Mapoly0250s0002



Description

MYB-LIKE DNA-BINDING PROTEIN MYB

Reference DB

Database ID Description
GO GO:0005215 Transporter activity
GO GO:0006810 Transport
GO GO:0016020 Membrane
OrthoMCL OG5_127030
PFAM PF00230 Major intrinsic protein
PANTHER PTHR10641 MYB-LIKE DNA-BINDING PROTEIN MYB
PANTHER PTHR10641:SF221

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB21 transcription factor, MYB Mapoly0250s0002.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0250s0002.1 scaffold_250:18888..27242  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0250s0002.1  

Gene structure:

mRNA scaffold_250:18888..27242  ( - strand )
three_prime_UTR scaffold_250:18888..19004  ( - strand )
three_prime_UTR scaffold_250:19116..19205  ( - strand )
three_prime_UTR scaffold_250:19516..19626  ( - strand )
CDS scaffold_250:19627..19651  ( - strand )
CDS scaffold_250:23106..23246  ( - strand )
CDS scaffold_250:23449..23854  ( - strand )
CDS scaffold_250:26001..26103  ( - strand )
CDS scaffold_250:26207..26301  ( - strand )
CDS scaffold_250:26426..26496  ( - strand )
CDS scaffold_250:26991..26997  ( - strand )
CDS scaffold_250:27116..27242  ( - strand )

Sequences:

