Mapoly0737s0001



Description

CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_155654
PFAM PF00170 BZIP transcription factor
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF110

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP15 transcription factor, bZIP Mapoly0737s0001.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0737s0001.1 scaffold_737:3926..7001  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0737s0001.1  

Gene structure:

mRNA scaffold_737:3926..7001  ( + strand )
five_prime_UTR scaffold_737:3926..4432  ( + strand )
CDS scaffold_737:4433..4608  ( + strand )
CDS scaffold_737:4893..5471  ( + strand )
CDS scaffold_737:5700..5775  ( + strand )
CDS scaffold_737:5898..6626  ( + strand )
three_prime_UTR scaffold_737:6627..7001  ( + strand )

Sequences:

Gene

>Mapoly0737s0001.1
CTGGGACGATATTCATCTCTTACGAATTATTCGGCCTCGAGACAGAGACATCGACATTTTAGACAGAGAGAGAGAGAGAGAGAGAGAGAGAAGAAAAGATCAGACGAGAGCACAAGAGAAGAAGACCGTGGAGCTTTTTTCTTGCTCACACGTCGGAGGAGGAGAAGAAGAACGAGATTTTTGCCATTTGGCTCGCTTTTAGGTAGAGAGGAGGAGGAGGAGGAGAAGAAAACGGATCTCCACACGAGAGGAGGAGCCGTCGACGGAAGAGGTGGTAGAAGAAGAAGAAGGAGAAGAAGAAAACACGTGGTCGCGGTGGAGTGTTCTTTGGCGGTCGGCGTGGTTGGTGGTGGTGGTGTCGGTTGCGATTTGTTCTTTTGTGGGAAGAGGAGAGTTGTGGGATTATTGAGAAGCGGGGAAGAGAAAATCTGTGAGAGTGTAGAGTGACAGGAGTGCGTGCTTTCTTGAACGGCAAGGAAGAGTATTTTTTTTCTATAGCGCACAGTCATGTGTCGTCCACCAGATGTGACGACGCCCTCCATTCTCCCAATCGGGAGAAGGAGAGATGTGAACCCGTCCTCATGGACGCCTGATCCTCGGACCAATTGGGGCGCTCCTCCGCCCCAGGCTGCCGGAAGCTCTTGGCCGTCATGGGTGGAGTTTTTCAACTACCCACAAGCAGGGTATTGTTTTCTCATTCACTACTGTTTTTCGTTAATCGTGGTGCTGCTAATCGTGTTTGTCTATGTTGTGGCCTCGTGCATATTACTATGAGATCCTTTGAGGAGGGAAGCCGCAGCACATGGTAATGGGGCTTGAAGAAGTAGAATTATTTGATTTGTATGTGCCCGGAAATAGAGACCGCTCGAAATTGGAACCCTGTATTGTTTGCTACATCCTAGCGTTGTGAGCTCATTTTCGAGACTGGAAAGGCCGGGTTTTCACCGTATTGTTATGTTGTTGTCAGATTTCCGAAGGACGATGTTTGTGCATCAAATGTGATCGACGCAGCACCTTTGGGCTCTCTTTTGGCTTCTGCTCTCGCACAGCAAGAAGTGCCGAAGACATGGCAGCCACAACCAAATTGGGCTACGCCGCAGTCGAACTCGTTTTACTGCGACACCCAAGCTATGCTTTCGTCGTATGGTGGTGGTATGGATGGTGGTGCTGCACACTTGCAGTCGACACAGGGTCCCGCATCCGAGATGGGAATCGCGACCACAAGCTCGATTGCGGCGACCGAAGAGCCTCTGTCTTTGGAGGGCATGGAGAGGCTCAAGGAAGAGGACAAGTCGCAGGGAGGGCCTTGGGTCGAGGAGGTCATCCAGGAGGGTCGTTTAGAACAGGACACTTCCGCCAAGAAATTGTGCAATCCCTCCCCCAAGATTGCGAAAGCCGCATGCCAGAAGCCTAAACCGGCAGTACGACCCGGAGTGAAGAAGGAGACGACGAGTCCGAAAGATGTATGCATGTTGGATTCCGACATGGAGGGGTCGGATGACGATGGAGAGGGAACTCCTGTCATCAGCGAGAAGCGCCGAAAGAGGTGCGACTATTTTCGAAGGCATATGTTCGGAGCATCAGTTTGTCAACTGATGGTGGATGGTGGTTCACTATATGGTCGTTCTTTTATTTCTCCCTGACTCAAGGCTAGTGTATCTATGTCGAGATCGGGATATCTTGTGGTAGGTTCTGAGCTTGGTTGCTTTTTCCTGAAGAGAATGCATCAAATGTTTATGTGCCGATGACCGACCGTAGCATTTTTCTTGTGCAGGATGTTGTCGAATCGGGCTTCCGCTCAGCGTTCAAGGCAGCGTCGGCAGGAGAGACTCGATACGCTTGAAGTGCTGGTAAGCTCAAGTCTTTTGCGGTAGTCACGAGAAACATCTGTCAAATTGTCATCTGCTGCGAAGTTGTCATTCTGTACAAGGAATTCTGAGACAAATCTGTGGCGTGTGTTGGCTTCGTGCAGGTTGCACAGCTCCGGGTGGAAAATGCCGCGCTCACGCGCAAGGCTAACAGTGCAGTAGCCACTGCGAAGAAGTTGGAGCATGAGAACAAGGTACTCCGAGAGCGGTTGGAATCGAAAGATCAAAATCGAGGAGGTCGGGACCAAAACTCTCGGCTCAAGGATGCTTTAGACACCGATGATCAGAGTCTTCAGACGACCGGAGGCAACAGTGCCGGAGTAAAATTACCAGAAACTGGGACAATCTCAATGAAGGCTCGAACTGGAGACAGCGACAGTTCTTCCGAGAATAGCGATCCAAACAAGCAAGACGGAGAGCAGAGCGTGAATAACACTTTGAATAATGTGAACAGCGCAAACACCAACAACGCGCGGTCGACAAGTCAAAGCTCGAAGAAATCAAAGCGTAGCTGCGAAGATGCTATGGAGAAAGAGTGGAGCTTCAACTCGAGCTTCAGTTCTGTTTTCAATTCAGAAAACATGGAACAGGCCGGGAATGCCACGTGCAAGATGTCTAAGCAGAGAAGCGCACCCCGCCTTGGAGTAACGCCCGAGTATTCGCAAGATTACGAAGCGATGAAGGGTGTGTCTGTGATCTTACCGCAAACCCCAGCCTTCCAAGAGCTGGCAGAGTTCGATATAGACCTCGAACATAGCCCCGATATTGACAAGAAATTACTGGAGTCGGTGGAGGAGATCTGGATGTTCTCGGACGACGTCTGCTTCAAATAAACTCATATGCTGAAGAAACGGATGAGTCGAGAAGAGAAGTAATGAACTAATCACCGACCAAACCACCTCAAACATCATACTTCCTCTCGCTCGAGTTAACTAGTAGGGAAATCGTAAGTCAGTGCCGTGTTTCGAAGGAGTTGCGAACTCTTTCAATCTTTTCCGTGAACTATACACAAACGCTTGTCCATCGGATCCGTGCCACAAATAACGGACTTGGATACTCCAATTTCTTCGGTGTCTTCATATTGTAGATGTACTGTAATTACTAATAGTGGTCTTTGATTCCTGGTTGTCATGTCACCGTCCCATGCTAACGGAACTTGTATATTGACGAGAGAAGTCACTTCATTACAATTTTCTGTTCTGTCGCTC

