Mapoly0474s0001



Description

B3 DNA binding domain

Reference DB

Database ID Description
GO GO:0003677 DNA binding
PFAM PF02362 B3 DNA binding domain
PANTHER PTHR31140 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpB3-8 transcription factor, B3 Mapoly0474s0001.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0474s0001.1 scaffold_474:2721..10194  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0474s0001.2 scaffold_474:1579..10521  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0474s0001.3 scaffold_474:1579..10521  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0474s0001.4 scaffold_474:1580..9769  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0474s0001.1  

Gene structure:

mRNA scaffold_474:2721..10194  ( - strand )
CDS scaffold_474:2721..3272  ( - strand )
CDS scaffold_474:3664..3737  ( - strand )
CDS scaffold_474:3976..4022  ( - strand )
CDS scaffold_474:4232..4332  ( - strand )
CDS scaffold_474:4884..4988  ( - strand )
CDS scaffold_474:5361..6746  ( - strand )
five_prime_UTR scaffold_474:6747..6801  ( - strand )
five_prime_UTR scaffold_474:9835..10194  ( - strand )

Sequences:

Gene

>Mapoly0474s0001.1
ACGTAAGACGTGAGATAGCGCACGAGACGAGAGGAAAAGATCGATTGAGCGCGAGCGCAGACGAGGCAAGCCGAAGAAGAAGAAGAAGAAGAAGGAAGAAGAGAGACAGTGCTTGATAGAGTGATAGAAGCCCGCTCGGGACCGAGGCAGGGTCCACGAGGCCGAGGAGCGGTACCATGATACCAGCTCGTCGATGCTCGCAGTTGGGCTCGAAAAGAACCCTCCTCATCCACCAAGGGCCGGGCGCTCAAAAGATGAAAGAGTAGCGCCACTGGGCCCGACTGGATCTCGACCCAGGCCACTGGACGAGAAGAGGTCTTCGCGTAGCTTGCTCGGATACTTGACGGCCTATCTGCACAGGTTGCTCTACCTCCTCGTCCCCGGCCTGGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTGTGCACCTCGTCGCTCGTCTCGCTCGTCTGACCTCCGTCAAGCGACGCACCTCTCGTAGGATCTGAGAAAAAGGCTTCTGTCAGCCACCTTCTGTACATAAGTCGGACCCCCTCCGGGTCCATCTCCTGCGGTCGGACTGCACTCGTCGTGTGGTGTAAAATAAACCTCTCTCTCTCTCGTCCTCTCTCTCGACGCTTAAACCGCTCCCCCGGCGAGTCACGGGTGCGTCTCGTCGACTTCGCGCGCTATCATCGATATCAGAAGCTTGTTTTGGCGCACTCTGAACACTCGCTCGTCTCTGGAGGAAGTCGGCACGAGCGAGTGGCTTATATAGGTTGGATTTGAAGTTCCCCCGCTTGCTGGTTTGTCTGGCAATTGCTCGCTTCGCACTTCCTTCGTTCCTTCATTCAATCTTCGTGAGTTTTCATTGTTGCAGTGCACGTAGACAATTGTGGACTTCTCCACCTCCTCCTCGCTCCTCGGACAAGCTTTTTGCCCGCGGAATGTCACGACTTCCACCTTCCAGCTAGTGTTAGGGTTCTCGAACATATCAAGAGTGTTGAAAGTCAGTACAATCTCCGAGTTTCCCCGTCCAGTATTCAAGACGCCCGGATGTGCCTGGCGAAACCCGACGATCAAAAGACAAACACACTCTTTGCCTCTTTGCAACTTGGCCGGAACTGAGCCAGTCAACTTGCCGTCAGAAGTTGCAATTGCCGCCACGTCTTGCTTCCATAGTTTCTTGAGAAGCCTTGGTCAGCATCATGGAGGAATTACTCCAGTCTTCGAATCCGAAGAAACTGCTACCACCACTGTTTCGACTGCAAACCCACCATTGCAGAAAAAAATGTCAATGAGCAGGTCATTCCGCACTGACTCGATCGTGCTGCTTGAGTCCGAGTCCGCGACTTCGACAGCGTCACCGGCTTTTGAACTTACTCTGATCATGAAATGTGTTTTGTAGATTCCGAAGTGGGCAACTGTCTCTCTGATTGGACGTTGTGACGCTTGTTCTCGATCAACATTTCTTCTGGATAGCATACTGCCAATATTACCACATGAATGTGCATTACCGCAAGCGCATGCATGTGCAGCTCTACGGGGTATGTGATCATGCCTGAAAGCCCTCGCCGATCGTTCACTCTGAGCAAATGGAAGCCTTGGTCAAATTTTTTCCTTCCAGAAGATAGATCTTAAGGACTTGAAGATTCGTGCAGATTGGTAGCACTACACTTGGGTGTAATTGAACATGTGGGAAGGCTTGCTCCGACGACCTCGATGGCTGGACCTCGGAATTGATAAAATTAATGACATGTAGGCTGAGATACATGCGCAAGGCCAATCACCTAACATACCTGGTTGGTGCAATTGTGCAGATCCTGCACATGTAGCCACTTCTTTAGTCAACAGTCGAGTATCAAGATCTGTGAACTATGTCATCGCTTTGCCACTCGACGACTCGACTAGCTAGCTTCATCAGGTAAGCCTGTGTGACCTTCCTGTCCCCGTTGATCAATGCCTGAGTAGTTCGCGGGTAGCATGACCGGCTGGTAAATAGATTCGGAGCCTCGACGCTCCGCTAGCGAGTCCCAGGCCCTTACGAGAGCAAGCATCGCAGGATGTGTTTTCGTCTTCGTTTCGGATGCAGGCTCCCGTGTTTCACGTCTGATATCTTCTCTCAGCAAGGCTTTCCTCGCCATTACGGCGTGGTGCGGGAACAGACATACTCGTGTGGGCTCATCCGAGAAAATAAAATACCGCGGCCATCCTGTCCACGGTTCTCGTGCGATTTAGTCTAGGTTTATTTTTTCTTTTTTCTGGGTACATTGAAACGCAGTACGAAACCATTCAACATGAGCTGAGTTGCTCCAGTGAGAGCCATTACTTTTGCAGTCCCATATTGAGCTCACATTATTGCCGGGTGTGAGAGAATGATGAAGTCCCCGGCTGGCACACGTGCGCGCACTTCGATCGAATGTGGCCATCCTTTCGGAATACAGACGTGCGCTACTCCTGAACTCTTGGAGTAACAATCTCCGTCACTATCTTTAGCTGTTGTGTTGTGCGTGGGGGAAGTATATCTCATTGTTGTACCTGGTCACAGACCCGTAATCGTAGATTGAGCCGCAGCGTCGAAGAAGTAGGCAGGTGCTTGAATTCTAATCTCTAGTTTTCTGTATTTAAACGAGCAATCATAGCCTCAGCTAAATGACTCGATTGAAGAGTGGACATGTCAGCGACAGCCTTTGCATTGCATGCATCCGGCGTGCGTTACGAAATGCATTCCCACCATTAGCCTTGAGGAGATGGCGAAATCCAAGCCAAAGCTTCGCCGCTGCTACTTGACAGACGCTGCCTGTTCTCTATACTCCGTTGTCCCTGGGACTTGAAATTGGAACTTTCGGTAGTATGGGAAGCGTATTAAATGAGTTTAATTTTTCCCTCAACTTCGCTACCCATGAATGCGAAGCAAACTGCTGGGACCTATTTCGTTGCGTGCCCGTCTGCAATCCGCGCGCAACAATTTCGCCGACGCTTGAAGATCTGGTTATAGAACTCAAGCGCAGAGCGCATCAAGCAAGTCGCGAGGCGTACAACGTGGGATTGTTCTTGTGTTCGCACTGTTGATCGTGTCTAGATCTCATGAGTGAGTCTCGTGACTGTTGACATAGAAACACCATGAACGTGCTCGAGTCGGAGCAAAGCTGAGTTCCATCAGCAACTGTAGCAGAAGTTTTCGGGGGGAATGATTGTTTCCTTGGTACCCTAAAGTCATGACCCGAGGCATGGAAGGAAGGAAGGAAGGATGGGTGAATGATGTCCGCGTGAAAGGCCTTTGTTTGTTTATCTGAACAACTGTCATACTTCTTTTCTTTGACTTTTGTATGCTATTTCTGATGCGCTCAGGTCAACCTCCGAAACGAGCACAGTGGCTGCAATCTCTTATATTCAAATTTTTTGTTTGTTGCAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTAGAGCTCAACCTTTAACTCTTCCAATTTAAGACGTGGCCTTCGTTTTCCGAATTGAATGTAAATTCGATTTTTTCCGTCTACCATGTTCAGGATTGAGTGAACTTTCAGAAAGAGAGGAGAGACTTTAGATAATGCAGTGATTCTGCTTGTAAGCAGTACGTCAAATTATGACCTTTAGAGTTTGTGGGCTTTCACAACGACCGATTCCTTGTGAGGCGAATTAAAAACCATGTGTACGGTCGGAAAACTGCTCACGTTGATATCTAGAATATAATTTCACTTAGATACATGGTTGTGTTCATGTTCGGCTCTGTGAATTGGGCTGAATTCGATAGTTTGGGACATCCCAAGCATGTTCTGAATTTGCAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGGTGAGATGCCCGTCTTACATAGGTTTTGAGGGCGGACTCAGAGTCCCTGTTCGTGAGGTATCACTGTTATCACTGGACTCCTCAGTATCTGCTTTCAATTTCAAGTGTAAGACCCGGTTGATGTCAATTGGATAGAGATTTTTACGGCATGGCGTGTATTATTCGGAAGGTATGGCGGAAAGTAGTACACTGCTTTTTGACATAAGCTCTTCAATTGCCTTTGAATGATTTCTGATTGTCATCGAAGAACAAGTATAAAGAAATCAGATGTCTGGGTGGCTGGGGACTATACGTGGCAACTGCCTGCCACTTTTTTTTGTCCGTATGGCAATGCCGTGGCCAATGTCCCAATTTTCTGTGGCTGCATGGTTGGTGAAAGCGTACACAAGGCATTAGTTGTAGATTAACTAGGTTCTTAGGCGTGTACATCAGTACTTGACTGTTCTGAGTAGGTGATGCCGGTAGTTGCTGATTTGATGCGATAGAATACAGCAAGACGTAGTCTACACGATCAACGATAACAATTTTTTATACCTATTGGCTGCCTGCAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTGCCTAAATCCTTCTTGTCTTCAATTCGTCATCGCTTTTGCAAGAGGCATGTTGCGTCTGCTATATTCAATGAAACGAGACATTGAGGCAATCATCGTGATCTGTACATGCTTGGACGACAAGAGAAACCAATCATCCACAATCGATGGACTCGGAGTGTTTGCTTCTTCTAAACTTAGCGCCGCAACGGCAATGTTTATGATTGCAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGTAAATTTCAAGCCTATTCTTTTGCTATATATCATGTGTCAGATTGAAGTCTATTGTTGTGAAATTGAAATTTGCATAGTAGAAATACGTAACGCGCCACCCTTGGATTTTGAGGCTATCATAGCGTGTACATCGAAAATTGGGCTTGTGGATCGACAATTCGCCAGTTGGTCAACATAGCTTGATTGATAACCACCGGCCTGTCTTTGATTTTGACATTTGCATCCTTTCACCGCAGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTAAGCACCGCTTTTACCAGATTCCAATTTTCTTCGTGCGATATGAATCTGAAATGTCTGAACTTAAAGCAGGAATTTCTTATTATCTTCGAATTTCGAGGCTCTGAGATATTCTACAGACGGTGATGAAACTCTTGCTGTAATTAGCCCCTCGCTAAGTGAGTCAGGAAACAAGATTGACGTGAAAGTGGCACAAAGTGATGGAATTTGGGTATGCTAATTTGTGTGTGCTTTTGATGGAAGGCCGATCATCAAAAGTCAACCGACTTGCTTTGTCCTGATTACACCAAATGTGTTGAGGTTAGGTTTGCAAGAGAATGCGACTTCAGTCATGTCGATCCGTAGATTCGAGTCCTTCCTTATAATGGTCGATGGCCCTGGCATCCTGCAGGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGTTTGTGGAACAGACGTCCCCGCTTTCTCGTATGTGGAGGCAGCCTCCAGCAATCGTGCTCAGCTGCTTGTTGTAGATGGACAGTCTCAGAACTTAGGCAGCTTGAATAAGCATCAAGGAAAGGCATCTTCAGATGATCGCAATCACAACTACATGACGGTGCAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAA

mRNA

>Mapoly0474s0001.1
ACGTAAGACGTGAGATAGCGCACGAGACGAGAGGAAAAGATCGATTGAGCGCGAGCGCAGACGAGGCAAGCCGAAGAAGAAGAAGAAGAAGAAGGAAGAAGAGAGACAGTGCTTGATAGAGTGATAGAAGCCCGCTCGGGACCGAGGCAGGGTCCACGAGGCCGAGGAGCGGTACCATGATACCAGCTCGTCGATGCTCGCAGTTGGGCTCGAAAAGAACCCTCCTCATCCACCAAGGGCCGGGCGCTCAAAAGATGAAAGAGTAGCGCCACTGGGCCCGACTGGATCTCGACCCAGGCCACTGGACGAGAAGAGGTCTTCGCGTAGCTTGCTCGGATACTTGACGGCCTATCTGCACAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGTTTGTGGAACAGACGTCCCCGCTTTCTCGTATGTGGAGGCAGCCTCCAGCAATCGTGCTCAGCTGCTTGTTGTAGATGGACAGTCTCAGAACTTAGGCAGCTTGAATAAGCATCAAGGAAAGGCATCTTCAGATGATCGCAATCACAACTACATGACGGTGCAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAA

CDS

>Mapoly0474s0001.1
ATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGTTTGTGGAACAGACGTCCCCGCTTTCTCGTATGTGGAGGCAGCCTCCAGCAATCGTGCTCAGCTGCTTGTTGTAGATGGACAGTCTCAGAACTTAGGCAGCTTGAATAAGCATCAAGGAAAGGCATCTTCAGATGATCGCAATCACAACTACATGACGGTGCAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAA

Protein

>Mapoly0474s0001.1
MHSTVSWRPAPSGCMSGTLNDVLMFTSRNRPATLEMSEDKDVEDKDLNPIEWQLLRDGVNGTNSRPKPSDPDFRLPFGSSQKQHVMAPAAPQWDSARNSMDGRVVVNYLRSFGPGRSDSSTCSVEGQVRGIRRSLDGHLLSSMVNRDEVPDREEEFGTESQGLSSLILGQGVHSSAQLFGCGLVVQSAATKGQQQVHRAPHFRNLFPEQSSSFSSVLTQESLPSDVNEHIHPQKKPRRYDFVEPLSQAEIDTIRLNEESHYRNSYPPRGAPLADFIDAHHSYKIPAASFSTSLPDRPTFTSNIPLQNLSLSNYQVSSPSVPLKSSSNDTSSARTPLVDYSYSSVDTKLQNGMRSVARGGPLLSGGGGFKPLNLMDGPTQAAVSRDYLQSGSMGQVCSIRPTSMETGSRAAWPAGFINFPPPTLESSGCVIPGMSSRRSLLDLDHHHHHHHHHHHEMAAEEREVQRVHPISESQLRLVIQKQLTTTDVGSLGRIILPKKEAETHLPHLPDKEGIEMCLYDHDVDRTWIMKYRFWPNNKSRMYLLENTGEFAKYHGLQQGDLLLIYRQLPARYVLRVKKMAPPLRLVTPPQSISESGGAEDLVSGAAETVSSRALTSSASSRTLNSSSAASKEVCGTDVPAFSYVEAASSNRAQLLVVDGQSQNLGSLNKHQGKASSDDRNHNYMTVQGQSTASDHDPTELDGESVYNLEEFPSLIEAEEIIDIFPLDSDSSEAQLSPVESIQVVRKTHHMRADLT

Mapoly0474s0001.2  

Gene structure:

mRNA scaffold_474:1579..10521  ( - strand )
three_prime_UTR scaffold_474:1579..2576  ( - strand )
CDS scaffold_474:2577..2627  ( - strand )
CDS scaffold_474:3093..3272  ( - strand )
CDS scaffold_474:3664..3737  ( - strand )
CDS scaffold_474:3976..4022  ( - strand )
CDS scaffold_474:4232..4332  ( - strand )
CDS scaffold_474:4884..4988  ( - strand )
CDS scaffold_474:5361..6746  ( - strand )
five_prime_UTR scaffold_474:6747..6801  ( - strand )
five_prime_UTR scaffold_474:9439..10521  ( - strand )

Sequences:

Gene

>Mapoly0474s0001.2
GGGCGGGCGGGCGGGGTGGCCGGTTGGTTGGTTGGTTGGATAGACGGACTAAAGTATCTATCTATCTATCTCTCTACTGCCTGCGCCTGCGCTTAATTTGCTCGGCTCTCGCTCGGCCTGGACTCGCCTTCCTTTCCTTTCCTGACTTGCCCTTACCTTGCCTTGCCTTGCCTTGCCTTGCCTTCGCTGCTGCTTTGTGAAACTGCGATCGTCGCCGCTTGAGTCCAGTCCAGTCCTCGCCTCTCCTTCTCTCCTCGCCTCTCCGCATTCATTCATATCCTAGGCCCACTAGATTGCTACGAGACAATTGGGGACCGGAAGCTCGAGACGTAAGACGTGAGATAGCGCACGAGACGAGAGGAAAAGATCGATTGAGCGCGAGCGCAGACGAGGCAAGCCGAAGAAGAAGAAGAAGAAGAAGGAAGAAGAGAGACAGTGCTTGATAGAGTGATAGAAGCCCGCTCGGGACCGAGGCAGGGTCCACGAGGCCGAGGAGCGGTACCATGATACCAGCTCGTCGATGCTCGCAGTTGGGCTCGAAAAGAACCCTCCTCATCCACCAAGGGCCGGGCGCTCAAAAGATGAAAGAGTAGCGCCACTGGGCCCGACTGGATCTCGACCCAGGCCACTGGACGAGAAGAGGTCTTCGCGTAGCTTGCTCGGATACTTGACGGCCTATCTGCACAGGTTGCTCTACCTCCTCGTCCCCGGCCTGGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTGTGCACCTCGTCGCTCGTCTCGCTCGTCTGACCTCCGTCAAGCGACGCACCTCTCGTAGGATCTGAGAAAAAGGCTTCTGTCAGCCACCTTCTGTACATAAGTCGGACCCCCTCCGGGTCCATCTCCTGCGGTCGGACTGCACTCGTCGTGTGGTGTAAAATAAACCTCTCTCTCTCTCGTCCTCTCTCTCGACGCTTAAACCGCTCCCCCGGCGAGTCACGGGTGCGTCTCGTCGACTTCGCGCGCTATCATCGATATCAGAAGCTTGTTTTGGCGCACTCTGAACACTCGCTCGTCTCTGGAGGAAGTCGGCACGAGCGAGTGGCTTATATAGGTTGGATTTGAAGTTCCCCCGCTTGCTGGTTTGTCTGGCAATTGCTCGCTTCGCACTTCCTTCGTTCCTTCATTCAATCTTCGTGAGTTTTCATTGTTGCAGTGCACGTAGACAATTGTGGACTTCTCCACCTCCTCCTCGCTCCTCGGACAAGCTTTTTGCCCGCGGAATGTCACGACTTCCACCTTCCAGCTAGTGTTAGGGTTCTCGAACATATCAAGAGTGTTGAAAGTCAGTACAATCTCCGAGTTTCCCCGTCCAGTATTCAAGACGCCCGGATGTGCCTGGCGAAACCCGACGATCAAAAGACAAACACACTCTTTGCCTCTTTGCAACTTGGCCGGAACTGAGCCAGTCAACTTGCCGTCAGAAGTTGCAATTGCCGCCACGTCTTGCTTCCATAGTTTCTTGAGAAGCCTTGGTCAGCATCATGGAGGAATTACTCCAGTCTTCGAATCCGAAGAAACTGCTACCACCACTGTTTCGACTGCAAACCCACCATTGCAGAAAAAAATGTCAATGAGCAGGTCATTCCGCACTGACTCGATCGTGCTGCTTGAGTCCGAGTCCGCGACTTCGACAGCGTCACCGGCTTTTGAACTTACTCTGATCATGAAATGTGTTTTGTAGATTCCGAAGTGGGCAACTGTCTCTCTGATTGGACGTTGTGACGCTTGTTCTCGATCAACATTTCTTCTGGATAGCATACTGCCAATATTACCACATGAATGTGCATTACCGCAAGCGCATGCATGTGCAGCTCTACGGGGTATGTGATCATGCCTGAAAGCCCTCGCCGATCGTTCACTCTGAGCAAATGGAAGCCTTGGTCAAATTTTTTCCTTCCAGAAGATAGATCTTAAGGACTTGAAGATTCGTGCAGATTGGTAGCACTACACTTGGGTGTAATTGAACATGTGGGAAGGCTTGCTCCGACGACCTCGATGGCTGGACCTCGGAATTGATAAAATTAATGACATGTAGGCTGAGATACATGCGCAAGGCCAATCACCTAACATACCTGGTTGGTGCAATTGTGCAGATCCTGCACATGTAGCCACTTCTTTAGTCAACAGTCGAGTATCAAGATCTGTGAACTATGTCATCGCTTTGCCACTCGACGACTCGACTAGCTAGCTTCATCAGGTAAGCCTGTGTGACCTTCCTGTCCCCGTTGATCAATGCCTGAGTAGTTCGCGGGTAGCATGACCGGCTGGTAAATAGATTCGGAGCCTCGACGCTCCGCTAGCGAGTCCCAGGCCCTTACGAGAGCAAGCATCGCAGGATGTGTTTTCGTCTTCGTTTCGGATGCAGGCTCCCGTGTTTCACGTCTGATATCTTCTCTCAGCAAGGCTTTCCTCGCCATTACGGCGTGGTGCGGGAACAGACATACTCGTGTGGGCTCATCCGAGAAAATAAAATACCGCGGCCATCCTGTCCACGGTTCTCGTGCGATTTAGTCTAGGTTTATTTTTTCTTTTTTCTGGGTACATTGAAACGCAGTACGAAACCATTCAACATGAGCTGAGTTGCTCCAGTGAGAGCCATTACTTTTGCAGTCCCATATTGAGCTCACATTATTGCCGGGTGTGAGAGAATGATGAAGTCCCCGGCTGGCACACGTGCGCGCACTTCGATCGAATGTGGCCATCCTTTCGGAATACAGACGTGCGCTACTCCTGAACTCTTGGAGTAACAATCTCCGTCACTATCTTTAGCTGTTGTGTTGTGCGTGGGGGAAGTATATCTCATTGTTGTACCTGGTCACAGACCCGTAATCGTAGATTGAGCCGCAGCGTCGAAGAAGTAGGCAGGTGCTTGAATTCTAATCTCTAGTTTTCTGTATTTAAACGAGCAATCATAGCCTCAGCTAAATGACTCGATTGAAGAGTGGACATGTCAGCGACAGCCTTTGCATTGCATGCATCCGGCGTGCGTTACGAAATGCATTCCCACCATTAGCCTTGAGGAGATGGCGAAATCCAAGCCAAAGCTTCGCCGCTGCTACTTGACAGACGCTGCCTGTTCTCTATACTCCGTTGTCCCTGGGACTTGAAATTGGAACTTTCGGTAGTATGGGAAGCGTATTAAATGAGTTTAATTTTTCCCTCAACTTCGCTACCCATGAATGCGAAGCAAACTGCTGGGACCTATTTCGTTGCGTGCCCGTCTGCAATCCGCGCGCAACAATTTCGCCGACGCTTGAAGATCTGGTTATAGAACTCAAGCGCAGAGCGCATCAAGCAAGTCGCGAGGCGTACAACGTGGGATTGTTCTTGTGTTCGCACTGTTGATCGTGTCTAGATCTCATGAGTGAGTCTCGTGACTGTTGACATAGAAACACCATGAACGTGCTCGAGTCGGAGCAAAGCTGAGTTCCATCAGCAACTGTAGCAGAAGTTTTCGGGGGGAATGATTGTTTCCTTGGTACCCTAAAGTCATGACCCGAGGCATGGAAGGAAGGAAGGAAGGATGGGTGAATGATGTCCGCGTGAAAGGCCTTTGTTTGTTTATCTGAACAACTGTCATACTTCTTTTCTTTGACTTTTGTATGCTATTTCTGATGCGCTCAGGTCAACCTCCGAAACGAGCACAGTGGCTGCAATCTCTTATATTCAAATTTTTTGTTTGTTGCAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTAGAGCTCAACCTTTAACTCTTCCAATTTAAGACGTGGCCTTCGTTTTCCGAATTGAATGTAAATTCGATTTTTTCCGTCTACCATGTTCAGGATTGAGTGAACTTTCAGAAAGAGAGGAGAGACTTTAGATAATGCAGTGATTCTGCTTGTAAGCAGTACGTCAAATTATGACCTTTAGAGTTTGTGGGCTTTCACAACGACCGATTCCTTGTGAGGCGAATTAAAAACCATGTGTACGGTCGGAAAACTGCTCACGTTGATATCTAGAATATAATTTCACTTAGATACATGGTTGTGTTCATGTTCGGCTCTGTGAATTGGGCTGAATTCGATAGTTTGGGACATCCCAAGCATGTTCTGAATTTGCAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGGTGAGATGCCCGTCTTACATAGGTTTTGAGGGCGGACTCAGAGTCCCTGTTCGTGAGGTATCACTGTTATCACTGGACTCCTCAGTATCTGCTTTCAATTTCAAGTGTAAGACCCGGTTGATGTCAATTGGATAGAGATTTTTACGGCATGGCGTGTATTATTCGGAAGGTATGGCGGAAAGTAGTACACTGCTTTTTGACATAAGCTCTTCAATTGCCTTTGAATGATTTCTGATTGTCATCGAAGAACAAGTATAAAGAAATCAGATGTCTGGGTGGCTGGGGACTATACGTGGCAACTGCCTGCCACTTTTTTTTGTCCGTATGGCAATGCCGTGGCCAATGTCCCAATTTTCTGTGGCTGCATGGTTGGTGAAAGCGTACACAAGGCATTAGTTGTAGATTAACTAGGTTCTTAGGCGTGTACATCAGTACTTGACTGTTCTGAGTAGGTGATGCCGGTAGTTGCTGATTTGATGCGATAGAATACAGCAAGACGTAGTCTACACGATCAACGATAACAATTTTTTATACCTATTGGCTGCCTGCAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTGCCTAAATCCTTCTTGTCTTCAATTCGTCATCGCTTTTGCAAGAGGCATGTTGCGTCTGCTATATTCAATGAAACGAGACATTGAGGCAATCATCGTGATCTGTACATGCTTGGACGACAAGAGAAACCAATCATCCACAATCGATGGACTCGGAGTGTTTGCTTCTTCTAAACTTAGCGCCGCAACGGCAATGTTTATGATTGCAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGTAAATTTCAAGCCTATTCTTTTGCTATATATCATGTGTCAGATTGAAGTCTATTGTTGTGAAATTGAAATTTGCATAGTAGAAATACGTAACGCGCCACCCTTGGATTTTGAGGCTATCATAGCGTGTACATCGAAAATTGGGCTTGTGGATCGACAATTCGCCAGTTGGTCAACATAGCTTGATTGATAACCACCGGCCTGTCTTTGATTTTGACATTTGCATCCTTTCACCGCAGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTAAGCACCGCTTTTACCAGATTCCAATTTTCTTCGTGCGATATGAATCTGAAATGTCTGAACTTAAAGCAGGAATTTCTTATTATCTTCGAATTTCGAGGCTCTGAGATATTCTACAGACGGTGATGAAACTCTTGCTGTAATTAGCCCCTCGCTAAGTGAGTCAGGAAACAAGATTGACGTGAAAGTGGCACAAAGTGATGGAATTTGGGTATGCTAATTTGTGTGTGCTTTTGATGGAAGGCCGATCATCAAAAGTCAACCGACTTGCTTTGTCCTGATTACACCAAATGTGTTGAGGTTAGGTTTGCAAGAGAATGCGACTTCAGTCATGTCGATCCGTAGATTCGAGTCCTTCCTTATAATGGTCGATGGCCCTGGCATCCTGCAGGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGTTTGTGGAACAGACGTCCCCGCTTTCTCGTATGTGGAGGCAGCCTCCAGCAATCGTGCTCAGCTGCTTGTTGTAGATGGACAGTCTCAGAACTTAGGCAGCTTGAATAAGCATCAAGGAAAGGCATCTTCAGATGATCGCAATCACAACTACATGACGGTGCAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAAGAGAGGAGCTTGACTCAAGATCGAGCAAGCTCAAAAACATCTCTCATCTTTGGCCAGTGTGGTAATTATTTTCCTTCCCTGTCTTCCCTGCAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAGAGATCTTCTTCGGTGATGTAACACAAGATTGAAGTAACTTCTAGACGCCTACAGGTGAGTGGGGCTCGGCTCCGGACACTTCTGACATGAACAGTTGTCCATGGCCACCCAAGTGAGACCACCTGTTGTTCGAACACTGACCAGTACGAGTATGGTGGAGTCTCAATCACGCAAGTCATCATCATTCTACTAACCGGTACGAGCGACCTCACGATCTGATCTAGCACTCGCCTCCAGGAGCTATAGTTAATGGCATTTCCTGTCCTACTTCACTTTTCTATGAGTTCGGTTACCACATACTATGATGCTGCTGCTGCTGCTGTAGACTTTACCAAGGTCTCGCCGCGACTGTTCCAGTAGTACAGTGGGGCAAGCTTCTCTTCTTTCGGAACTGGATCCGGTCTGGGTGGTTTGGATCAGTCGGCTGTGAGATGACGCTCGAGACTTGATTACACATAAGACTCCTCCTGCCTCCCTTACATTCATCGTAATTTAATCGTTATTTTAAACCTCCTCCTTTTCCTATTTTAGAAGCTAAGCTAAGCTAGCTACACACTACCTACTTAGCTTGAATTCATTTATTGGTTTCAATTTTCATACAGTAAGGTATGTAAGTAGCGAAGGTCGTGACCACAAACTAGACTTACATTCCATTGTAGATTCTTAAGACCTAAGCACACGCCAGCAGAGCTCTTTAGCCGGTGAAGGTGAACTCCGTGCCGACGTGTTGGCACTACTCTGTACTATAGCGGAAATGGAAACAAATTGCAGCAGCTAGACGTTTTAGTTTTATCTAGTTATGGTCTTCCCTGCCCAGACCAGATAAAAACGCCAAAAACTTAAGATGACCATCTCATAGCTGGGCCTCGCACAGATTTGCTGCGCGCTTGGACCAAAGAGTAGCGTAGCTGATTTGGAAATTGGTTGTACAGGAGGATAATTACCTATGACTTCTTATCGTTTGTCGAAATTCATGAAGTGCGTCTCTGCATATCTGG