Gene

>Mapoly0250s0002.1
ATGGAGGGATCCTCATCTTCGACAGTGCCAAAGTTGCCACTCAGGAGATGCCTCGAAGACATAAGCAATTCTAGCGGCCGAACCTGCCTTCTGAGGCAGTCGTGGATTTTCCCCTTGACGCAAAAGGGTAAGCACAATTTATTTCGCTCGCACTTACACTGCGTTCTGTTGTTGTCTCCATGTAGATCCAGATGACGCATGGTCTCTGAAGCCGAATATTCTTGTCGCTTCTGTGAATGTAACAGGAAGAAGGTGAGAGTTTATCGTGCTCCGCGACCAAGGAAGCCAATCATGTCGTGGAAGGCGGAAGAAGTGAGTCAAGCCTTGGCTGATACCTAATACTTGTTTAGCCTCTATGTAGACGAATCAGTCTTTGGAAAGTTTGAAGAATCGACAGGTCCAAAGTGGAGTCTGTCACGATTTTGATTCCATGATGTTCACGACCTTCAGAGGAAGCACTCGAGTTCCTCTAAGTATGAGTGATGATTTTGGTTCATATTGTTGATAATTTGTGCTTAGATTGGCGAGTACAACTTAAGGTAGATTCTTTGATTCATTATCAAGCTTAGTCATAGGATATATTTTTTGAGTCCGATATTTAACTTGCCCTGCACCATCTGTAGTATTTTTAAGTAGGATCTGGTTCTCTGACCACTCGTATTCAATGTAATATTTGATGAACATCCACAGGTGTTTGGAAGTGAATATCTGCAGTGACTGAGTTTTGCAATTTTAGTGAACCCAAGGCGACTGTCACAGGACGCAGCATTGCGAGCAGCAGTTGAGAAGTTCAAAGGCGGAAATGGGAAACAAATTGGTGAGTACACATGTACGAGTTTTTTTAGGTAAGTAGTTAACTACTTTGGTAATTTTTAACTGCTGTGACCACAACTCTTCTGTGTAAAATCTCAAGATATGTGTTGGAATGATGGCATGTGTAGCTGCGAAATTACCCAACCGGTCAGATGTTAAGTGCCTTCACCGCGGGCAGAAGGTCCTTGATCCTGCCCTCGTGAAAGGATACTGGACCAAAGAGGTAAGTGATTCTTATATAACCACGTATTGATTACAAGAGTGAGGTTCCCCAGATCCTACGTTTGAGAAATGTGATGATTGATAAAAGTAGCTAAATTTCGCAGGAGGATGATAAGTTGCTGGAATTGGTTAACACGTTCTGCACCAAGAGATGGCTGCCATCGCTCGGTCATTGCCTAGTAGAAATGGCAAGCAGTGTCGAGAGAGGTGCGTATCAAATATGTGGTGATTCTTATGTTCCGACACTGAATACCCTCTATAGTCTCATAAACCATCAATAGGTGATGGTAATGCTGCTAATCATGGTATTTTGAGTGGCATCTGTGAGTGTATATATAGTATAATTGTTTGTGATCTTTGTCCGAAGAAATTTGTTTTGTCGTGCAAACAGTAGCTTAAGAGAAAGTTATATCTCAATAACATAGTGTTAATCGTGCTGACATATTTCCACGAGCCGGAATAAATACAAGATGCGACATAGTTAACCACTATTAAAACATGTAAATTTTGAATTTTGAATTATGCATACAATGATTCAAGTGGGCTTTTCTGCAAAATGTGAGAACTAAAATATTTACTAATTTATTGCTTTATATTGGAAAATTTTGTGTCAACGTGTTACAAATGTTTTCTAGCAATCTTCTTAATGCTTATATGACATGTAAACATCGAAAACGGTATCGAGAAAAGATGTAACATAGCAGTGAAAGAAAGGGAGTATGCACTTGAACAATAATGACAACTGGATGAACAGCAACCAATTAGATAGGTTGCTGGATATGTTATACCTTACTATGTGGCTCCATCATACCTTGACGCTTCTCAATCTCTTCTGGAATTGAATGGCGAGGCCAATGTCTACCTTCAGTACTTGAATGCTGAGGAGGATCTTCTGGCATTGAACAGCGAGTTCGGAGCGGATGAGTTTGACATGGATGACAGAAACTCCCAGACTTTGACTCCTCCCTTTGATGGCAAGTTTTTTACAGTTTGAGGATGAACTGTAAAAAACTTGACATCAAAGGGAGAAGTCAAAGTCTGGGCATTCTTGGGTTGTGCCCTTTGTGTAGTGGGTGTGTGGGTTTGAAAAAGCTTGGCTAACAGAAGCTGTGATTTTTACTCATAAGATTTTCTGTGACTTGTTGTTTTAGATCGAGCTTCTTTAATTGATATTTTATAAAATTGCAATTAAATCCAATAATAGGCCCTATATTTTACAGACTCATATAGAAGTAACAGTAGAATAGTGTAGATTGTCATGAAAATTTATGTTTTCTTCAAGAAAAATAATTCTGACTTTTTTTTGTAATTCGACACGGAAATGCACTTACATTTCTGTGATTTCAGTCGATTGCTTCGACCCGTCACTATATTGCTCTAGAACGCGAGCTTTTGATTTTCATAATGTTTGAGACTTTTATTCAACACCCAACGCTATTTCTCAAGTTTGTGTTGCAATAGTCAGTAAGTATAATATAAATTGCAATCTCGCAATTTACTACCCTTGTGAAGGACAAATGTGATGTAAGAATGCAACTACTGTAGTGTGTTATACTTTGCAGATTGTTGTGATAGACGCTGGGTATTGTAATTGTTGTGATAGATGCAAGGTTGTTCGATGAAATTGGAAGATGATTACAAATTTTTGGGCCGAGCATGCATACATACGAGACAGGATGTTTTGTTTTCACACACTGGATTATTAGCTAGGGAGGAACCTGCACATGGTCTAAGAAGTTGCCAAAAACTGCAAGTGGAGCGTTATTTTTGGCTCCCTTAAAATTTTGTTTATTCCAGATGATAAAAAAGCGTCCCGTGGGTCTGACCATGTGACGATTCCTTTCAATTGACTCAAACCTTATCGCGACCTCCATATTCACAACATCAGCAGGAGAGTCACAAGCATGTGCATGTGTGCAGGAGATTCTCTGCTCCATCGCTTCGTTCTGGTTGTAGCTACGAGCGTTTTGATGATGATTTTTTAGGTCATCTGCAGGTTCGTATCCCTAGTTAATAATCCAGTGTCTTGCGAAAAGACATTAGTTTTAGTATGTATGCTCGGTCCAAAAATTGAGAGTCATTTTTCAATATGATCAAATTTGAATTAACATCCCAACATCTATCCAGAACAATTACATTACCAACATCTATCCAGAACAATTATATTACCCAGCGTCTATCGCAGCTATTGTGATCAAAGTATTATATCTGCAAAACAAATAGAAGCTGAAATATTCTCATAGTGACTTCCATTGTTCATGGCTGTCATATATGGCAGTACTCTAATTAATTCTTTGCACTCTAATTAATTCATCTGTTCTTTACACATTAACAGTACACATTAACCTTGCAGTTACTTTGGGACAACTTTTGGGTAGCAAGCTTTTGGTTCCTCGGGCTTTCATCTACAAGGTTGCGCAAATGGCGGGAATTATCTGTGGAGCAGGACTCGTCAAGGATTGCCCAAAACTCCACTCCAGGTCGTGGGTGGTGCGACGAATACCATCAGTGCAGATTTCAACATCGGCACATGTCCAGCAGCAGAAATCATCGAAAATTTCTTACTGGTTTACGTGGCGAGGGGAGGAGAAATGGGGCATGGGGGAGCAAAAAAATACGAAGTACAAGTTCCCTGCGGGGAAGGGAGGCCGCGAGGGAAAGAGCCCAATGGTCGAGTGGGAGTGGGGCGAGCTAAAGCGGGAGGGCCTCCATGGTCGAAGCGGGAGGTCGGGATGCGGGCCCGGGCGGGCAGAGCTCGCGTTCCCCCTTTTCTGAGGAGCCTTTAGTGACGAGGATGTGCCGGTAGGTTCAAGAATCATCATATATGTGGATTCTTGAAGAGTGAATTCCCAGATGAATCCAAATGCAGCTTCTGAAACTGGGTCAGAGTCACATAAATCATGATGAACTGGTTCAAATGGAAGACGAGACTTAATGTCTGGAGGTGCTGTGATGTCCCAGGTGTTCGCCCCATTGCCCGTCGGGCTTGCAGTTTTCGTTGTCCATCTGGCGACCATTCTCATCACTGGCTGTGGAATCAACCCTGCACAAAGAGTCGGCCCGGCTGCTCTCTCGAACTACCAGCAAGTTTAAAATGACCAGGTGATTCATAGTATCTCAACCTATCACACTTAAATGTGTTATGTCAAACTCTTCCCATTGACCGAAATTCTCAGAAAATCCAAGATCCAGTCTCTCGCTCTCGCATGAACATTCTGCACGACAGCAGATGACAGGGCTTGTAATTTGGTACATCTGCTTTGAGCAGTGGATCTTCTGGGTTGGTCCCTTCATCGGAGCTACCTTGGCTGCCACCTATCACCAGTTCGTCATCCGTGCTTTGACGCTAGTATCACACTTCCTGTTCCCGCTCATTCCATGTCCGGGCCCATGAGTATTTCAGGGAGAAAACTTGAGAACAAGGTCTCAGGGTGAGCTTGTTCGAAAATACTAAGGACAGTAAATCTGCTGACAAAAAAATTTGAAGCTCCGGCTCATATACTGATCTCGAGCTGCACATACCACTGTACTGTAAATAACAACGAATAGGTTCTTATACATAGCTGGGGAGAAATTACATAGCGCTGAAGATTCAGCAAAAAGGGTAAAACCTGAAATCATCTATTGCAGAGGACTAGGATTACCATCCGCAATTACGGATGGTAATCGAAGAAGTAATCTCAGATTGTGATCAACACCAGCTATCACATTAAGGTCAAGCATGGAGTCAAGTAGAGGCTGATGATAGATCAGTACAGCTTCTAGACATGACTTGGCATCATGGTTGTTCGAGTATCGCGTTGACACTAAACCGACAATTTTCGATGAAATGATCTAAGTAGGATAGATATCGAAATCCTCTCCACATAACTGTCCACGTCAGGAGCTGGTAGTCGATTTCTGATGAACTGGTTCAAATGGAAGACGAGACTTAATGTCTGGAGGTGCTGTGATGTCCCAGGTGTTCGCCCCATTGCCCGTCGGGCTTGCAGTTTTCGTTGTCCATCTGGCGACCATTCTCATCACTGGCTGTGGAATCAACCCTGCACAAAGAGTCGGCCCGGCTGCTCTCTCGAACTACCAGCAAGTTTAAAATGACCAGGTGATTCATAGTATCTCAACCTATCACACTTAAATGTGTTATGTCAAACTCTTCCCATTGACCGAAATTCTCAGAAAATCCAAGATCCAGTCTCTCGCTCTCGCATGAACATTCTGCACGACAGCAGATGACAGGGCTTGTAATTTGGTACATCTGCTTTGAGCAGTGGATCTTCTGGGTTGGTCCCTTCATCGGAGCTACCTTGGCTGCCACCTATCACCAGTTCGTCATCCGTGCTTTGACGCTAGTATCACACTTCCTGTTCCCGCTCATTCCATGTCCGGGCCCATGAGTATTTCAGGGAGAAAACTTGAGAACAAGGTCTCAGGGTGAGCTTGTTCGAAAATACTAAGGACAGTAAATCTGCTGACAAAAAAATTTGAAGCTCCGGCTCATATACTGATCTCGAGCTGCACATACCACTGTACTGTAAATAACAACGAATAGGTTCTTATACATAGCTGGGGAGAAATTACATAGCGCTGAAGATTCAGCAAAAAGGGTAAAACCTGAAATCATCTATTGCAGAGGACTAGGATTACCATCCGCAATTACGGATGGTAATCGAAGAAGTAATCTCAGATTGTGATCAACACCAGCTATCACATTAAGGTCAAGCATGGAGTCAAGTAGAGGCTGATGATAGATCAGTACAGCTTCTAGACATGACTTGGCATCATGGTTGTTCGAGTATCGCGTTGACACTAAACCGACAATTTTCGATGAAATGATCTAAGTAGGATAGATATCGAAATCCTCTCCACATAACTGTCCACGTCAGGAGCTGGTAGTCGATTTCAAGAAAAAGGTTACGTTAGCATAGTCACACGAAAGTATCTCAAGAAGGTCAACAGAAGAGAACCACACCTTCATCAGATGTAATAGGTGCTGTAGACCATAACCATGCCTGAAAGTTCTTCGTTCAGAAAACCATAATAGTAGTGGTGACCGTTTCATGCTTAAAGAGATCACAAGACACTATCCATAAGCCATTTATTGTCCACTGAATCTCATGTACAGACGTTGTGAGTAGCAGATTTTCTTCTCAGATCTATTCTCAATATTAGTCCAATCAAAGTTGAAAGTCAAAGCTGTGCCCAAGCGAGTACCCATTCAAGTTGAGGAGTAAAGATTGAGTTGACTTATTGCTGAATATCTTTATTGCCTCACTCTAGCCCAATCATCACAGCTGCGAGAAATTCATCGATCTCACCTTATATATCAAGACAATACTCTCATGTGGCGATCATCAGTCAAGTTATCAATCTCGTCACTTATATTCGATACCAAGTTGAACCACATTCAGCAGACTGAGTAATTTCAAACCTTTTTCAGTCTCGTCCTCAGAACCTCTGCGATACACATCAAGGTATACAATCATCGGCCTCTCAGAGATTCGCAAAGAGGCCTTATGCACCGATGCCAAGTCGTAGCTAGTCTACATTATTTTAGAAATCACCCAATACCCTAACCTCAATCTTAGAGAAGACTCAGAAAAGTTACAATGGAAAACCTTCCAGAGGGCTTTATAAGCCTTCAATCTTATGATTGGTTCTTCTGTATACTACTAGAACTTAGAGAAGGTGTACCCATCTTTAACAACAGGAACACATGCTCTGGGCCCTTCTTCTTCTATTACTTTCCTGCTGTACGTGCTTTCTTTCGTCATTTCCTTATCCTTTACTCTGGCGTAAATTTCTTATTCCTTGTTCCGTGAGACATGATATATAATCTAGGAAGATGCAAGAATTCAGGTAGAATATGGATAATTAGGTGTATTTATCTGGCTTCACCGTGATCCTATCCACTTTGCCAACAGTGAAGTATGCACCCGGTTAAAATTAGAGATTCTCTTCACTGTCTCTTCGAAAATCGGTTACTTTCTATTACATGGACACCTTGAGAAGAATGGTGTAGGACGTTCCCCCAGACTATATTCGCCTACAAAAGAATATTGCAAACGGAAACTTACAACAAAAATATTTGTGAGACATTAGGATCTGTCCGTGATTTGCTGTTCTTATATTATCTTGTCGAGAAGTCAATCCAGTCTTGACAAAGGCTTGTTATCTTCTCTAGATGTTGTCTACTTGTATATTTATGTATATTTATGTGTCTTATATTATACGTAAATGAAGATTTAAAGCATCAGCAAAACATGTCCAAGATTTCAGAAAGATAAAGAATTTCTTCCCTGTCAGGAGGCCTCGAGACAAAGATCTCCCCTGCTCGAGATATGTGCTTTACAGTTGGTCATTCATGCCTAATGGCCCCATGTGGGGTCATAGTCGGAGACATATAAAACATCAGAGAATCTCATACATAAAATATATATCTTTGATACTCGATGCGTCTTACATCGAGGATCAAACATTTTCGATTCGTTTCGTTTCGGATTCATTAATCTATCGATGTCTTGATGACTTGTGCCTCTGGCATCATAAAATATTGCAGGATGCTAGCTTCTTCAGTAAAGTGAATCAGTCACGTCTTGCATAGCGCGTTATACATACGGCTTACATCTCCACCCCAGACAAAGACCAAAGGCACGAGACCAAATTCTGATCCACCAAATCTGGAAAGTATATGAGTAAGTTCAGTATCTATCGAGTCCCATGACACTAGTGAGCTCTGGCATACGAAATCAATAGATAAAATTAAAGGCCGTGATAAGGATGCTTTTGCATATTCCAAGAACTAAGGTATCTTGGTGGTTAGAATAAGATCTTTTAAAAAAATTATTTTATCAAGATTCTTATTTAGATTTAAACTTTAAATAAGAATATTCATAATATCAGCTTTTACTAACATTGATTACTTTGAGTATTTGGACTACCTGGAATTCCAAAGGTGAGATCCTGTATGCTTCTCTAAGTATTTGGGTGGTTTTTTGTGGAAAGGACGCAGCTATGTTTTGAGGTCCTTTCTTGTCTTTCTAACCGCCGAGAACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTAAGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATTGTTCAGATTTCATCCGGTCATGTTCTTCACAATCTTTATTGCTTGCTGAGGTTTTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGACTAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACGTAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAAGCACCG

mRNA

>Mapoly0250s0002.1
ATGGAGGGATCCTCATCTTCGACAGTGCCAAAGTTGCCACTCAGGAGATGCCTCGAAGACATAAGCAATTCTAGCGGCCGAACCTGCCTTCTGAGGCAGTCGTGGATTTTCCCCTTGACGCAAAAGGGAAGAAGGCGACTGTCACAGGACGCAGCATTGCGAGCAGCAGTTGAGAAGTTCAAAGGCGGAAATGGGAAACAAATTGCTGCGAAATTACCCAACCGGTCAGATGTTAAGTGCCTTCACCGCGGGCAGAAGGTCCTTGATCCTGCCCTCGTGAAAGGATACTGGACCAAAGAGGAGGATGATAAGTTGCTGGAATTGGTTAACACGTTCTGCACCAAGAGATGGCTGCCATCGCTCGGTCATTGCCTAGTAGAAATGGCAAGCAGTGTCGAGAGAGTTACTTTGGGACAACTTTTGGGTAGCAAGCTTTTGGTTCCTCGGGCTTTCATCTACAAGGTTGCGCAAATGGCGGGAATTATCTGTGGAGCAGGACTCGTCAAGGATTGCCCAAAACTCCACTCCAGGTCGTGGGTGGTGCGACGAATACCATCAGTGCAGATTTCAACATCGGCACATGTCCAGCAGCAGAAATCATCGAAAATTTCTTACTGGTTTACGTGGCGAGGGGAGGAGAAATGGGGCATGGGGGAGCAAAAAAATACGAAGTACAAGTTCCCTGCGGGGAAGGGAGGCCGCGAGGGAAAGAGCCCAATGGTCGAGTGGGAGTGGGGCGAGCTAAAGCGGGAGGGCCTCCATGGTCGAAGCGGGAGGTCGGGATGCGGGCCCGGGCGGGCAGAGCTCGCGTGTTCGCCCCATTGCCCGTCGGGCTTGCAGTTTTCGTTGTCCATCTGGCGACCATTCTCATCACTGGCTGTGGAATCAACCCTGCACAAAGAGTCGGCCCGGCTGCTCTCTCGAACTACCAGCAAGTTTAAAATGACCAGGATGCTAGCTTCTTCAGTAAAGTGAATCAGTCACGTCTTGCATAGCGCGTTATACATACGGCTTACATCTCCACCCCAGACAAAGACCAAAGGCACGAGACCAAATTCTGATCCACCAAATCTGGAAAGTATATGAGACGCAGCTATGTTTTGAGGTCCTTTCTTGTCTTTCTAACCGCCGAGAACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGACTAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACGTAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAAGCACCG

CDS

>Mapoly0250s0002.1
ATGGAGGGATCCTCATCTTCGACAGTGCCAAAGTTGCCACTCAGGAGATGCCTCGAAGACATAAGCAATTCTAGCGGCCGAACCTGCCTTCTGAGGCAGTCGTGGATTTTCCCCTTGACGCAAAAGGGAAGAAGGCGACTGTCACAGGACGCAGCATTGCGAGCAGCAGTTGAGAAGTTCAAAGGCGGAAATGGGAAACAAATTGCTGCGAAATTACCCAACCGGTCAGATGTTAAGTGCCTTCACCGCGGGCAGAAGGTCCTTGATCCTGCCCTCGTGAAAGGATACTGGACCAAAGAGGAGGATGATAAGTTGCTGGAATTGGTTAACACGTTCTGCACCAAGAGATGGCTGCCATCGCTCGGTCATTGCCTAGTAGAAATGGCAAGCAGTGTCGAGAGAGTTACTTTGGGACAACTTTTGGGTAGCAAGCTTTTGGTTCCTCGGGCTTTCATCTACAAGGTTGCGCAAATGGCGGGAATTATCTGTGGAGCAGGACTCGTCAAGGATTGCCCAAAACTCCACTCCAGGTCGTGGGTGGTGCGACGAATACCATCAGTGCAGATTTCAACATCGGCACATGTCCAGCAGCAGAAATCATCGAAAATTTCTTACTGGTTTACGTGGCGAGGGGAGGAGAAATGGGGCATGGGGGAGCAAAAAAATACGAAGTACAAGTTCCCTGCGGGGAAGGGAGGCCGCGAGGGAAAGAGCCCAATGGTCGAGTGGGAGTGGGGCGAGCTAAAGCGGGAGGGCCTCCATGGTCGAAGCGGGAGGTCGGGATGCGGGCCCGGGCGGGCAGAGCTCGCGTGTTCGCCCCATTGCCCGTCGGGCTTGCAGTTTTCGTTGTCCATCTGGCGACCATTCTCATCACTGGCTGTGGAATCAACCCTGCACAAAGAGTCGGCCCGGCTGCTCTCTCGAACTACCAGCAAGTTTAAAATGACCAGGATGCTAGCTTCTTCAGTAAAGTGA

Protein

>Mapoly0250s0002.1
MEGSSSSTVPKLPLRRCLEDISNSSGRTCLLRQSWIFPLTQKGRRRLSQDAALRAAVEKFKGGNGKQIAAKLPNRSDVKCLHRGQKVLDPALVKGYWTKEEDDKLLELVNTFCTKRWLPSLGHCLVEMASSVERVTLGQLLGSKLLVPRAFIYKVAQMAGIICGAGLVKDCPKLHSRSWVVRRIPSVQISTSAHVQQQKSSKISYWFTWRGEEKWGMGEQKNTKYKFPAGKGGREGKSPMVEWEWGELKREGLHGRSGRSGCGPGRAELACSPHCPSGLQFSLSIWRPFSSLAVESTLHKESARLLSRTTSKFKMTRMLASSVK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>