDHMRRERDRRIALKLMYKTLDSMIPKPSKKSKRDRTAIVDDALKYVKGMQEKLEKFRLKGIGVKKISTISNRLLEPEHENLLACSPAELPSRLGKLTAATGAAREQGTEISVITSHDERLGSDSSLLMEPQVQVFIGCGNDVLISFSCKPRGNLISCVLQALEMFCLEVKQYTFSKILKELVHCNFMTKHNKASGDTPSGQMIEDVLKSLLK

Mapoly0232s0001.2  

Gene structure:

mRNA scaffold_232:1..5852  ( + strand )
five_prime_UTR scaffold_232:1..768  ( + strand )
five_prime_UTR scaffold_232:859..3029  ( + strand )
CDS scaffold_232:3030..3986  ( + strand )
CDS scaffold_232:4397..4876  ( + strand )
CDS scaffold_232:4989..4994  ( + strand )
three_prime_UTR scaffold_232:4995..5098  ( + strand )
three_prime_UTR scaffold_232:5239..5852  ( + strand )

Sequences:

Gene

>Mapoly0232s0001.2
GGACGGCCCGACGATGCGCAAACGAGGGTCACATCTCGGGGAATCTATCTTCTCCGGAGCGCGAGGACGCCTCGCCTGCTCAGTCCGTTTCATTCGATCGCCCCCAACCCAACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTTCCTTCTCGTTCTCGCCATCCCACTCCACCGTACCCGTCCCTGCCCGTCCTTCTGCTGCTGAAAAAGGAAAAGGTTAGGTGGGAAGTACGATTTAATAGCAGTGGGCCCGGAATTGAGAATACCAAAAGCAGAGCACCGAAGAGGCCGTCCGTCGGACTGGGCAGAGCAGAGACGCACTGTGCGAGCGAGCGAGCGAGCGAGCGAACGAGAGCACTGTTCCAGTAGGTTGTACCTTGGGGGCTCGTACAGCATACACTACGTTCTCTCGTCTTGATCGTCGTAAAGCAGAGAGACTACTACCCTTTGGCGCTGTCTGGCTCTAGATCTGAACCTGCTCCCGCTGCAGTTCGATCTCGGGCTTCTACTGTGACATCGAGATGGTCAAGCTTAAAGACATGCTCTAGTCCGACTGTCATCTCGCTGCACGGACAAGCAAATACTGTCACAGAAGTACGGGCTCCCGAACTTCACGGGATTTATGACGAGCGACCAATCAATGACATCGGCATTTTCTCCCTGCACGTCAATCGATTTCTGACTCCAATCGGCTGCAGGCTCGGCTGCAGATCTCCTGGTTCACAGACGCCGACTCTCGAAAAGTGGCCAGCGGCTGATCCTCGAGTGTAAGTAAAGCACCAGCCCCCCAACCAGAGCTTCCTTTCCTGTATTGGCCAGCTGACATTGTGCAATACCGTCAACTTTCGCTCGTTCAGCAGGCGCAGGTTTTGACCAGCTAATCGTGGACGTGTGGACCGAGCGTAGAATATGCCGTTCCATGGCCCATTGCACCATAACTCTGCAGCCGACGTGACTAAGTTGGCGTTTGCAAACGGAGTCCGTCCGCCCGGCGTCGCCGTAATGGCGATGTTAGCTGCGAGCGAGGGATGCTGAGACCGGGGGAGTCCAATTAGAGGCCAATTAGGACCGTAGCTGCTGCAGTCGCGAGTACGTACGAGTCCGAGCATCAACATGACGCACGCAAAGCTAGCCCTGCAACCATCTTTTGCCTCTTATCTAGACGGAGCCCAGCAGTACAGTTGGCCGAGGCGTATGGAATCTGATCCGCTGTGCTCTGGGTCGGAAGAAGCCACGGAGTATCGCATCAGTGGAGGCCGGATTAGACTTTGACTGGAGAGGGCAAACTATCTTCTCGAAGTCTATCGAGACTTCGGCTCGGCCGCGAAGCTGAGCAGTGTGTAAGAACCGTACTTGATTGCAGAATCTTCTTCTGGATCAAGTCTGAGTTTCCGGAGCAAAATCTCAAAGCTGGACCTGTATGCCAATGTAACTCCTCTTACACTGTACTGCATCACTCGCACTCGATCTCGCTCTCGCTGATAAAGCTAGGGCAGACTTTGATAGTCAGACAAACCCCGCTATCCTCTAGCAAGAAACCTCAATCCGCAGACCAAAAAGAAATCGAGGGAGGTGAAAATTCCGTCCGATAATCCAGCGGCGGCTCCATCCATGGGGGATCGCCGAATTTGCACTGGTACACGCAACACTCCTGAAGAGGATAACTAATTCGGGACCGCTGTGGGCAGCCAAATTTTACTCATGTTTTGTTCTTGCGCATGGTTTGGATCGCTGAACGGAGGAGCGATTATCGAGTCTCACCCGTCGACAGCTTTGCTCACTTACCGCTGAAGATTTGCAATTATCAGTACATCACTGTAGAATTCGGAACGCATCGAAACGGCTGGTGGACTTCTCGTACCCGGAATCTGAAGACAGTGAGAAGTAAAACGCCCTGTGGCCTGAGCAGGACTCTGGACTGGGCTGGGCTTTATTGGACTTGAGTCCGGACTGCCACAGCGCTATGGTAGCCCGGCGCAGGATTATGGGCGGATGATCTGAACTGCTGAGGTTGACATGGTAGCATAGGAGCATAGGTACTGACTGTATGATTGAGCTCAGACGTCTTGCGCAGTACATGGCCGCCCGTCCGAAAATGAGAACATCTGCATCCGCGCTAAAGAACTGCCTTACCCTGATAGCCAGAAGCGACACCACAGCAAAGCACCGCATATGAAACCTTGAGGTATCATTACACGAGCGAGATAGAGATGGGAGCCAAACAGTCGTCACAGCGACGCTGCACGGACTGGAGTATAATGTATTTGGAAGCTCGTCCCACACTCGCTTGCTCACAGAATCGGCAGAGAGGACGTACGCCACGCCATCAGCTCTTCTGAGGAACCGTCCTCTTCTGAGGATGGTCTTCGCTGTGGGGATGTTTGGCCCTCGCCTTGTCGCCGGTGCCGACGATGTCAATCCGACGACCTACTCGCTCACTTTATGCATTATCAGCATGTACAAACATCCAACTTGACTTACTCAGGCTCAGCCAGGTTCTGAGCCCGAGAAATATCCCTTTTCACCAGTATGTTCGAAAGTTTCCCGGGTTCACCACATGGCTCCATCTGGAAATCCGCAAGAGGAACTCGCTCGGCTGACAGTCAGCGGCCGAGGGAAAGGGAAAGGCAAAAGCTCGGAACCCCCAGTGGCCATGATACTAGGGGCCAGGGTGAGGCATGTGCCACTCTTCTGCTCCTAAGTCTAGAGTGCACGCATATGGTCGCAGCCCAGTTCCCTCACCTCGAGGATCAAAACTAGCGGGAGTAAGTATCATGCAATTGCTCACGAGGCCCAGCCAGCACTTTGATAATGTTCTGTTGTCTGATTTAAAGCAGTAACTGTTAACGTGGACTCTCGCCCGAGGCCATTAGCAAAGCGGGAAACCTTCAGGCTCCAGGGGAGTAAGCACAGTACGAGAAGTAGAACTCGGACTTCTACTGCTCAGGTCAGCTCTGTACAGCTGAAGGGTTTGAAGCTGCAAGCCCTGGATGCGGATTAACAGGCATTAGGTATCCGTTTGCTGCGCATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAGTAAGTTCCCCTGTACATTTTTCAAGCTCATTTGGTTTCCTTACAGAATCTTTACACATACTGATTTGGCGGATTGCGTACTGTCGACCACATAAAAGCGGATCTGAAGCCCTGCTTAGCACTCATGCGAATGACTCAGAGCCGTGAGAAAATATGCCTCTTGGAAACTGGAGGATTGTGATGCGCATATTGCGTCAATAGAAATCAAGCTCTAGTGCTTGTTCACAATCAGTATGCAAGGATGACAGAAGTTGCGGTTCTGATAACATCTTACTCTGTAGTCAGGTTTATATGCTCCTTTTCGCGACATTGTCCACATGATATTCTCACACGAAATACACAGAGTGTGGCATCTCCTACTGGGCAGTCGAATTTTGTATCGACAAACTAACAAGTTCAAGTTTTTACAGAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGGTACCGACACAAATCCATGATCCAGTGTTGACGAACTTCTTCGATTTCTTTCAAGAATGTCTTCTTCCTGGTAACACTGATTGATGAATTGAACACAAATTTTGAAATGTAGAGCTGAGGTCTACAACAAAACCAACTTTCGCTTCGTTGTAACGATTGGCTAGCTTTTGAGCATGTATCCTCCGCCAGGAAGGTTATAGCGGCTGTCTTTGCAGCTCCAGTGTAAGAATCTTAGACTCCAGTACTTAGAGGCTATTGAGCAGTATGCCGTCTGCCAACTTTCTTGACAGTTCACTTGTCGGCAAGAAACAAAAGTACTTGATTCCAGCTCATTACTGATTGTTCGTGCTAATGTTATGCAGCACAATAAGGCGTCTGGTGACACTCCTAGCGGGCAAATGATAGAAGACGTTCTGAAGTCTCTACTGAAGTAGGTGTCGAAAACGAGGACTTTGTGTACAATACTATGCATGCATCAATAAGCAATTGCCACTGTTTGTGATTCGACTGGTCAGCTTGAACGTTTAAAAACACAAAACTGATAGCTTATTTTTGTTTGGATTTGCTCGAGCCATGCTGAATCTTTTCAACAGTATTTCACGATGGAAGAGATTAAATCCAGAAGTTTTCCTTGACTATGAAATCGACTCGATTTTCTCGAACATGGTTCTAGAAAACGGTTTCGTGGTTCATGGCTAGCTTTGGATGACTTTATAGAATTCGGTATGTAGATGAGCAGTTTTTGAGGATTTGTTTTCTATAACACATGCTTAATGCTAGGCCTCCATTAACATCAATGTAATGGCCACGAAGCAACTATTGCTAGTCGACCCTGTACTGAAAAGGTTCGATGAAGTGTCCAAAGGTTATGAGACTCAGCTCCTTGTAGAGGCTGATTGAGGAGAAGCTAATGTATGACGCCGTTGGAACTATCGAATAATTTTGTATTAAAAGTTTGACATCATGCTTGTTCATA