mRNA

>Mapoly0737s0001.1
CTGGGACGATATTCATCTCTTACGAATTATTCGGCCTCGAGACAGAGACATCGACATTTTAGACAGAGAGAGAGAGAGAGAGAGAGAGAGAAGAAAAGATCAGACGAGAGCACAAGAGAAGAAGACCGTGGAGCTTTTTTCTTGCTCACACGTCGGAGGAGGAGAAGAAGAACGAGATTTTTGCCATTTGGCTCGCTTTTAGGTAGAGAGGAGGAGGAGGAGGAGAAGAAAACGGATCTCCACACGAGAGGAGGAGCCGTCGACGGAAGAGGTGGTAGAAGAAGAAGAAGGAGAAGAAGAAAACACGTGGTCGCGGTGGAGTGTTCTTTGGCGGTCGGCGTGGTTGGTGGTGGTGGTGTCGGTTGCGATTTGTTCTTTTGTGGGAAGAGGAGAGTTGTGGGATTATTGAGAAGCGGGGAAGAGAAAATCTGTGAGAGTGTAGAGTGACAGGAGTGCGTGCTTTCTTGAACGGCAAGGAAGAGTATTTTTTTTCTATAGCGCACAGTCATGTGTCGTCCACCAGATGTGACGACGCCCTCCATTCTCCCAATCGGGAGAAGGAGAGATGTGAACCCGTCCTCATGGACGCCTGATCCTCGGACCAATTGGGGCGCTCCTCCGCCCCAGGCTGCCGGAAGCTCTTGGCCGTCATGGGTGGAGTTTTTCAACTACCCACAAGCAGGATTTCCGAAGGACGATGTTTGTGCATCAAATGTGATCGACGCAGCACCTTTGGGCTCTCTTTTGGCTTCTGCTCTCGCACAGCAAGAAGTGCCGAAGACATGGCAGCCACAACCAAATTGGGCTACGCCGCAGTCGAACTCGTTTTACTGCGACACCCAAGCTATGCTTTCGTCGTATGGTGGTGGTATGGATGGTGGTGCTGCACACTTGCAGTCGACACAGGGTCCCGCATCCGAGATGGGAATCGCGACCACAAGCTCGATTGCGGCGACCGAAGAGCCTCTGTCTTTGGAGGGCATGGAGAGGCTCAAGGAAGAGGACAAGTCGCAGGGAGGGCCTTGGGTCGAGGAGGTCATCCAGGAGGGTCGTTTAGAACAGGACACTTCCGCCAAGAAATTGTGCAATCCCTCCCCCAAGATTGCGAAAGCCGCATGCCAGAAGCCTAAACCGGCAGTACGACCCGGAGTGAAGAAGGAGACGACGAGTCCGAAAGATGTATGCATGTTGGATTCCGACATGGAGGGGTCGGATGACGATGGAGAGGGAACTCCTGTCATCAGCGAGAAGCGCCGAAAGAGGATGTTGTCGAATCGGGCTTCCGCTCAGCGTTCAAGGCAGCGTCGGCAGGAGAGACTCGATACGCTTGAAGTGCTGGTTGCACAGCTCCGGGTGGAAAATGCCGCGCTCACGCGCAAGGCTAACAGTGCAGTAGCCACTGCGAAGAAGTTGGAGCATGAGAACAAGGTACTCCGAGAGCGGTTGGAATCGAAAGATCAAAATCGAGGAGGTCGGGACCAAAACTCTCGGCTCAAGGATGCTTTAGACACCGATGATCAGAGTCTTCAGACGACCGGAGGCAACAGTGCCGGAGTAAAATTACCAGAAACTGGGACAATCTCAATGAAGGCTCGAACTGGAGACAGCGACAGTTCTTCCGAGAATAGCGATCCAAACAAGCAAGACGGAGAGCAGAGCGTGAATAACACTTTGAATAATGTGAACAGCGCAAACACCAACAACGCGCGGTCGACAAGTCAAAGCTCGAAGAAATCAAAGCGTAGCTGCGAAGATGCTATGGAGAAAGAGTGGAGCTTCAACTCGAGCTTCAGTTCTGTTTTCAATTCAGAAAACATGGAACAGGCCGGGAATGCCACGTGCAAGATGTCTAAGCAGAGAAGCGCACCCCGCCTTGGAGTAACGCCCGAGTATTCGCAAGATTACGAAGCGATGAAGGGTGTGTCTGTGATCTTACCGCAAACCCCAGCCTTCCAAGAGCTGGCAGAGTTCGATATAGACCTCGAACATAGCCCCGATATTGACAAGAAATTACTGGAGTCGGTGGAGGAGATCTGGATGTTCTCGGACGACGTCTGCTTCAAATAAACTCATATGCTGAAGAAACGGATGAGTCGAGAAGAGAAGTAATGAACTAATCACCGACCAAACCACCTCAAACATCATACTTCCTCTCGCTCGAGTTAACTAGTAGGGAAATCGTAAGTCAGTGCCGTGTTTCGAAGGAGTTGCGAACTCTTTCAATCTTTTCCGTGAACTATACACAAACGCTTGTCCATCGGATCCGTGCCACAAATAACGGACTTGGATACTCCAATTTCTTCGGTGTCTTCATATTGTAGATGTACTGTAATTACTAATAGTGGTCTTTGATTCCTGGTTGTCATGTCACCGTCCCATGCTAACGGAACTTGTATATTGACGAGAGAAGTCACTTCATTACAATTTTCTGTTCTGTCGCTC