mRNA

>Mapoly0474s0001.2
GGGCGGGCGGGCGGGGTGGCCGGTTGGTTGGTTGGTTGGATAGACGGACTAAAGTATCTATCTATCTATCTCTCTACTGCCTGCGCCTGCGCTTAATTTGCTCGGCTCTCGCTCGGCCTGGACTCGCCTTCCTTTCCTTTCCTGACTTGCCCTTACCTTGCCTTGCCTTGCCTTGCCTTGCCTTCGCTGCTGCTTTGTGAAACTGCGATCGTCGCCGCTTGAGTCCAGTCCAGTCCTCGCCTCTCCTTCTCTCCTCGCCTCTCCGCATTCATTCATATCCTAGGCCCACTAGATTGCTACGAGACAATTGGGGACCGGAAGCTCGAGACGTAAGACGTGAGATAGCGCACGAGACGAGAGGAAAAGATCGATTGAGCGCGAGCGCAGACGAGGCAAGCCGAAGAAGAAGAAGAAGAAGAAGGAAGAAGAGAGACAGTGCTTGATAGAGTGATAGAAGCCCGCTCGGGACCGAGGCAGGGTCCACGAGGCCGAGGAGCGGTACCATGATACCAGCTCGTCGATGCTCGCAGTTGGGCTCGAAAAGAACCCTCCTCATCCACCAAGGGCCGGGCGCTCAAAAGATGAAAGAGTAGCGCCACTGGGCCCGACTGGATCTCGACCCAGGCCACTGGACGAGAAGAGGTCTTCGCGTAGCTTGCTCGGATACTTGACGGCCTATCTGCACAGGTTGCTCTACCTCCTCGTCCCCGGCCTGGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTGTGCACCTCGTCGCTCGTCTCGCTCGTCTGACCTCCGTCAAGCGACGCACCTCTCGTAGGATCTGAGAAAAAGGCTTCTGTCAGCCACCTTCTGTACATAAGTCGGACCCCCTCCGGGTCCATCTCCTGCGGTCGGACTGCACTCGTCGTGTGGTGTAAAATAAACCTCTCTCTCTCTCGTCCTCTCTCTCGACGCTTAAACCGCTCCCCCGGCGAGTCACGGGTGCGTCTCGTCGACTTCGCGCGCTATCATCGATATCAGAAGCTTGTTTTGGCGCACTCTGAACACTCGCTCGTCTCTGGAGGAAGTCGGCACGAGCGAGTGGCTTATATAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAGAGATCTTCTTCGGTGATGTAACACAAGATTGAAGTAACTTCTAGACGCCTACAGGTGAGTGGGGCTCGGCTCCGGACACTTCTGACATGAACAGTTGTCCATGGCCACCCAAGTGAGACCACCTGTTGTTCGAACACTGACCAGTACGAGTATGGTGGAGTCTCAATCACGCAAGTCATCATCATTCTACTAACCGGTACGAGCGACCTCACGATCTGATCTAGCACTCGCCTCCAGGAGCTATAGTTAATGGCATTTCCTGTCCTACTTCACTTTTCTATGAGTTCGGTTACCACATACTATGATGCTGCTGCTGCTGCTGTAGACTTTACCAAGGTCTCGCCGCGACTGTTCCAGTAGTACAGTGGGGCAAGCTTCTCTTCTTTCGGAACTGGATCCGGTCTGGGTGGTTTGGATCAGTCGGCTGTGAGATGACGCTCGAGACTTGATTACACATAAGACTCCTCCTGCCTCCCTTACATTCATCGTAATTTAATCGTTATTTTAAACCTCCTCCTTTTCCTATTTTAGAAGCTAAGCTAAGCTAGCTACACACTACCTACTTAGCTTGAATTCATTTATTGGTTTCAATTTTCATACAGTAAGGTATGTAAGTAGCGAAGGTCGTGACCACAAACTAGACTTACATTCCATTGTAGATTCTTAAGACCTAAGCACACGCCAGCAGAGCTCTTTAGCCGGTGAAGGTGAACTCCGTGCCGACGTGTTGGCACTACTCTGTACTATAGCGGAAATGGAAACAAATTGCAGCAGCTAGACGTTTTAGTTTTATCTAGTTATGGTCTTCCCTGCCCAGACCAGATAAAAACGCCAAAAACTTAAGATGACCATCTCATAGCTGGGCCTCGCACAGATTTGCTGCGCGCTTGGACCAAAGAGTAGCGTAGCTGATTTGGAAATTGGTTGTACAGGAGGATAATTACCTATGACTTCTTATCGTTTGTCGAAATTCATGAAGTGCGTCTCTGCATATCTGG

CDS

>Mapoly0474s0001.2
ATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAG

Protein

>Mapoly0474s0001.2
MHSTVSWRPAPSGCMSGTLNDVLMFTSRNRPATLEMSEDKDVEDKDLNPIEWQLLRDGVNGTNSRPKPSDPDFRLPFGSSQKQHVMAPAAPQWDSARNSMDGRVVVNYLRSFGPGRSDSSTCSVEGQVRGIRRSLDGHLLSSMVNRDEVPDREEEFGTESQGLSSLILGQGVHSSAQLFGCGLVVQSAATKGQQQVHRAPHFRNLFPEQSSSFSSVLTQESLPSDVNEHIHPQKKPRRYDFVEPLSQAEIDTIRLNEESHYRNSYPPRGAPLADFIDAHHSYKIPAASFSTSLPDRPTFTSNIPLQNLSLSNYQVSSPSVPLKSSSNDTSSARTPLVDYSYSSVDTKLQNGMRSVARGGPLLSGGGGFKPLNLMDGPTQAAVSRDYLQSGSMGQVCSIRPTSMETGSRAAWPAGFINFPPPTLESSGCVIPGMSSRRSLLDLDHHHHHHHHHHHEMAAEEREVQRVHPISESQLRLVIQKQLTTTDVGSLGRIILPKKEAETHLPHLPDKEGIEMCLYDHDVDRTWIMKYRFWPNNKSRMYLLENTGEFAKYHGLQQGDLLLIYRQLPARYVLRVKKMAPPLRLVTPPQSISESGGAEDLVSGAAETVSSRALTSSASSRTLNSSSAASKEGLCIITSARPHLHTMS

Mapoly0474s0001.3  

Gene structure:

mRNA scaffold_474:1579..10521  ( - strand )
three_prime_UTR scaffold_474:1579..2720  ( - strand )
CDS scaffold_474:2721..2927  ( - strand )
CDS scaffold_474:3093..3272  ( - strand )
CDS scaffold_474:3664..3737  ( - strand )
CDS scaffold_474:3976..4022  ( - strand )
CDS scaffold_474:4232..4332  ( - strand )
CDS scaffold_474:4884..4988  ( - strand )
CDS scaffold_474:5361..6746  ( - strand )
five_prime_UTR scaffold_474:6747..6801  ( - strand )
five_prime_UTR scaffold_474:9439..10521  ( - strand )

Sequences:

Gene

>Mapoly0474s0001.3
GGGCGGGCGGGCGGGGTGGCCGGTTGGTTGGTTGGTTGGATAGACGGACTAAAGTATCTATCTATCTATCTCTCTACTGCCTGCGCCTGCGCTTAATTTGCTCGGCTCTCGCTCGGCCTGGACTCGCCTTCCTTTCCTTTCCTGACTTGCCCTTACCTTGCCTTGCCTTGCCTTGCCTTGCCTTCGCTGCTGCTTTGTGAAACTGCGATCGTCGCCGCTTGAGTCCAGTCCAGTCCTCGCCTCTCCTTCTCTCCTCGCCTCTCCGCATTCATTCATATCCTAGGCCCACTAGATTGCTACGAGACAATTGGGGACCGGAAGCTCGAGACGTAAGACGTGAGATAGCGCACGAGACGAGAGGAAAAGATCGATTGAGCGCGAGCGCAGACGAGGCAAGCCGAAGAAGAAGAAGAAGAAGAAGGAAGAAGAGAGACAGTGCTTGATAGAGTGATAGAAGCCCGCTCGGGACCGAGGCAGGGTCCACGAGGCCGAGGAGCGGTACCATGATACCAGCTCGTCGATGCTCGCAGTTGGGCTCGAAAAGAACCCTCCTCATCCACCAAGGGCCGGGCGCTCAAAAGATGAAAGAGTAGCGCCACTGGGCCCGACTGGATCTCGACCCAGGCCACTGGACGAGAAGAGGTCTTCGCGTAGCTTGCTCGGATACTTGACGGCCTATCTGCACAGGTTGCTCTACCTCCTCGTCCCCGGCCTGGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTGTGCACCTCGTCGCTCGTCTCGCTCGTCTGACCTCCGTCAAGCGACGCACCTCTCGTAGGATCTGAGAAAAAGGCTTCTGTCAGCCACCTTCTGTACATAAGTCGGACCCCCTCCGGGTCCATCTCCTGCGGTCGGACTGCACTCGTCGTGTGGTGTAAAATAAACCTCTCTCTCTCTCGTCCTCTCTCTCGACGCTTAAACCGCTCCCCCGGCGAGTCACGGGTGCGTCTCGTCGACTTCGCGCGCTATCATCGATATCAGAAGCTTGTTTTGGCGCACTCTGAACACTCGCTCGTCTCTGGAGGAAGTCGGCACGAGCGAGTGGCTTATATAGGTTGGATTTGAAGTTCCCCCGCTTGCTGGTTTGTCTGGCAATTGCTCGCTTCGCACTTCCTTCGTTCCTTCATTCAATCTTCGTGAGTTTTCATTGTTGCAGTGCACGTAGACAATTGTGGACTTCTCCACCTCCTCCTCGCTCCTCGGACAAGCTTTTTGCCCGCGGAATGTCACGACTTCCACCTTCCAGCTAGTGTTAGGGTTCTCGAACATATCAAGAGTGTTGAAAGTCAGTACAATCTCCGAGTTTCCCCGTCCAGTATTCAAGACGCCCGGATGTGCCTGGCGAAACCCGACGATCAAAAGACAAACACACTCTTTGCCTCTTTGCAACTTGGCCGGAACTGAGCCAGTCAACTTGCCGTCAGAAGTTGCAATTGCCGCCACGTCTTGCTTCCATAGTTTCTTGAGAAGCCTTGGTCAGCATCATGGAGGAATTACTCCAGTCTTCGAATCCGAAGAAACTGCTACCACCACTGTTTCGACTGCAAACCCACCATTGCAGAAAAAAATGTCAATGAGCAGGTCATTCCGCACTGACTCGATCGTGCTGCTTGAGTCCGAGTCCGCGACTTCGACAGCGTCACCGGCTTTTGAACTTACTCTGATCATGAAATGTGTTTTGTAGATTCCGAAGTGGGCAACTGTCTCTCTGATTGGACGTTGTGACGCTTGTTCTCGATCAACATTTCTTCTGGATAGCATACTGCCAATATTACCACATGAATGTGCATTACCGCAAGCGCATGCATGTGCAGCTCTACGGGGTATGTGATCATGCCTGAAAGCCCTCGCCGATCGTTCACTCTGAGCAAATGGAAGCCTTGGTCAAATTTTTTCCTTCCAGAAGATAGATCTTAAGGACTTGAAGATTCGTGCAGATTGGTAGCACTACACTTGGGTGTAATTGAACATGTGGGAAGGCTTGCTCCGACGACCTCGATGGCTGGACCTCGGAATTGATAAAATTAATGACATGTAGGCTGAGATACATGCGCAAGGCCAATCACCTAACATACCTGGTTGGTGCAATTGTGCAGATCCTGCACATGTAGCCACTTCTTTAGTCAACAGTCGAGTATCAAGATCTGTGAACTATGTCATCGCTTTGCCACTCGACGACTCGACTAGCTAGCTTCATCAGGTAAGCCTGTGTGACCTTCCTGTCCCCGTTGATCAATGCCTGAGTAGTTCGCGGGTAGCATGACCGGCTGGTAAATAGATTCGGAGCCTCGACGCTCCGCTAGCGAGTCCCAGGCCCTTACGAGAGCAAGCATCGCAGGATGTGTTTTCGTCTTCGTTTCGGATGCAGGCTCCCGTGTTTCACGTCTGATATCTTCTCTCAGCAAGGCTTTCCTCGCCATTACGGCGTGGTGCGGGAACAGACATACTCGTGTGGGCTCATCCGAGAAAATAAAATACCGCGGCCATCCTGTCCACGGTTCTCGTGCGATTTAGTCTAGGTTTATTTTTTCTTTTTTCTGGGTACATTGAAACGCAGTACGAAACCATTCAACATGAGCTGAGTTGCTCCAGTGAGAGCCATTACTTTTGCAGTCCCATATTGAGCTCACATTATTGCCGGGTGTGAGAGAATGATGAAGTCCCCGGCTGGCACACGTGCGCGCACTTCGATCGAATGTGGCCATCCTTTCGGAATACAGACGTGCGCTACTCCTGAACTCTTGGAGTAACAATCTCCGTCACTATCTTTAGCTGTTGTGTTGTGCGTGGGGGAAGTATATCTCATTGTTGTACCTGGTCACAGACCCGTAATCGTAGATTGAGCCGCAGCGTCGAAGAAGTAGGCAGGTGCTTGAATTCTAATCTCTAGTTTTCTGTATTTAAACGAGCAATCATAGCCTCAGCTAAATGACTCGATTGAAGAGTGGACATGTCAGCGACAGCCTTTGCATTGCATGCATCCGGCGTGCGTTACGAAATGCATTCCCACCATTAGCCTTGAGGAGATGGCGAAATCCAAGCCAAAGCTTCGCCGCTGCTACTTGACAGACGCTGCCTGTTCTCTATACTCCGTTGTCCCTGGGACTTGAAATTGGAACTTTCGGTAGTATGGGAAGCGTATTAAATGAGTTTAATTTTTCCCTCAACTTCGCTACCCATGAATGCGAAGCAAACTGCTGGGACCTATTTCGTTGCGTGCCCGTCTGCAATCCGCGCGCAACAATTTCGCCGACGCTTGAAGATCTGGTTATAGAACTCAAGCGCAGAGCGCATCAAGCAAGTCGCGAGGCGTACAACGTGGGATTGTTCTTGTGTTCGCACTGTTGATCGTGTCTAGATCTCATGAGTGAGTCTCGTGACTGTTGACATAGAAACACCATGAACGTGCTCGAGTCGGAGCAAAGCTGAGTTCCATCAGCAACTGTAGCAGAAGTTTTCGGGGGGAATGATTGTTTCCTTGGTACCCTAAAGTCATGACCCGAGGCATGGAAGGAAGGAAGGAAGGATGGGTGAATGATGTCCGCGTGAAAGGCCTTTGTTTGTTTATCTGAACAACTGTCATACTTCTTTTCTTTGACTTTTGTATGCTATTTCTGATGCGCTCAGGTCAACCTCCGAAACGAGCACAGTGGCTGCAATCTCTTATATTCAAATTTTTTGTTTGTTGCAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTAGAGCTCAACCTTTAACTCTTCCAATTTAAGACGTGGCCTTCGTTTTCCGAATTGAATGTAAATTCGATTTTTTCCGTCTACCATGTTCAGGATTGAGTGAACTTTCAGAAAGAGAGGAGAGACTTTAGATAATGCAGTGATTCTGCTTGTAAGCAGTACGTCAAATTATGACCTTTAGAGTTTGTGGGCTTTCACAACGACCGATTCCTTGTGAGGCGAATTAAAAACCATGTGTACGGTCGGAAAACTGCTCACGTTGATATCTAGAATATAATTTCACTTAGATACATGGTTGTGTTCATGTTCGGCTCTGTGAATTGGGCTGAATTCGATAGTTTGGGACATCCCAAGCATGTTCTGAATTTGCAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGGTGAGATGCCCGTCTTACATAGGTTTTGAGGGCGGACTCAGAGTCCCTGTTCGTGAGGTATCACTGTTATCACTGGACTCCTCAGTATCTGCTTTCAATTTCAAGTGTAAGACCCGGTTGATGTCAATTGGATAGAGATTTTTACGGCATGGCGTGTATTATTCGGAAGGTATGGCGGAAAGTAGTACACTGCTTTTTGACATAAGCTCTTCAATTGCCTTTGAATGATTTCTGATTGTCATCGAAGAACAAGTATAAAGAAATCAGATGTCTGGGTGGCTGGGGACTATACGTGGCAACTGCCTGCCACTTTTTTTTGTCCGTATGGCAATGCCGTGGCCAATGTCCCAATTTTCTGTGGCTGCATGGTTGGTGAAAGCGTACACAAGGCATTAGTTGTAGATTAACTAGGTTCTTAGGCGTGTACATCAGTACTTGACTGTTCTGAGTAGGTGATGCCGGTAGTTGCTGATTTGATGCGATAGAATACAGCAAGACGTAGTCTACACGATCAACGATAACAATTTTTTATACCTATTGGCTGCCTGCAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTGCCTAAATCCTTCTTGTCTTCAATTCGTCATCGCTTTTGCAAGAGGCATGTTGCGTCTGCTATATTCAATGAAACGAGACATTGAGGCAATCATCGTGATCTGTACATGCTTGGACGACAAGAGAAACCAATCATCCACAATCGATGGACTCGGAGTGTTTGCTTCTTCTAAACTTAGCGCCGCAACGGCAATGTTTATGATTGCAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGTAAATTTCAAGCCTATTCTTTTGCTATATATCATGTGTCAGATTGAAGTCTATTGTTGTGAAATTGAAATTTGCATAGTAGAAATACGTAACGCGCCACCCTTGGATTTTGAGGCTATCATAGCGTGTACATCGAAAATTGGGCTTGTGGATCGACAATTCGCCAGTTGGTCAACATAGCTTGATTGATAACCACCGGCCTGTCTTTGATTTTGACATTTGCATCCTTTCACCGCAGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTAAGCACCGCTTTTACCAGATTCCAATTTTCTTCGTGCGATATGAATCTGAAATGTCTGAACTTAAAGCAGGAATTTCTTATTATCTTCGAATTTCGAGGCTCTGAGATATTCTACAGACGGTGATGAAACTCTTGCTGTAATTAGCCCCTCGCTAAGTGAGTCAGGAAACAAGATTGACGTGAAAGTGGCACAAAGTGATGGAATTTGGGTATGCTAATTTGTGTGTGCTTTTGATGGAAGGCCGATCATCAAAAGTCAACCGACTTGCTTTGTCCTGATTACACCAAATGTGTTGAGGTTAGGTTTGCAAGAGAATGCGACTTCAGTCATGTCGATCCGTAGATTCGAGTCCTTCCTTATAATGGTCGATGGCCCTGGCATCCTGCAGGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGTTTGTGGAACAGACGTCCCCGCTTTCTCGTATGTGGAGGCAGCCTCCAGCAATCGTGCTCAGCTGCTTGTTGTAGATGGACAGTCTCAGAACTTAGGCAGCTTGAATAAGCATCAAGGAAAGGCATCTTCAGATGATCGCAATCACAACTACATGACGGTGCAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAAGAGAGGAGCTTGACTCAAGATCGAGCAAGCTCAAAAACATCTCTCATCTTTGGCCAGTGTGGTAATTATTTTCCTTCCCTGTCTTCCCTGCAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAGAGATCTTCTTCGGTGATGTAACACAAGATTGAAGTAACTTCTAGACGCCTACAGGTGAGTGGGGCTCGGCTCCGGACACTTCTGACATGAACAGTTGTCCATGGCCACCCAAGTGAGACCACCTGTTGTTCGAACACTGACCAGTACGAGTATGGTGGAGTCTCAATCACGCAAGTCATCATCATTCTACTAACCGGTACGAGCGACCTCACGATCTGATCTAGCACTCGCCTCCAGGAGCTATAGTTAATGGCATTTCCTGTCCTACTTCACTTTTCTATGAGTTCGGTTACCACATACTATGATGCTGCTGCTGCTGCTGTAGACTTTACCAAGGTCTCGCCGCGACTGTTCCAGTAGTACAGTGGGGCAAGCTTCTCTTCTTTCGGAACTGGATCCGGTCTGGGTGGTTTGGATCAGTCGGCTGTGAGATGACGCTCGAGACTTGATTACACATAAGACTCCTCCTGCCTCCCTTACATTCATCGTAATTTAATCGTTATTTTAAACCTCCTCCTTTTCCTATTTTAGAAGCTAAGCTAAGCTAGCTACACACTACCTACTTAGCTTGAATTCATTTATTGGTTTCAATTTTCATACAGTAAGGTATGTAAGTAGCGAAGGTCGTGACCACAAACTAGACTTACATTCCATTGTAGATTCTTAAGACCTAAGCACACGCCAGCAGAGCTCTTTAGCCGGTGAAGGTGAACTCCGTGCCGACGTGTTGGCACTACTCTGTACTATAGCGGAAATGGAAACAAATTGCAGCAGCTAGACGTTTTAGTTTTATCTAGTTATGGTCTTCCCTGCCCAGACCAGATAAAAACGCCAAAAACTTAAGATGACCATCTCATAGCTGGGCCTCGCACAGATTTGCTGCGCGCTTGGACCAAAGAGTAGCGTAGCTGATTTGGAAATTGGTTGTACAGGAGGATAATTACCTATGACTTCTTATCGTTTGTCGAAATTCATGAAGTGCGTCTCTGCATATCTGG