mRNA

>Mapoly0232s0001.2
GGACGGCCCGACGATGCGCAAACGAGGGTCACATCTCGGGGAATCTATCTTCTCCGGAGCGCGAGGACGCCTCGCCTGCTCAGTCCGTTTCATTCGATCGCCCCCAACCCAACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTTCCTTCTCGTTCTCGCCATCCCACTCCACCGTACCCGTCCCTGCCCGTCCTTCTGCTGCTGAAAAAGGAAAAGGTTAGGTGGGAAGTACGATTTAATAGCAGTGGGCCCGGAATTGAGAATACCAAAAGCAGAGCACCGAAGAGGCCGTCCGTCGGACTGGGCAGAGCAGAGACGCACTGTGCGAGCGAGCGAGCGAGCGAGCGAACGAGAGCACTGTTCCAGTAGGTTGTACCTTGGGGGCTCGTACAGCATACACTACGTTCTCTCGTCTTGATCGTCGTAAAGCAGAGAGACTACTACCCTTTGGCGCTGTCTGGCTCTAGATCTGAACCTGCTCCCGCTGCAGTTCGATCTCGGGCTTCTACTGTGACATCGAGATGGTCAAGCTTAAAGACATGCTCTAGTCCGACTGTCATCTCGCTGCACGGACAAGCAAATACTGTCACAGAAGTACGGGCTCCCGAACTTCACGGGATTTATGACGAGCGACCAATCAATGACATCGGCATTTTCTCCCTGCACGTCAATCGATTTCTGACTCCAATCGGCTGCAGGCTCGGCTGCAGATCTCCTGGTTCACAGACGCCGACTCTCGAAAAGTGGCCAGCGGCTGATCCTCGAGTCAGGCGCAGGTTTTGACCAGCTAATCGTGGACGTGTGGACCGAGCGTAGAATATGCCGTTCCATGGCCCATTGCACCATAACTCTGCAGCCGACGTGACTAAGTTGGCGTTTGCAAACGGAGTCCGTCCGCCCGGCGTCGCCGTAATGGCGATGTTAGCTGCGAGCGAGGGATGCTGAGACCGGGGGAGTCCAATTAGAGGCCAATTAGGACCGTAGCTGCTGCAGTCGCGAGTACGTACGAGTCCGAGCATCAACATGACGCACGCAAAGCTAGCCCTGCAACCATCTTTTGCCTCTTATCTAGACGGAGCCCAGCAGTACAGTTGGCCGAGGCGTATGGAATCTGATCCGCTGTGCTCTGGGTCGGAAGAAGCCACGGAGTATCGCATCAGTGGAGGCCGGATTAGACTTTGACTGGAGAGGGCAAACTATCTTCTCGAAGTCTATCGAGACTTCGGCTCGGCCGCGAAGCTGAGCAGTGTGTAAGAACCGTACTTGATTGCAGAATCTTCTTCTGGATCAAGTCTGAGTTTCCGGAGCAAAATCTCAAAGCTGGACCTGTATGCCAATGTAACTCCTCTTACACTGTACTGCATCACTCGCACTCGATCTCGCTCTCGCTGATAAAGCTAGGGCAGACTTTGATAGTCAGACAAACCCCGCTATCCTCTAGCAAGAAACCTCAATCCGCAGACCAAAAAGAAATCGAGGGAGGTGAAAATTCCGTCCGATAATCCAGCGGCGGCTCCATCCATGGGGGATCGCCGAATTTGCACTGGTACACGCAACACTCCTGAAGAGGATAACTAATTCGGGACCGCTGTGGGCAGCCAAATTTTACTCATGTTTTGTTCTTGCGCATGGTTTGGATCGCTGAACGGAGGAGCGATTATCGAGTCTCACCCGTCGACAGCTTTGCTCACTTACCGCTGAAGATTTGCAATTATCAGTACATCACTGTAGAATTCGGAACGCATCGAAACGGCTGGTGGACTTCTCGTACCCGGAATCTGAAGACAGTGAGAAGTAAAACGCCCTGTGGCCTGAGCAGGACTCTGGACTGGGCTGGGCTTTATTGGACTTGAGTCCGGACTGCCACAGCGCTATGGTAGCCCGGCGCAGGATTATGGGCGGATGATCTGAACTGCTGAGGTTGACATGGTAGCATAGGAGCATAGGTACTGACTGTATGATTGAGCTCAGACGTCTTGCGCAGTACATGGCCGCCCGTCCGAAAATGAGAACATCTGCATCCGCGCTAAAGAACTGCCTTACCCTGATAGCCAGAAGCGACACCACAGCAAAGCACCGCATATGAAACCTTGAGGTATCATTACACGAGCGAGATAGAGATGGGAGCCAAACAGTCGTCACAGCGACGCTGCACGGACTGGAGTATAATGTATTTGGAAGCTCGTCCCACACTCGCTTGCTCACAGAATCGGCAGAGAGGACGTACGCCACGCCATCAGCTCTTCTGAGGAACCGTCCTCTTCTGAGGATGGTCTTCGCTGTGGGGATGTTTGGCCCTCGCCTTGTCGCCGGTGCCGACGATGTCAATCCGACGACCTACTCGCTCACTTTATGCATTATCAGCATGTACAAACATCCAACTTGACTTACTCAGGCTCAGCCAGGTTCTGAGCCCGAGAAATATCCCTTTTCACCAGTATGTTCGAAAGTTTCCCGGGTTCACCACATGGCTCCATCTGGAAATCCGCAAGAGGAACTCGCTCGGCTGACAGTCAGCGGCCGAGGGAAAGGGAAAGGCAAAAGCTCGGAACCCCCAGTGGCCATGATACTAGGGGCCAGGGTGAGGCATGTGCCACTCTTCTGCTCCTAAGTCTAGAGTGCACGCATATGGTCGCAGCCCAGTTCCCTCACCTCGAGGATCAAAACTAGCGGGAGTAAGTATCATGCAATTGCTCACGAGGCCCAGCCAGCACTTTGATAATGTTCTGTTGTCTGATTTAAAGCAGTAACTGTTAACGTGGACTCTCGCCCGAGGCCATTAGCAAAGCGGGAAACCTTCAGGCTCCAGGGGAGTAAGCACAGTACGAGAAGTAGAACTCGGACTTCTACTGCTCAGGTCAGCTCTGTACAGCTGAAGGGTTTGAAGCTGCAAGCCCTGGATGCGGATTAACAGGCATTAGGTATCCGTTTGCTGCGCATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGAGCTGAGGTCTACAACAAAACCAACTTTCGCTTCGTTGTAACGATTGGCTAGCTTTTGAGCATGTATCCTCCGCCAGGAAGGTTATAGCGGCTGTCTTTGCAGCTCCAGTCACAATAAGGCGTCTGGTGACACTCCTAGCGGGCAAATGATAGAAGACGTTCTGAAGTCTCTACTGAAGTAGGTGTCGAAAACGAGGACTTTGTGTACAATACTATGCATGCATCAATAAGCAATTGCCACTGTTTGTGATTCGACTGGTCAGCTTGAACGTTTAAAAACACAAAACTGATAGCTTATTTTTGTTTGGATTTGCTCGAGCCATGCTGAATCTTTTCAACAGTATTTCACGATGGAAGAGATTAAATCCAGAAGTTTTCCTTGACTATGAAATCGACTCGATTTTCTCGAACATGGTTCTAGAAAACGGTTTCGTGGTTCATGGCTAGCTTTGGATGACTTTATAGAATTCGGTATGTAGATGAGCAGTTTTTGAGGATTTGTTTTCTATAACACATGCTTAATGCTAGGCCTCCATTAACATCAATGTAATGGCCACGAAGCAACTATTGCTAGTCGACCCTGTACTGAAAAGGTTCGATGAAGTGTCCAAAGGTTATGAGACTCAGCTCCTTGTAGAGGCTGATTGAGGAGAAGCTAATGTATGACGCCGTTGGAACTATCGAATAATTTTGTATTAAAAGTTTGACATCATGCTTGTTCATA