CDS

>Mapoly0737s0001.1
ATGTGTCGTCCACCAGATGTGACGACGCCCTCCATTCTCCCAATCGGGAGAAGGAGAGATGTGAACCCGTCCTCATGGACGCCTGATCCTCGGACCAATTGGGGCGCTCCTCCGCCCCAGGCTGCCGGAAGCTCTTGGCCGTCATGGGTGGAGTTTTTCAACTACCCACAAGCAGGATTTCCGAAGGACGATGTTTGTGCATCAAATGTGATCGACGCAGCACCTTTGGGCTCTCTTTTGGCTTCTGCTCTCGCACAGCAAGAAGTGCCGAAGACATGGCAGCCACAACCAAATTGGGCTACGCCGCAGTCGAACTCGTTTTACTGCGACACCCAAGCTATGCTTTCGTCGTATGGTGGTGGTATGGATGGTGGTGCTGCACACTTGCAGTCGACACAGGGTCCCGCATCCGAGATGGGAATCGCGACCACAAGCTCGATTGCGGCGACCGAAGAGCCTCTGTCTTTGGAGGGCATGGAGAGGCTCAAGGAAGAGGACAAGTCGCAGGGAGGGCCTTGGGTCGAGGAGGTCATCCAGGAGGGTCGTTTAGAACAGGACACTTCCGCCAAGAAATTGTGCAATCCCTCCCCCAAGATTGCGAAAGCCGCATGCCAGAAGCCTAAACCGGCAGTACGACCCGGAGTGAAGAAGGAGACGACGAGTCCGAAAGATGTATGCATGTTGGATTCCGACATGGAGGGGTCGGATGACGATGGAGAGGGAACTCCTGTCATCAGCGAGAAGCGCCGAAAGAGGATGTTGTCGAATCGGGCTTCCGCTCAGCGTTCAAGGCAGCGTCGGCAGGAGAGACTCGATACGCTTGAAGTGCTGGTTGCACAGCTCCGGGTGGAAAATGCCGCGCTCACGCGCAAGGCTAACAGTGCAGTAGCCACTGCGAAGAAGTTGGAGCATGAGAACAAGGTACTCCGAGAGCGGTTGGAATCGAAAGATCAAAATCGAGGAGGTCGGGACCAAAACTCTCGGCTCAAGGATGCTTTAGACACCGATGATCAGAGTCTTCAGACGACCGGAGGCAACAGTGCCGGAGTAAAATTACCAGAAACTGGGACAATCTCAATGAAGGCTCGAACTGGAGACAGCGACAGTTCTTCCGAGAATAGCGATCCAAACAAGCAAGACGGAGAGCAGAGCGTGAATAACACTTTGAATAATGTGAACAGCGCAAACACCAACAACGCGCGGTCGACAAGTCAAAGCTCGAAGAAATCAAAGCGTAGCTGCGAAGATGCTATGGAGAAAGAGTGGAGCTTCAACTCGAGCTTCAGTTCTGTTTTCAATTCAGAAAACATGGAACAGGCCGGGAATGCCACGTGCAAGATGTCTAAGCAGAGAAGCGCACCCCGCCTTGGAGTAACGCCCGAGTATTCGCAAGATTACGAAGCGATGAAGGGTGTGTCTGTGATCTTACCGCAAACCCCAGCCTTCCAAGAGCTGGCAGAGTTCGATATAGACCTCGAACATAGCCCCGATATTGACAAGAAATTACTGGAGTCGGTGGAGGAGATCTGGATGTTCTCGGACGACGTCTGCTTCAAATAA

Protein

>Mapoly0737s0001.1
MCRPPDVTTPSILPIGRRRDVNPSSWTPDPRTNWGAPPPQAAGSSWPSWVEFFNYPQAGFPKDDVCASNVIDAAPLGSLLASALAQQEVPKTWQPQPNWATPQSNSFYCDTQAMLSSYGGGMDGGAAHLQSTQGPASEMGIATTSSIAATEEPLSLEGMERLKEEDKSQGGPWVEEVIQEGRLEQDTSAKKLCNPSPKIAKAACQKPKPAVRPGVKKETTSPKDVCMLDSDMEGSDDDGEGTPVISEKRRKRMLSNRASAQRSRQRRQERLDTLEVLVAQLRVENAALTRKANSAVATAKKLEHENKVLRERLESKDQNRGGRDQNSRLKDALDTDDQSLQTTGGNSAGVKLPETGTISMKARTGDSDSSSENSDPNKQDGEQSVNNTLNNVNSANTNNARSTSQSSKKSKRSCEDAMEKEWSFNSSFSSVFNSENMEQAGNATCKMSKQRSAPRLGVTPEYSQDYEAMKGVSVILPQTPAFQELAEFDIDLEHSPDIDKKLLESVEEIWMFSDDVCFK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>