mRNA

>Mapoly0474s0001.3
GGGCGGGCGGGCGGGGTGGCCGGTTGGTTGGTTGGTTGGATAGACGGACTAAAGTATCTATCTATCTATCTCTCTACTGCCTGCGCCTGCGCTTAATTTGCTCGGCTCTCGCTCGGCCTGGACTCGCCTTCCTTTCCTTTCCTGACTTGCCCTTACCTTGCCTTGCCTTGCCTTGCCTTGCCTTCGCTGCTGCTTTGTGAAACTGCGATCGTCGCCGCTTGAGTCCAGTCCAGTCCTCGCCTCTCCTTCTCTCCTCGCCTCTCCGCATTCATTCATATCCTAGGCCCACTAGATTGCTACGAGACAATTGGGGACCGGAAGCTCGAGACGTAAGACGTGAGATAGCGCACGAGACGAGAGGAAAAGATCGATTGAGCGCGAGCGCAGACGAGGCAAGCCGAAGAAGAAGAAGAAGAAGAAGGAAGAAGAGAGACAGTGCTTGATAGAGTGATAGAAGCCCGCTCGGGACCGAGGCAGGGTCCACGAGGCCGAGGAGCGGTACCATGATACCAGCTCGTCGATGCTCGCAGTTGGGCTCGAAAAGAACCCTCCTCATCCACCAAGGGCCGGGCGCTCAAAAGATGAAAGAGTAGCGCCACTGGGCCCGACTGGATCTCGACCCAGGCCACTGGACGAGAAGAGGTCTTCGCGTAGCTTGCTCGGATACTTGACGGCCTATCTGCACAGGTTGCTCTACCTCCTCGTCCCCGGCCTGGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTGTGCACCTCGTCGCTCGTCTCGCTCGTCTGACCTCCGTCAAGCGACGCACCTCTCGTAGGATCTGAGAAAAAGGCTTCTGTCAGCCACCTTCTGTACATAAGTCGGACCCCCTCCGGGTCCATCTCCTGCGGTCGGACTGCACTCGTCGTGTGGTGTAAAATAAACCTCTCTCTCTCTCGTCCTCTCTCTCGACGCTTAAACCGCTCCCCCGGCGAGTCACGGGTGCGTCTCGTCGACTTCGCGCGCTATCATCGATATCAGAAGCTTGTTTTGGCGCACTCTGAACACTCGCTCGTCTCTGGAGGAAGTCGGCACGAGCGAGTGGCTTATATAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAAGAGAGGAGCTTGACTCAAGATCGAGCAAGCTCAAAAACATCTCTCATCTTTGGCCAGTGTGGTAATTATTTTCCTTCCCTGTCTTCCCTGCAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAGAGATCTTCTTCGGTGATGTAACACAAGATTGAAGTAACTTCTAGACGCCTACAGGTGAGTGGGGCTCGGCTCCGGACACTTCTGACATGAACAGTTGTCCATGGCCACCCAAGTGAGACCACCTGTTGTTCGAACACTGACCAGTACGAGTATGGTGGAGTCTCAATCACGCAAGTCATCATCATTCTACTAACCGGTACGAGCGACCTCACGATCTGATCTAGCACTCGCCTCCAGGAGCTATAGTTAATGGCATTTCCTGTCCTACTTCACTTTTCTATGAGTTCGGTTACCACATACTATGATGCTGCTGCTGCTGCTGTAGACTTTACCAAGGTCTCGCCGCGACTGTTCCAGTAGTACAGTGGGGCAAGCTTCTCTTCTTTCGGAACTGGATCCGGTCTGGGTGGTTTGGATCAGTCGGCTGTGAGATGACGCTCGAGACTTGATTACACATAAGACTCCTCCTGCCTCCCTTACATTCATCGTAATTTAATCGTTATTTTAAACCTCCTCCTTTTCCTATTTTAGAAGCTAAGCTAAGCTAGCTACACACTACCTACTTAGCTTGAATTCATTTATTGGTTTCAATTTTCATACAGTAAGGTATGTAAGTAGCGAAGGTCGTGACCACAAACTAGACTTACATTCCATTGTAGATTCTTAAGACCTAAGCACACGCCAGCAGAGCTCTTTAGCCGGTGAAGGTGAACTCCGTGCCGACGTGTTGGCACTACTCTGTACTATAGCGGAAATGGAAACAAATTGCAGCAGCTAGACGTTTTAGTTTTATCTAGTTATGGTCTTCCCTGCCCAGACCAGATAAAAACGCCAAAAACTTAAGATGACCATCTCATAGCTGGGCCTCGCACAGATTTGCTGCGCGCTTGGACCAAAGAGTAGCGTAGCTGATTTGGAAATTGGTTGTACAGGAGGATAATTACCTATGACTTCTTATCGTTTGTCGAAATTCATGAAGTGCGTCTCTGCATATCTGG

CDS

>Mapoly0474s0001.3
ATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAA

Protein

>Mapoly0474s0001.3
MHSTVSWRPAPSGCMSGTLNDVLMFTSRNRPATLEMSEDKDVEDKDLNPIEWQLLRDGVNGTNSRPKPSDPDFRLPFGSSQKQHVMAPAAPQWDSARNSMDGRVVVNYLRSFGPGRSDSSTCSVEGQVRGIRRSLDGHLLSSMVNRDEVPDREEEFGTESQGLSSLILGQGVHSSAQLFGCGLVVQSAATKGQQQVHRAPHFRNLFPEQSSSFSSVLTQESLPSDVNEHIHPQKKPRRYDFVEPLSQAEIDTIRLNEESHYRNSYPPRGAPLADFIDAHHSYKIPAASFSTSLPDRPTFTSNIPLQNLSLSNYQVSSPSVPLKSSSNDTSSARTPLVDYSYSSVDTKLQNGMRSVARGGPLLSGGGGFKPLNLMDGPTQAAVSRDYLQSGSMGQVCSIRPTSMETGSRAAWPAGFINFPPPTLESSGCVIPGMSSRRSLLDLDHHHHHHHHHHHEMAAEEREVQRVHPISESQLRLVIQKQLTTTDVGSLGRIILPKKEAETHLPHLPDKEGIEMCLYDHDVDRTWIMKYRFWPNNKSRMYLLENTGEFAKYHGLQQGDLLLIYRQLPARYVLRVKKMAPPLRLVTPPQSISESGGAEDLVSGAAETVSSRALTSSASSRTLNSSSAASKEGQSTASDHDPTELDGESVYNLEEFPSLIEAEEIIDIFPLDSDSSEAQLSPVESIQVVRKTHHMRADLT

Mapoly0474s0001.4  

Gene structure:

mRNA scaffold_474:1580..9769  ( - strand )
three_prime_UTR scaffold_474:1580..2576  ( - strand )
CDS scaffold_474:2577..2627  ( - strand )
CDS scaffold_474:3093..3272  ( - strand )
CDS scaffold_474:3664..3737  ( - strand )
CDS scaffold_474:3976..4022  ( - strand )
CDS scaffold_474:4232..4332  ( - strand )
CDS scaffold_474:4884..5006  ( - strand )
CDS scaffold_474:5361..6746  ( - strand )
five_prime_UTR scaffold_474:6747..6801  ( - strand )
five_prime_UTR scaffold_474:9439..9769  ( - strand )

Sequences:

Gene

>Mapoly0474s0001.4
ACCTCGTCGCTCGTCTCGCTCGTCTGACCTCCGTCAAGCGACGCACCTCTCGTAGGATCTGAGAAAAAGGCTTCTGTCAGCCACCTTCTGTACATAAGTCGGACCCCCTCCGGGTCCATCTCCTGCGGTCGGACTGCACTCGTCGTGTGGTGTAAAATAAACCTCTCTCTCTCTCGTCCTCTCTCTCGACGCTTAAACCGCTCCCCCGGCGAGTCACGGGTGCGTCTCGTCGACTTCGCGCGCTATCATCGATATCAGAAGCTTGTTTTGGCGCACTCTGAACACTCGCTCGTCTCTGGAGGAAGTCGGCACGAGCGAGTGGCTTATATAGGTTGGATTTGAAGTTCCCCCGCTTGCTGGTTTGTCTGGCAATTGCTCGCTTCGCACTTCCTTCGTTCCTTCATTCAATCTTCGTGAGTTTTCATTGTTGCAGTGCACGTAGACAATTGTGGACTTCTCCACCTCCTCCTCGCTCCTCGGACAAGCTTTTTGCCCGCGGAATGTCACGACTTCCACCTTCCAGCTAGTGTTAGGGTTCTCGAACATATCAAGAGTGTTGAAAGTCAGTACAATCTCCGAGTTTCCCCGTCCAGTATTCAAGACGCCCGGATGTGCCTGGCGAAACCCGACGATCAAAAGACAAACACACTCTTTGCCTCTTTGCAACTTGGCCGGAACTGAGCCAGTCAACTTGCCGTCAGAAGTTGCAATTGCCGCCACGTCTTGCTTCCATAGTTTCTTGAGAAGCCTTGGTCAGCATCATGGAGGAATTACTCCAGTCTTCGAATCCGAAGAAACTGCTACCACCACTGTTTCGACTGCAAACCCACCATTGCAGAAAAAAATGTCAATGAGCAGGTCATTCCGCACTGACTCGATCGTGCTGCTTGAGTCCGAGTCCGCGACTTCGACAGCGTCACCGGCTTTTGAACTTACTCTGATCATGAAATGTGTTTTGTAGATTCCGAAGTGGGCAACTGTCTCTCTGATTGGACGTTGTGACGCTTGTTCTCGATCAACATTTCTTCTGGATAGCATACTGCCAATATTACCACATGAATGTGCATTACCGCAAGCGCATGCATGTGCAGCTCTACGGGGTATGTGATCATGCCTGAAAGCCCTCGCCGATCGTTCACTCTGAGCAAATGGAAGCCTTGGTCAAATTTTTTCCTTCCAGAAGATAGATCTTAAGGACTTGAAGATTCGTGCAGATTGGTAGCACTACACTTGGGTGTAATTGAACATGTGGGAAGGCTTGCTCCGACGACCTCGATGGCTGGACCTCGGAATTGATAAAATTAATGACATGTAGGCTGAGATACATGCGCAAGGCCAATCACCTAACATACCTGGTTGGTGCAATTGTGCAGATCCTGCACATGTAGCCACTTCTTTAGTCAACAGTCGAGTATCAAGATCTGTGAACTATGTCATCGCTTTGCCACTCGACGACTCGACTAGCTAGCTTCATCAGGTAAGCCTGTGTGACCTTCCTGTCCCCGTTGATCAATGCCTGAGTAGTTCGCGGGTAGCATGACCGGCTGGTAAATAGATTCGGAGCCTCGACGCTCCGCTAGCGAGTCCCAGGCCCTTACGAGAGCAAGCATCGCAGGATGTGTTTTCGTCTTCGTTTCGGATGCAGGCTCCCGTGTTTCACGTCTGATATCTTCTCTCAGCAAGGCTTTCCTCGCCATTACGGCGTGGTGCGGGAACAGACATACTCGTGTGGGCTCATCCGAGAAAATAAAATACCGCGGCCATCCTGTCCACGGTTCTCGTGCGATTTAGTCTAGGTTTATTTTTTCTTTTTTCTGGGTACATTGAAACGCAGTACGAAACCATTCAACATGAGCTGAGTTGCTCCAGTGAGAGCCATTACTTTTGCAGTCCCATATTGAGCTCACATTATTGCCGGGTGTGAGAGAATGATGAAGTCCCCGGCTGGCACACGTGCGCGCACTTCGATCGAATGTGGCCATCCTTTCGGAATACAGACGTGCGCTACTCCTGAACTCTTGGAGTAACAATCTCCGTCACTATCTTTAGCTGTTGTGTTGTGCGTGGGGGAAGTATATCTCATTGTTGTACCTGGTCACAGACCCGTAATCGTAGATTGAGCCGCAGCGTCGAAGAAGTAGGCAGGTGCTTGAATTCTAATCTCTAGTTTTCTGTATTTAAACGAGCAATCATAGCCTCAGCTAAATGACTCGATTGAAGAGTGGACATGTCAGCGACAGCCTTTGCATTGCATGCATCCGGCGTGCGTTACGAAATGCATTCCCACCATTAGCCTTGAGGAGATGGCGAAATCCAAGCCAAAGCTTCGCCGCTGCTACTTGACAGACGCTGCCTGTTCTCTATACTCCGTTGTCCCTGGGACTTGAAATTGGAACTTTCGGTAGTATGGGAAGCGTATTAAATGAGTTTAATTTTTCCCTCAACTTCGCTACCCATGAATGCGAAGCAAACTGCTGGGACCTATTTCGTTGCGTGCCCGTCTGCAATCCGCGCGCAACAATTTCGCCGACGCTTGAAGATCTGGTTATAGAACTCAAGCGCAGAGCGCATCAAGCAAGTCGCGAGGCGTACAACGTGGGATTGTTCTTGTGTTCGCACTGTTGATCGTGTCTAGATCTCATGAGTGAGTCTCGTGACTGTTGACATAGAAACACCATGAACGTGCTCGAGTCGGAGCAAAGCTGAGTTCCATCAGCAACTGTAGCAGAAGTTTTCGGGGGGAATGATTGTTTCCTTGGTACCCTAAAGTCATGACCCGAGGCATGGAAGGAAGGAAGGAAGGATGGGTGAATGATGTCCGCGTGAAAGGCCTTTGTTTGTTTATCTGAACAACTGTCATACTTCTTTTCTTTGACTTTTGTATGCTATTTCTGATGCGCTCAGGTCAACCTCCGAAACGAGCACAGTGGCTGCAATCTCTTATATTCAAATTTTTTGTTTGTTGCAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGGTAGAGCTCAACCTTTAACTCTTCCAATTTAAGACGTGGCCTTCGTTTTCCGAATTGAATGTAAATTCGATTTTTTCCGTCTACCATGTTCAGGATTGAGTGAACTTTCAGAAAGAGAGGAGAGACTTTAGATAATGCAGTGATTCTGCTTGTAAGCAGTACGTCAAATTATGACCTTTAGAGTTTGTGGGCTTTCACAACGACCGATTCCTTGTGAGGCGAATTAAAAACCATGTGTACGGTCGGAAAACTGCTCACGTTGATATCTAGAATATAATTTCACTTAGATACATGGTTGTGTTCATGTTCGGCTCTGTGAATTGGGCTGAATTCGATAGTTTGGGACATCCCAAGCATGTTCTGAATTTGCAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGGTGAGATGCCCGTCTTACATAGGTTTTGAGGGCGGACTCAGAGTCCCTGTTCGTGAGGTATCACTGTTATCACTGGACTCCTCAGTATCTGCTTTCAATTTCAAGTGTAAGACCCGGTTGATGTCAATTGGATAGAGATTTTTACGGCATGGCGTGTATTATTCGGAAGGTATGGCGGAAAGTAGTACACTGCTTTTTGACATAAGCTCTTCAATTGCCTTTGAATGATTTCTGATTGTCATCGAAGAACAAGTATAAAGAAATCAGATGTCTGGGTGGCTGGGGACTATACGTGGCAACTGCCTGCCACTTTTTTTTGTCCGTATGGCAATGCCGTGGCCAATGTCCCAATTTTCTGTGGCTGCATGGTTGGTGAAAGCGTACACAAGGCATTAGTTGTAGATTAACTAGGTTCTTAGGCGTGTACATCAGTACTTGACTGTTCTGAGTAGGTGATGCCGGTAGTTGCTGATTTGATGCGATAGAATACAGCAAGACGTAGTCTACACGATCAACGATAACAATTTTTTATACCTATTGGCTGCCTGCAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTGCCTAAATCCTTCTTGTCTTCAATTCGTCATCGCTTTTGCAAGAGGCATGTTGCGTCTGCTATATTCAATGAAACGAGACATTGAGGCAATCATCGTGATCTGTACATGCTTGGACGACAAGAGAAACCAATCATCCACAATCGATGGACTCGGAGTGTTTGCTTCTTCTAAACTTAGCGCCGCAACGGCAATGTTTATGATTGCAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGTAAATTTCAAGCCTATTCTTTTGCTATATATCATGTGTCAGATTGAAGTCTATTGTTGTGAAATTGAAATTTGCATAGTAGAAATACGTAACGCGCCACCCTTGGATTTTGAGGCTATCATAGCGTGTACATCGAAAATTGGGCTTGTGGATCGACAATTCGCCAGTTGGTCAACATAGCTTGATTGATAACCACCGGCCTGTCTTTGATTTTGACATTTGCATCCTTTCACCGCAGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTAAGCACCGCTTTTACCAGATTCCAATTTTCTTCGTGCGATATGAATCTGAAATGTCTGAACTTAAAGCAGGAATTTCTTATTATCTTCGAATTTCGAGGCTCTGAGATATTCTACAGACGGTGATGAAACTCTTGCTGTAATTAGCCCCTCGCTAAGTGAGTCAGGAAACAAGATTGACGTGAAAGTGGCACAAAGTGATGGAATTTGGGTATGCTAATTTGTGTGTGCTTTTGATGGAAGGCCGATCATCAAAAGTCAACCGACTTGCTTTGTCCTGATTACACCAAATGTGTTGAGGTTAGGTTTGCAAGAGAATGCGACTTCAGTCATGTCGATCCGTAGATTCGAGTCCTTCCTTATAATGGTCGATGGCCCTGGCATCCTGCAGGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGTTTGTGGAACAGACGTCCCCGCTTTCTCGTATGTGGAGGCAGCCTCCAGCAATCGTGCTCAGCTGCTTGTTGTAGATGGACAGTCTCAGAACTTAGGCAGCTTGAATAAGCATCAAGGAAAGGCATCTTCAGATGATCGCAATCACAACTACATGACGGTGCAGGGACAGAGTACTGCTTCAGACCACGATCCGACGGAGCTGGATGGAGAAAGTGTTTATAACTTGGAAGAGTTTCCGAGCCTGATTGAGGCCGAAGAAATAATTGACATTTTCCCGCTGGATAGTGACAGCAGCGAGGCTCAGCTGAGCCCGGTTGAATCGATTCAAGTCGTGCGAAAGACGCACCATATGAGGGCTGACCTAACTTAAGAGAGGAGCTTGACTCAAGATCGAGCAAGCTCAAAAACATCTCTCATCTTTGGCCAGTGTGGTAATTATTTTCCTTCCCTGTCTTCCCTGCAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAGAGATCTTCTTCGGTGATGTAACACAAGATTGAAGTAACTTCTAGACGCCTACAGGTGAGTGGGGCTCGGCTCCGGACACTTCTGACATGAACAGTTGTCCATGGCCACCCAAGTGAGACCACCTGTTGTTCGAACACTGACCAGTACGAGTATGGTGGAGTCTCAATCACGCAAGTCATCATCATTCTACTAACCGGTACGAGCGACCTCACGATCTGATCTAGCACTCGCCTCCAGGAGCTATAGTTAATGGCATTTCCTGTCCTACTTCACTTTTCTATGAGTTCGGTTACCACATACTATGATGCTGCTGCTGCTGCTGTAGACTTTACCAAGGTCTCGCCGCGACTGTTCCAGTAGTACAGTGGGGCAAGCTTCTCTTCTTTCGGAACTGGATCCGGTCTGGGTGGTTTGGATCAGTCGGCTGTGAGATGACGCTCGAGACTTGATTACACATAAGACTCCTCCTGCCTCCCTTACATTCATCGTAATTTAATCGTTATTTTAAACCTCCTCCTTTTCCTATTTTAGAAGCTAAGCTAAGCTAGCTACACACTACCTACTTAGCTTGAATTCATTTATTGGTTTCAATTTTCATACAGTAAGGTATGTAAGTAGCGAAGGTCGTGACCACAAACTAGACTTACATTCCATTGTAGATTCTTAAGACCTAAGCACACGCCAGCAGAGCTCTTTAGCCGGTGAAGGTGAACTCCGTGCCGACGTGTTGGCACTACTCTGTACTATAGCGGAAATGGAAACAAATTGCAGCAGCTAGACGTTTTAGTTTTATCTAGTTATGGTCTTCCCTGCCCAGACCAGATAAAAACGCCAAAAACTTAAGATGACCATCTCATAGCTGGGCCTCGCACAGATTTGCTGCGCGCTTGGACCAAAGAGTAGCGTAGCTGATTTGGAAATTGGTTGTACAGGAGGATAATTACCTATGACTTCTTATCGTTTGTCGAAATTCATGAAGTGCGTCTCTGCATATCTG