CDS

>Mapoly0232s0001.2
ATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGAGCTGA

Protein

>Mapoly0232s0001.2
MLDAFVVTCHKQMIPWTDLGRVRCNNAHASFVHAITAHFEADRQLTCGMGMNKVQIGNGRTPTVFTPWTSHAPLEATSFVAESGTYSQPTYAHGGAGDSWPSFTFSPEQIDYRQAPVSVPESSPSTPPLLYDTVTLGPIIDCSGVADLILDKGSTPFFKDKEKETTPSARIILPAAAASVTGNATAIPPKLQLGPVATQNHASVATDCQRLLQLGKDDQVKKSDLLSAGANWEFSERVPPDPNRNQASTLDKEAKSKASTEQRKIATMHEGYLKNYKKDRLPNVVTLQKSDHMRRERDRRIALKLMYKTLDSMIPKPSKKSKRDRTAIVDDALKYVKGMQEKLEKFRLKGIGVKKISTISNRLLEPEHENLLACSPAELPSRLGKLTAATGAAREQGTEISVITSHDERLGSDSSLLMEPQVQVFIGCGNDVLISFSCKPRGNLISCVLQALEMFCLEVKQYTFSKILKELVHCNFMTKS

Mapoly0232s0001.3  

Gene structure:

mRNA scaffold_232:1..5151  ( + strand )
five_prime_UTR scaffold_232:1..768  ( + strand )
five_prime_UTR scaffold_232:859..3029  ( + strand )
CDS scaffold_232:3030..3986  ( + strand )
CDS scaffold_232:4397..4876  ( + strand )
CDS scaffold_232:4989..4994  ( + strand )
three_prime_UTR scaffold_232:4995..5151  ( + strand )

Sequences:

Gene

>Mapoly0232s0001.3
GGACGGCCCGACGATGCGCAAACGAGGGTCACATCTCGGGGAATCTATCTTCTCCGGAGCGCGAGGACGCCTCGCCTGCTCAGTCCGTTTCATTCGATCGCCCCCAACCCAACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTTCCTTCTCGTTCTCGCCATCCCACTCCACCGTACCCGTCCCTGCCCGTCCTTCTGCTGCTGAAAAAGGAAAAGGTTAGGTGGGAAGTACGATTTAATAGCAGTGGGCCCGGAATTGAGAATACCAAAAGCAGAGCACCGAAGAGGCCGTCCGTCGGACTGGGCAGAGCAGAGACGCACTGTGCGAGCGAGCGAGCGAGCGAGCGAACGAGAGCACTGTTCCAGTAGGTTGTACCTTGGGGGCTCGTACAGCATACACTACGTTCTCTCGTCTTGATCGTCGTAAAGCAGAGAGACTACTACCCTTTGGCGCTGTCTGGCTCTAGATCTGAACCTGCTCCCGCTGCAGTTCGATCTCGGGCTTCTACTGTGACATCGAGATGGTCAAGCTTAAAGACATGCTCTAGTCCGACTGTCATCTCGCTGCACGGACAAGCAAATACTGTCACAGAAGTACGGGCTCCCGAACTTCACGGGATTTATGACGAGCGACCAATCAATGACATCGGCATTTTCTCCCTGCACGTCAATCGATTTCTGACTCCAATCGGCTGCAGGCTCGGCTGCAGATCTCCTGGTTCACAGACGCCGACTCTCGAAAAGTGGCCAGCGGCTGATCCTCGAGTGTAAGTAAAGCACCAGCCCCCCAACCAGAGCTTCCTTTCCTGTATTGGCCAGCTGACATTGTGCAATACCGTCAACTTTCGCTCGTTCAGCAGGCGCAGGTTTTGACCAGCTAATCGTGGACGTGTGGACCGAGCGTAGAATATGCCGTTCCATGGCCCATTGCACCATAACTCTGCAGCCGACGTGACTAAGTTGGCGTTTGCAAACGGAGTCCGTCCGCCCGGCGTCGCCGTAATGGCGATGTTAGCTGCGAGCGAGGGATGCTGAGACCGGGGGAGTCCAATTAGAGGCCAATTAGGACCGTAGCTGCTGCAGTCGCGAGTACGTACGAGTCCGAGCATCAACATGACGCACGCAAAGCTAGCCCTGCAACCATCTTTTGCCTCTTATCTAGACGGAGCCCAGCAGTACAGTTGGCCGAGGCGTATGGAATCTGATCCGCTGTGCTCTGGGTCGGAAGAAGCCACGGAGTATCGCATCAGTGGAGGCCGGATTAGACTTTGACTGGAGAGGGCAAACTATCTTCTCGAAGTCTATCGAGACTTCGGCTCGGCCGCGAAGCTGAGCAGTGTGTAAGAACCGTACTTGATTGCAGAATCTTCTTCTGGATCAAGTCTGAGTTTCCGGAGCAAAATCTCAAAGCTGGACCTGTATGCCAATGTAACTCCTCTTACACTGTACTGCATCACTCGCACTCGATCTCGCTCTCGCTGATAAAGCTAGGGCAGACTTTGATAGTCAGACAAACCCCGCTATCCTCTAGCAAGAAACCTCAATCCGCAGACCAAAAAGAAATCGAGGGAGGTGAAAATTCCGTCCGATAATCCAGCGGCGGCTCCATCCATGGGGGATCGCCGAATTTGCACTGGTACACGCAACACTCCTGAAGAGGATAACTAATTCGGGACCGCTGTGGGCAGCCAAATTTTACTCATGTTTTGTTCTTGCGCATGGTTTGGATCGCTGAACGGAGGAGCGATTATCGAGTCTCACCCGTCGACAGCTTTGCTCACTTACCGCTGAAGATTTGCAATTATCAGTACATCACTGTAGAATTCGGAACGCATCGAAACGGCTGGTGGACTTCTCGTACCCGGAATCTGAAGACAGTGAGAAGTAAAACGCCCTGTGGCCTGAGCAGGACTCTGGACTGGGCTGGGCTTTATTGGACTTGAGTCCGGACTGCCACAGCGCTATGGTAGCCCGGCGCAGGATTATGGGCGGATGATCTGAACTGCTGAGGTTGACATGGTAGCATAGGAGCATAGGTACTGACTGTATGATTGAGCTCAGACGTCTTGCGCAGTACATGGCCGCCCGTCCGAAAATGAGAACATCTGCATCCGCGCTAAAGAACTGCCTTACCCTGATAGCCAGAAGCGACACCACAGCAAAGCACCGCATATGAAACCTTGAGGTATCATTACACGAGCGAGATAGAGATGGGAGCCAAACAGTCGTCACAGCGACGCTGCACGGACTGGAGTATAATGTATTTGGAAGCTCGTCCCACACTCGCTTGCTCACAGAATCGGCAGAGAGGACGTACGCCACGCCATCAGCTCTTCTGAGGAACCGTCCTCTTCTGAGGATGGTCTTCGCTGTGGGGATGTTTGGCCCTCGCCTTGTCGCCGGTGCCGACGATGTCAATCCGACGACCTACTCGCTCACTTTATGCATTATCAGCATGTACAAACATCCAACTTGACTTACTCAGGCTCAGCCAGGTTCTGAGCCCGAGAAATATCCCTTTTCACCAGTATGTTCGAAAGTTTCCCGGGTTCACCACATGGCTCCATCTGGAAATCCGCAAGAGGAACTCGCTCGGCTGACAGTCAGCGGCCGAGGGAAAGGGAAAGGCAAAAGCTCGGAACCCCCAGTGGCCATGATACTAGGGGCCAGGGTGAGGCATGTGCCACTCTTCTGCTCCTAAGTCTAGAGTGCACGCATATGGTCGCAGCCCAGTTCCCTCACCTCGAGGATCAAAACTAGCGGGAGTAAGTATCATGCAATTGCTCACGAGGCCCAGCCAGCACTTTGATAATGTTCTGTTGTCTGATTTAAAGCAGTAACTGTTAACGTGGACTCTCGCCCGAGGCCATTAGCAAAGCGGGAAACCTTCAGGCTCCAGGGGAGTAAGCACAGTACGAGAAGTAGAACTCGGACTTCTACTGCTCAGGTCAGCTCTGTACAGCTGAAGGGTTTGAAGCTGCAAGCCCTGGATGCGGATTAACAGGCATTAGGTATCCGTTTGCTGCGCATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAGTAAGTTCCCCTGTACATTTTTCAAGCTCATTTGGTTTCCTTACAGAATCTTTACACATACTGATTTGGCGGATTGCGTACTGTCGACCACATAAAAGCGGATCTGAAGCCCTGCTTAGCACTCATGCGAATGACTCAGAGCCGTGAGAAAATATGCCTCTTGGAAACTGGAGGATTGTGATGCGCATATTGCGTCAATAGAAATCAAGCTCTAGTGCTTGTTCACAATCAGTATGCAAGGATGACAGAAGTTGCGGTTCTGATAACATCTTACTCTGTAGTCAGGTTTATATGCTCCTTTTCGCGACATTGTCCACATGATATTCTCACACGAAATACACAGAGTGTGGCATCTCCTACTGGGCAGTCGAATTTTGTATCGACAAACTAACAAGTTCAAGTTTTTACAGAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGGTACCGACACAAATCCATGATCCAGTGTTGACGAACTTCTTCGATTTCTTTCAAGAATGTCTTCTTCCTGGTAACACTGATTGATGAATTGAACACAAATTTTGAAATGTAGAGCTGAGGTCTACAACAAAACCAACTTTCGCTTCGTTGTAACGATTGGCTAGCTTTTGAGCATGTATCCTCCGCCAGGAAGGTTATAGCGGCTGTCTTTGCAGCTCCAGTGTAAGAATCTTAGACTCCAGTACTTAGAGGCTATTGAGCAGTATGCCGTCTGC

