Mapoly1480s0001



Description

(UnKnown)

Reference DB

Database ID Description

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2L7 transcription factor, AP2/ERF Mapoly1480s0001.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly1480s0001.1 scaffold_1480:3315..4718  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly1480s0001.1  

Gene structure:

mRNA scaffold_1480:3315..4718  ( - strand )
three_prime_UTR scaffold_1480:3315..3484  ( - strand )
CDS scaffold_1480:3485..4032  ( - strand )
CDS scaffold_1480:4170..4243  ( - strand )
CDS scaffold_1480:4372..4416  ( - strand )
CDS scaffold_1480:4558..4718  ( - strand )

Sequences:

Gene

>Mapoly1480s0001.1
ATGAGAGGGATGAGCTTTCTGGATTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAGTAAGTCAACCGTGTGATTTGTCCATCGACTTCCAGAGTTCCGATGATATACTTTGAATCGAATTCAGCTACCTTTGAAATTCATGCTCAGCAGCATGTGCATTACTGATGCTCTCCACTAAATCAATTGCATATGTTCAGATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTGAGGTAAGAATCGTGATTCCGTGATAGCAAATAATTTCATTTTATGTGGACAGTCAAGAGAGGGCTGGTGCACAATTACTGAGCGAATGAATATTTATTGACCGGATTTCCATCCTGTAATTCGGCTGCAGAGCATACAATAAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGTAAGTGAATCAAGTACTTTATCATCATATGAAGGTTGATTATATATTCCCATAGTTCCTATTCTGTGACTGCAGTCTGTATAATTGATACAATCATGATCAGATTTATTTTTTAACTACCGATTTTCACCCTACAGGCTATCCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCGAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCTTCTGTAAACGTTTCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGATGCACATCTCCAAATGCAAGAAGAATGTCAGGGTCGTTCACAGTTCACGGATGCTGGAATCAAATTATTCAATCTCTTCCCTGGAGGCACACCTCTGGATTATTCTCTGGAAGTCCCCACATTCGATTTCTTCCCTGCAGAGCCCCTCTCCACGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGAAATTGATCTCACTCTCTGAAAGGACTTCAGAAGATGACCATTCGATACACAAAGTATCAGTTGTTATTATGTTGGAAGGAACGAGTTTACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAAACCAGAAGTCAATAGTTCGATGTATTCGAACTATTAACTATTGCTTCAGATGTATATTCCCG

mRNA

>Mapoly1480s0001.1
ATGAGAGGGATGAGCTTTCTGGATTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTGAGAGCATACAATAAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATCCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCGAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCTTCTGTAAACGTTTCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGATGCACATCTCCAAATGCAAGAAGAATGTCAGGGTCGTTCACAGTTCACGGATGCTGGAATCAAATTATTCAATCTCTTCCCTGGAGGCACACCTCTGGATTATTCTCTGGAAGTCCCCACATTCGATTTCTTCCCTGCAGAGCCCCTCTCCACGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGAAATTGATCTCACTCTCTGAAAGGACTTCAGAAGATGACCATTCGATACACAAAGTATCAGTTGTTATTATGTTGGAAGGAACGAGTTTACATATTAGGAGGAGACGTACTTGTTCCGAGGCCAAAAAACCAGAAGTCAATAGTTCGATGTATTCGAACTATTAACTATTGCTTCAGATGTATATTCCCG

CDS

>Mapoly1480s0001.1
ATGAGAGGGATGAGCTTTCTGGATTACAGACAGTTCTTGCGTGACACGAGTAGGAAGGCGGATTGTATCCTCATGTGCAAGTCGTCGAAGGGGATTCTGATTGATGCCAATGGAAAGTGGGAAGTGAAGTACTGCTCGAAAAATCATCAGCATAAATCCCAATATACTCTCGTCGGCTGGTTCGATACCGAAGAAGAAGCCGTGAGAGCATACAATAAAACAGCTTTGCAACACGGTGATGAAAGAGCCATTGTTCGAAGTTTTTTCAAGAAAAAAACCGGCTATCCTAGAGTAGCAAGTCCGACGAGAGATGATTCCGGTACGACGATTGAGAATACAGAAAGGACTTTAACTTTAGCCCATCCAGCGTCCAACAATTCCCACTCTTCGAAGGAGGAAGTGACGAGTGCATCACATCCAAGAGCGAGTTGCTGGGAGAGAGCAACAGATGCCTCTAAACGTGATGCTTCTGGATCTATGGAAGCTTGTGCTCGAGACGACAAGAATGATGATACAGAAATGCACGATGCTTCTGTAAACGTTTCAGTTTTACCGCAACAAACGGATGGTTCGAGCCTCTCAGACCCCGATGAACTAGAGGATGCACATCTCCAAATGCAAGAAGAATGTCAGGGTCGTTCACAGTTCACGGATGCTGGAATCAAATTATTCAATCTCTTCCCTGGAGGCACACCTCTGGATTATTCTCTGGAAGTCCCCACATTCGATTTCTTCCCTGCAGAGCCCCTCTCCACGGATAACCAAGATGTCAGTGGCTTAACACATCTCAAAAGGGAAGGACCTTTTGAAATTGATCTCACTCTCTGA

Protein

>Mapoly1480s0001.1
MRGMSFLDYRQFLRDTSRKADCILMCKSSKGILIDANGKWEVKYCSKNHQHKSQYTLVGWFDTEEEAVRAYNKTALQHGDERAIVRSFFKKKTGYPRVASPTRDDSGTTIENTERTLTLAHPASNNSHSSKEEVTSASHPRASCWERATDASKRDASGSMEACARDDKNDDTEMHDASVNVSVLPQQTDGSSLSDPDELEDAHLQMQEECQGRSQFTDAGIKLFNLFPGGTPLDYSLEVPTFDFFPAEPLSTDNQDVSGLTHLKREGPFEIDLTL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>