mRNA

>Mapoly0474s0001.4
ACCTCGTCGCTCGTCTCGCTCGTCTGACCTCCGTCAAGCGACGCACCTCTCGTAGGATCTGAGAAAAAGGCTTCTGTCAGCCACCTTCTGTACATAAGTCGGACCCCCTCCGGGTCCATCTCCTGCGGTCGGACTGCACTCGTCGTGTGGTGTAAAATAAACCTCTCTCTCTCTCGTCCTCTCTCTCGACGCTTAAACCGCTCCCCCGGCGAGTCACGGGTGCGTCTCGTCGACTTCGCGCGCTATCATCGATATCAGAAGCTTGTTTTGGCGCACTCTGAACACTCGCTCGTCTCTGGAGGAAGTCGGCACGAGCGAGTGGCTTATATAGGTGATAGGACATTGGTCATGACAACTCACAAATTGCAGTAGCAAAATCTTCACGCATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGCATGTTCTGAATTTGCAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAGAGATCTTCTTCGGTGATGTAACACAAGATTGAAGTAACTTCTAGACGCCTACAGGTGAGTGGGGCTCGGCTCCGGACACTTCTGACATGAACAGTTGTCCATGGCCACCCAAGTGAGACCACCTGTTGTTCGAACACTGACCAGTACGAGTATGGTGGAGTCTCAATCACGCAAGTCATCATCATTCTACTAACCGGTACGAGCGACCTCACGATCTGATCTAGCACTCGCCTCCAGGAGCTATAGTTAATGGCATTTCCTGTCCTACTTCACTTTTCTATGAGTTCGGTTACCACATACTATGATGCTGCTGCTGCTGCTGTAGACTTTACCAAGGTCTCGCCGCGACTGTTCCAGTAGTACAGTGGGGCAAGCTTCTCTTCTTTCGGAACTGGATCCGGTCTGGGTGGTTTGGATCAGTCGGCTGTGAGATGACGCTCGAGACTTGATTACACATAAGACTCCTCCTGCCTCCCTTACATTCATCGTAATTTAATCGTTATTTTAAACCTCCTCCTTTTCCTATTTTAGAAGCTAAGCTAAGCTAGCTACACACTACCTACTTAGCTTGAATTCATTTATTGGTTTCAATTTTCATACAGTAAGGTATGTAAGTAGCGAAGGTCGTGACCACAAACTAGACTTACATTCCATTGTAGATTCTTAAGACCTAAGCACACGCCAGCAGAGCTCTTTAGCCGGTGAAGGTGAACTCCGTGCCGACGTGTTGGCACTACTCTGTACTATAGCGGAAATGGAAACAAATTGCAGCAGCTAGACGTTTTAGTTTTATCTAGTTATGGTCTTCCCTGCCCAGACCAGATAAAAACGCCAAAAACTTAAGATGACCATCTCATAGCTGGGCCTCGCACAGATTTGCTGCGCGCTTGGACCAAAGAGTAGCGTAGCTGATTTGGAAATTGGTTGTACAGGAGGATAATTACCTATGACTTCTTATCGTTTGTCGAAATTCATGAAGTGCGTCTCTGCATATCTG

CDS

>Mapoly0474s0001.4
ATGCACAGCACTGTGAGTTGGCGGCCAGCGCCCTCTGGATGTATGTCAGGCACTTTGAACGACGTGTTGATGTTCACAAGTAGAAATCGACCGGCAACGTTGGAGATGTCGGAGGACAAAGATGTAGAGGACAAGGATTTGAATCCCATCGAGTGGCAGCTTCTGAGAGATGGTGTTAATGGCACCAACAGTCGACCGAAGCCCAGCGATCCTGACTTCAGATTACCATTTGGCAGTAGTCAAAAACAGCACGTAATGGCCCCAGCAGCACCTCAGTGGGATAGCGCACGGAATTCTATGGATGGTAGAGTTGTTGTAAACTACCTCCGATCGTTCGGACCCGGTCGCTCGGATTCAAGCACCTGCAGTGTCGAAGGACAGGTTAGAGGAATTAGACGCTCCTTAGATGGTCATTTGCTCAGTAGTATGGTGAATAGGGACGAAGTCCCTGATAGGGAGGAAGAATTTGGAACGGAATCGCAGGGACTCTCGAGTCTTATTTTGGGTCAAGGCGTACATAGTTCAGCCCAGCTCTTTGGCTGCGGCTTGGTTGTACAATCCGCTGCTACCAAAGGACAACAGCAGGTTCACAGGGCTCCGCATTTCCGGAACCTTTTCCCTGAGCAATCATCGAGCTTTTCGAGTGTGCTGACCCAGGAGAGCTTGCCCAGCGATGTCAACGAACACATTCATCCCCAGAAAAAGCCAAGAAGGTACGATTTTGTTGAACCTCTTTCTCAGGCGGAGATCGACACGATACGGCTGAACGAGGAGTCCCATTACCGGAATTCATATCCTCCGCGAGGTGCACCGCTCGCAGACTTTATTGATGCCCACCACAGCTATAAGATTCCCGCGGCTTCTTTTTCAACATCTCTGCCTGACAGGCCGACTTTTACCTCCAACATACCATTACAGAATCTTAGCCTTTCTAACTATCAAGTGTCCAGTCCATCGGTGCCACTGAAGTCCTCCTCGAATGATACTTCTTCGGCGAGAACTCCGCTCGTCGACTATAGCTACTCATCAGTCGATACCAAGCTGCAAAACGGAATGAGGAGCGTTGCGCGAGGTGGTCCTTTACTTTCCGGGGGAGGAGGATTCAAACCACTGAATCTCATGGACGGACCGACCCAAGCAGCCGTAAGTCGAGATTATCTGCAATCAGGCTCGATGGGACAGGTCTGCTCCATTCGCCCAACATCCATGGAAACTGGAAGTAGGGCTGCATGGCCTGCAGGTTTCATCAACTTCCCTCCTCCCACTTTGGAAAGTTCTGGATGTGTGATTCCAGGCATGTCCTCAAGGCGAAGCTTGCTCGATCTAGATCACCATCATCACCATCACCATCATCATCACCATGAAATGGCTGCGGAAGAACGAGAGCATGTTCTGAATTTGCAGGTTCAAAGAGTTCATCCAATTTCAGAATCTCAACTACGATTGGTGATACAAAAGCAGCTCACAACTACAGATGTCGGTTCTCTTGGCAGAATTATTTTACCTAAGAAGGAAGCCGAAACTCATCTTCCTCATCTCCCCGACAAAGAGGGGATTGAAATGTGTCTGTATGATCATGACGTTGATCGTACGTGGATAATGAAATACAGGTTTTGGCCCAACAATAAAAGTCGGATGTATCTGCTTGAAAATACTGGGGAATTCGCCAAATATCATGGTCTCCAGCAAGGCGATCTGTTGCTCATTTATCGGCAACTTCCGGCGCGCTATGTTTTGAGAGTCAAGAAAATGGCGCCACCTTTGCGTCTCGTAACCCCTCCGCAGAGCATTTCTGAGTCCGGGGGAGCCGAGGATCTGGTTTCAGGTGCCGCTGAAACAGTATCTTCTCGTGCACTGACCTCCTCAGCATCTTCCAGGACTTTGAACTCCTCCTCAGCAGCAAGCAAGGAGGGCCTCTGTATCATAACATCAGCTCGACCCCACCTCCACACAATGTCATAG

Protein

>Mapoly0474s0001.4
MHSTVSWRPAPSGCMSGTLNDVLMFTSRNRPATLEMSEDKDVEDKDLNPIEWQLLRDGVNGTNSRPKPSDPDFRLPFGSSQKQHVMAPAAPQWDSARNSMDGRVVVNYLRSFGPGRSDSSTCSVEGQVRGIRRSLDGHLLSSMVNRDEVPDREEEFGTESQGLSSLILGQGVHSSAQLFGCGLVVQSAATKGQQQVHRAPHFRNLFPEQSSSFSSVLTQESLPSDVNEHIHPQKKPRRYDFVEPLSQAEIDTIRLNEESHYRNSYPPRGAPLADFIDAHHSYKIPAASFSTSLPDRPTFTSNIPLQNLSLSNYQVSSPSVPLKSSSNDTSSARTPLVDYSYSSVDTKLQNGMRSVARGGPLLSGGGGFKPLNLMDGPTQAAVSRDYLQSGSMGQVCSIRPTSMETGSRAAWPAGFINFPPPTLESSGCVIPGMSSRRSLLDLDHHHHHHHHHHHEMAAEEREHVLNLQVQRVHPISESQLRLVIQKQLTTTDVGSLGRIILPKKEAETHLPHLPDKEGIEMCLYDHDVDRTWIMKYRFWPNNKSRMYLLENTGEFAKYHGLQQGDLLLIYRQLPARYVLRVKKMAPPLRLVTPPQSISESGGAEDLVSGAAETVSSRALTSSASSRTLNSSSAASKEGLCIITSARPHLHTMS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>