mRNA

>Mapoly0232s0001.3
GGACGGCCCGACGATGCGCAAACGAGGGTCACATCTCGGGGAATCTATCTTCTCCGGAGCGCGAGGACGCCTCGCCTGCTCAGTCCGTTTCATTCGATCGCCCCCAACCCAACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTTCCTTCTCGTTCTCGCCATCCCACTCCACCGTACCCGTCCCTGCCCGTCCTTCTGCTGCTGAAAAAGGAAAAGGTTAGGTGGGAAGTACGATTTAATAGCAGTGGGCCCGGAATTGAGAATACCAAAAGCAGAGCACCGAAGAGGCCGTCCGTCGGACTGGGCAGAGCAGAGACGCACTGTGCGAGCGAGCGAGCGAGCGAGCGAACGAGAGCACTGTTCCAGTAGGTTGTACCTTGGGGGCTCGTACAGCATACACTACGTTCTCTCGTCTTGATCGTCGTAAAGCAGAGAGACTACTACCCTTTGGCGCTGTCTGGCTCTAGATCTGAACCTGCTCCCGCTGCAGTTCGATCTCGGGCTTCTACTGTGACATCGAGATGGTCAAGCTTAAAGACATGCTCTAGTCCGACTGTCATCTCGCTGCACGGACAAGCAAATACTGTCACAGAAGTACGGGCTCCCGAACTTCACGGGATTTATGACGAGCGACCAATCAATGACATCGGCATTTTCTCCCTGCACGTCAATCGATTTCTGACTCCAATCGGCTGCAGGCTCGGCTGCAGATCTCCTGGTTCACAGACGCCGACTCTCGAAAAGTGGCCAGCGGCTGATCCTCGAGTCAGGCGCAGGTTTTGACCAGCTAATCGTGGACGTGTGGACCGAGCGTAGAATATGCCGTTCCATGGCCCATTGCACCATAACTCTGCAGCCGACGTGACTAAGTTGGCGTTTGCAAACGGAGTCCGTCCGCCCGGCGTCGCCGTAATGGCGATGTTAGCTGCGAGCGAGGGATGCTGAGACCGGGGGAGTCCAATTAGAGGCCAATTAGGACCGTAGCTGCTGCAGTCGCGAGTACGTACGAGTCCGAGCATCAACATGACGCACGCAAAGCTAGCCCTGCAACCATCTTTTGCCTCTTATCTAGACGGAGCCCAGCAGTACAGTTGGCCGAGGCGTATGGAATCTGATCCGCTGTGCTCTGGGTCGGAAGAAGCCACGGAGTATCGCATCAGTGGAGGCCGGATTAGACTTTGACTGGAGAGGGCAAACTATCTTCTCGAAGTCTATCGAGACTTCGGCTCGGCCGCGAAGCTGAGCAGTGTGTAAGAACCGTACTTGATTGCAGAATCTTCTTCTGGATCAAGTCTGAGTTTCCGGAGCAAAATCTCAAAGCTGGACCTGTATGCCAATGTAACTCCTCTTACACTGTACTGCATCACTCGCACTCGATCTCGCTCTCGCTGATAAAGCTAGGGCAGACTTTGATAGTCAGACAAACCCCGCTATCCTCTAGCAAGAAACCTCAATCCGCAGACCAAAAAGAAATCGAGGGAGGTGAAAATTCCGTCCGATAATCCAGCGGCGGCTCCATCCATGGGGGATCGCCGAATTTGCACTGGTACACGCAACACTCCTGAAGAGGATAACTAATTCGGGACCGCTGTGGGCAGCCAAATTTTACTCATGTTTTGTTCTTGCGCATGGTTTGGATCGCTGAACGGAGGAGCGATTATCGAGTCTCACCCGTCGACAGCTTTGCTCACTTACCGCTGAAGATTTGCAATTATCAGTACATCACTGTAGAATTCGGAACGCATCGAAACGGCTGGTGGACTTCTCGTACCCGGAATCTGAAGACAGTGAGAAGTAAAACGCCCTGTGGCCTGAGCAGGACTCTGGACTGGGCTGGGCTTTATTGGACTTGAGTCCGGACTGCCACAGCGCTATGGTAGCCCGGCGCAGGATTATGGGCGGATGATCTGAACTGCTGAGGTTGACATGGTAGCATAGGAGCATAGGTACTGACTGTATGATTGAGCTCAGACGTCTTGCGCAGTACATGGCCGCCCGTCCGAAAATGAGAACATCTGCATCCGCGCTAAAGAACTGCCTTACCCTGATAGCCAGAAGCGACACCACAGCAAAGCACCGCATATGAAACCTTGAGGTATCATTACACGAGCGAGATAGAGATGGGAGCCAAACAGTCGTCACAGCGACGCTGCACGGACTGGAGTATAATGTATTTGGAAGCTCGTCCCACACTCGCTTGCTCACAGAATCGGCAGAGAGGACGTACGCCACGCCATCAGCTCTTCTGAGGAACCGTCCTCTTCTGAGGATGGTCTTCGCTGTGGGGATGTTTGGCCCTCGCCTTGTCGCCGGTGCCGACGATGTCAATCCGACGACCTACTCGCTCACTTTATGCATTATCAGCATGTACAAACATCCAACTTGACTTACTCAGGCTCAGCCAGGTTCTGAGCCCGAGAAATATCCCTTTTCACCAGTATGTTCGAAAGTTTCCCGGGTTCACCACATGGCTCCATCTGGAAATCCGCAAGAGGAACTCGCTCGGCTGACAGTCAGCGGCCGAGGGAAAGGGAAAGGCAAAAGCTCGGAACCCCCAGTGGCCATGATACTAGGGGCCAGGGTGAGGCATGTGCCACTCTTCTGCTCCTAAGTCTAGAGTGCACGCATATGGTCGCAGCCCAGTTCCCTCACCTCGAGGATCAAAACTAGCGGGAGTAAGTATCATGCAATTGCTCACGAGGCCCAGCCAGCACTTTGATAATGTTCTGTTGTCTGATTTAAAGCAGTAACTGTTAACGTGGACTCTCGCCCGAGGCCATTAGCAAAGCGGGAAACCTTCAGGCTCCAGGGGAGTAAGCACAGTACGAGAAGTAGAACTCGGACTTCTACTGCTCAGGTCAGCTCTGTACAGCTGAAGGGTTTGAAGCTGCAAGCCCTGGATGCGGATTAACAGGCATTAGGTATCCGTTTGCTGCGCATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGAGCTGAGGTCTACAACAAAACCAACTTTCGCTTCGTTGTAACGATTGGCTAGCTTTTGAGCATGTATCCTCCGCCAGGAAGGTTATAGCGGCTGTCTTTGCAGCTCCAGTGTAAGAATCTTAGACTCCAGTACTTAGAGGCTATTGAGCAGTATGCCGTCTGC

CDS

>Mapoly0232s0001.3
ATGCTCGACGCTTTCGTCGTTACATGCCACAAGCAAATGATCCCATGGACAGACCTCGGTCGAGTCAGGTGCAACAATGCGCATGCCAGCTTTGTGCATGCTATCACTGCTCACTTCGAAGCGGACCGTCAGTTGACATGTGGGATGGGGATGAATAAAGTCCAAATAGGCAATGGGCGTACTCCGACAGTGTTCACGCCCTGGACAAGTCATGCTCCTCTGGAAGCTACATCCTTCGTGGCCGAGTCCGGGACTTACTCGCAGCCAACGTACGCTCATGGAGGGGCAGGAGATTCGTGGCCTTCTTTCACCTTCTCCCCTGAGCAGATTGATTATCGACAGGCACCAGTATCCGTCCCAGAATCTTCACCCTCCACTCCTCCGCTCCTGTATGATACGGTCACCCTTGGACCGATCATTGACTGCTCCGGAGTGGCTGATCTGATTTTGGACAAAGGTTCTACGCCATTTTTCAAGGACAAAGAGAAGGAGACCACGCCGTCTGCTCGCATTATTTTGCCTGCAGCAGCTGCTTCTGTGACGGGTAACGCTACAGCCATACCTCCGAAACTGCAGCTCGGTCCTGTTGCTACGCAGAATCACGCGAGCGTGGCCACAGATTGCCAGCGCCTGCTGCAATTGGGGAAAGACGATCAGGTGAAGAAATCAGATTTATTATCTGCCGGTGCGAATTGGGAGTTCTCCGAGAGAGTTCCGCCCGACCCGAATCGGAACCAAGCTAGCACTCTCGATAAAGAGGCTAAATCAAAAGCTTCTACTGAGCAGAGGAAGATCGCAACGATGCATGAAGGATACCTTAAAAACTACAAGAAGGATCGACTTCCGAACGTGGTTACCTTACAGAAGTCTGATCACATGCGGCGAGAACGAGACCGAAGGATAGCCCTGAAACTCATGTACAAAACCCTCGACTCCATGATACCGAAACCATCAAAAAAGTCGAAACGGGACAGGACGGCTATTGTGGACGACGCACTGAAATACGTTAAAGGGATGCAGGAAAAGCTCGAGAAGTTTCGATTAAAAGGCATTGGAGTGAAGAAAATTTCAACCATATCAAACAGACTGCTGGAACCTGAGCACGAAAACTTGCTGGCTTGTAGCCCTGCCGAGCTGCCCAGTCGCTTGGGAAAGCTGACAGCTGCCACAGGCGCCGCCCGTGAACAAGGAACAGAGATTTCAGTTATTACAAGCCATGACGAACGTTTGGGATCGGATTCTTCTTTGCTTATGGAGCCACAGGTCCAGGTATTCATCGGTTGTGGTAACGATGTACTGATCAGTTTTAGTTGTAAACCTCGAGGTAACTTGATAAGCTGCGTTCTGCAAGCCTTGGAAATGTTTTGCTTGGAGGTAAAGCAATACACCTTTTCTAAGATCCTTAAGGAACTCGTCCACTGCAACTTCATGACAAAGAGCTGA

Protein

>Mapoly0232s0001.3
MLDAFVVTCHKQMIPWTDLGRVRCNNAHASFVHAITAHFEADRQLTCGMGMNKVQIGNGRTPTVFTPWTSHAPLEATSFVAESGTYSQPTYAHGGAGDSWPSFTFSPEQIDYRQAPVSVPESSPSTPPLLYDTVTLGPIIDCSGVADLILDKGSTPFFKDKEKETTPSARIILPAAAASVTGNATAIPPKLQLGPVATQNHASVATDCQRLLQLGKDDQVKKSDLLSAGANWEFSERVPPDPNRNQASTLDKEAKSKASTEQRKIATMHEGYLKNYKKDRLPNVVTLQKSDHMRRERDRRIALKLMYKTLDSMIPKPSKKSKRDRTAIVDDALKYVKGMQEKLEKFRLKGIGVKKISTISNRLLEPEHENLLACSPAELPSRLGKLTAATGAAREQGTEISVITSHDERLGSDSSLLMEPQVQVFIGCGNDVLISFSCKPRGNLISCVLQALEMFCLEVKQYTFSKILKELVHCNFMTKS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>