MapolyY_A0044



Description

protein phosphatase 2C

Reference DB

Database ID Description
EC 3.1.3.16 Phosphoprotein phosphatase.
GO GO:0003824 Catalytic activity
KEGGORTH K14497
KOG KOG0698 Serine/threonine protein phosphatase
OrthoMCL OG5_139205
PFAM PF00481 Protein phosphatase 2C
PANTHER PTHR13832 PROTEIN PHOSPHATASE 2C
PANTHER PTHR13832:SF219

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABI1 Type 2C protein phosphatase, group A MapolyY_A0044.1 Published
MpABI1A Type 2C protein phosphatase, group A MapolyY_A0044.1 Public

Transcript models

Transcript ID Location Sequences Gene model
MapolyY_A0044.1 Chr_Y_A:2194727..2204659  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

MapolyY_A0044.1  

Gene structure:

mRNA Chr_Y_A:2194727..2204659  ( - strand )
three_prime_UTR Chr_Y_A:2194727..2195097  ( - strand )
CDS Chr_Y_A:2195098..2195426  ( - strand )
CDS Chr_Y_A:2198777..2198882  ( - strand )
CDS Chr_Y_A:2200249..2200617  ( - strand )
CDS Chr_Y_A:2200747..2201649  ( - strand )
five_prime_UTR Chr_Y_A:2201650..2201691  ( - strand )
five_prime_UTR Chr_Y_A:2201805..2201893  ( - strand )
five_prime_UTR Chr_Y_A:2204104..2204153  ( - strand )
five_prime_UTR Chr_Y_A:2204434..2204659  ( - strand )

Sequences:

Gene

>MapolyY_A0044.1
TTCTTAGCTTAGGTCATGAAAAGGAGTAATCGATAAATCTCTGCCAAGACTCAGACACATGCACTACCTATTCTCGACAGGAAACGTCTTCGAACGCAAGGAAAGATTGAGTTTGTGTCCATGTGCGCTCCTCGGCGTCATAATGTAGTAGTATGCAGTCCCGATCATGCGGCCTGTATCCGACTTGACGCTTAGTGCGAACACCCTTCCAAAACAGGACGCGCTGGTATGACGAAGCACGTAGTTTGGTTGTAGTTACTATGCCGATTGTCACCAGTCCAGGTTCTGATTGCAGTTCCACGTCTGGTGTACAGTCTTCTACTTTTCGCACGAAGAATGAAGTATCGGACGTAGCAAAAAGCTTGAAACTTTGAAGTAATGTTACACGCAGTATAATGTTCAAGTTATCAGTTGCCAGCGTTCTGTATCCTGGAAATTCAAATTTCAGTTGAGTTCGCCTGTTTCTTTCAACTCTAAATTTTGAATTGGATTCGTTGTTTATGCAGCCTGAGAGTTTACATCAAGATTGGAACGGCGGGTCGCTTGTCCTCTTAAGGTAAGAATTGGCAGAGATTGGCTCTGCTCTCTCCTTCGTTTCAGTCTCATCACTTGTTTGTTGCTCAGTTAGGTACGCTGTGATGGCAAGTATACTTCTTGTGTGCGAAGAAGCCCAGTAGGCATGATCGACTGTCAAGCACGCGGAGTGGTTTTAGAGCAGTCATGGTTTGGTTTTCCTCGTTCGGTGGTATGATGTAACGAACAGTGGTTGTTTTCTTGTAAACCACCCGGCTGTGAATGAACTACATAGTTTCTGCAGTGTCTACCTTTTTGAAGAATCGTCCGACGTTTCTTGGTCTCAATAATTGGTCTCACTGAATTGTTTTTTTTAAAGCTTTCATTGGAAATCCAACCTCGTCATCATGCGAAGTTTTTTTTTTGGATGACGTTGACGAGGTCGATGTGGTCACACGAAATCACAACATCCTCTACCGGAACTCGTAATGTTGTCATTATGACTTTTGTTCGGTTTTTTTTTCTTTGCGCGCCGTACATTGTCTTGACTTCCTCTTTCGTTCATGCCTTCTCATATGCCTGTACCAATGCTATCTTTATGTTCAATCCACTATGTCTCCTGAGTTGCACTGGTATTAGAAGTCACGGTCTAGATGTTGTCTCTCGTTGCCTTTGATGACCTACTGTTGTTTTAAGGTTTGATGAGACGTTTGGGTGAATCTCGGGTAGTCAGAGAGACATTTGATGAATATTTCAATAGATCTGTTCTTCATTGAATGCCTTTCCTTCTTATGTTCCATTCCGATGTTTTTGTTGTCCTCTGCGTCGCTCTTTTGATCTCTTTGTCCGCATAAATTTTGATATATTTGTACAGAAGCCCACTTATTTACTTCCTATCCCGTACTTAAATTCTGATGCGGATATAACCACACGGGTGGCCTTTCTTTGAAATATTCCAGATGTTCGGTACGGGCTAGCCTTTTACAAATAAGACATCGGAGTTCCCATCGGTTCTTATTCTGCAGTTTTTCCAGTAGATTTCTTTCTTCGAGTGATGAGATATGATTCCTCTAATATCCAACTCTCCATGTTAGAGACTAACAACTACCGTCTACTTTTTGGGACAATATTCTTTCTACACGTCGTTTTGTGGATGATCTCTGGAAATTCATCTCCCCTTATTTCTATTCTTCTATGTACCTCTCTTACAAGGCAAGCAGAGGATGCATCTATTGACCTCATTGGTGCGAACTTGCCCGCTCATCATATGGTTCACATAGCAATGTCTTAGATTCTCTAACCACACAGAACAGGATCCGACTATTGCTACTCGAAAATAGAAATGATCAGAAATATTCACTTACACAATATGTTGCATAATTATTAGGATGCGTGATAAAACTCATACTGGAACACAGGGTTCAAATCAGAGCTACACACGTGCTACAATGGCAATTACAATTGGAAGCGATTTCGGCGGATAAGGGCAGACTGCATCTTCTTTAGCTGACTGCATAAGTTGGCGAATGTGCACAAAGTCAACTACCTTTTATTTTCGAAGTAACTGGTTGTTTTAACTGTTTCAAATAGAGGATACCCGCTTCTGAAGTTCCTCAGGAGAGGATGTTTCTTTGCGACATAGACGCTACGACGTTCTCAGCCTCGATGAAGTTTAGTTCTATCGAGAAGTCACCGAAGCTGGGGAGGTTACCGGAGTATTCAGATGATGTGAATCGTGGGTTGGCTAAGTTGTACTTCGATTCGTGTACAATCCGGCCGCAGAATGTTTAATTGTCCTTGAAAGTAGTTTCTTGTCTTGCCTGTAATTCATCCACCTTTTGCTTCTTAGCGGTTGTAGTAGGTACAGATTGGGAAGAAGATGATGTAAGATAAGATGACCTAAGATGGAGTGTGAAGACGATATGAGAGGGCGGAGGCTCCGTCTATCACGAATCCTGAAACGAGGTTTTTTCAAAGGTTCCACCTGGAAGCTCTGATGAAACCTCTTTTCTGGACTCTTATTAGGAAGAATTCTCGTACATATACGGAGTCTGTTGGTATGAAAAGGTTTTTTAGTACCGAGAATAGCTATATTGTGTTTGATTCGAGGGTCCGTTGTAGCTTAGTTTGTTTGTTACGCATAGACTTGTGAAGATGAACATGTGTTGTGCAGTTTACTGTGTTTGGAATCTGCTCTGTTCTGTTTAATGCGGAATCTAACAACACTACTCGCTTGTTCTACTGCTAGACCAGAACCGCCGGAAAATAGCCCCAGGAGCATGAGGTTTTTAGTTGGAGGGCTTCGGCTGGTGGAGGATTGATAAAGAATGTCGAGGATGAAGGTCAATATAACTATATGTTTTTACTTTGTGTAAGCTACTCTCATACTTCACGACTGTAAGTATCTTTAGATTAAACTAAACTAATTATCAATTGAAGTGTACTCTTGCAACAGCTGGTTTGCTCTTCCGAACTGCCGGAAGTGGATTGAGGGACTATGGAGACGCTGGTCACTTCCGATGCTTGCCGCAGCTCTTGCAACTTCTTAGAGGACTCTTTACAATGTGAAACCGCAACTGTTGCTGCTAGAAGACGCCGTAAAGAAATTCGCCGTTTCAAGTTGATCACCAACGCTGGTATCTCGGAGCCATCAAGTAAGCGCTTTCGGGCGCTAGAGTGTAACGCGTTTCCTTTGGCGGAAGGTGATGGAGTGGTTTTGTCTCGTAGGCCCAATTGCAACCTGGCTTTGATACCCTCGAAGCAGTGTGCTGACACCGAGGAGCGGACATCTGAAAGCCGTCAGACATTAGGTTGTCCACATGGACGACAAGGTGTCCGATCATCACTGTCAACGTGGGAGAGGACGTCCTTGGGAATTAGTGTTCAAAGTAGCAGTAGCGGAGAGGAGGATAGTGGAAGTAGTAATAGTGGTAGCACTAGTAGTGGAAGCAGCGTAAGCAGTGACAGCTCCGGGACCAGTCTCGAGAGCACAGACGCCGAAGCTGGATCTACAGTTACCTGGACGTTAGATAACACCGGAACCGTGAGTCTTACGGAATCTCAATTGGAAGTTCAAGCAGCTACAACCATGTTGCAATCTCAGGAGACATCAGTTGACAGGTTAAAGGTATCGGCTGCGAGGAACTTTCTCGATGTGGAGGATACCACTATGATTCCCAGCAGCAGCGGTAGTGTGAACGTTATTGACGATGGTCACTGTCCTCCTCATGGGCTTGTATCTGTTTGTGGCCGACGTCGAGAGATGGAGGATGCAGTTGCCGCTGTTCCTGCGTTTTTATCAGTGCCATGCGATGTCACTGGTTGTAATTGCCGAGAGAATTATGGAGTTCATGCCCCTTTACACTTCTTTGGAGTATATGATGGACATGGAGGCTCTCAGGTGAGTAAGAGCTTTCTTCTCCTCTACCTATCTTTTTAGATTGGAGCCTTAAACAAATTATCTCCTGAATCCACACGAAATATTTGTAGTGTTGTTTGTCCTCTAAACCAGATCTGGAAATACCTGCAGGCAGCTGTGTTTTGTGCAGATCGTCTCCATCATGCCCTTGCAGAGGAAATGAAGACTGTTTTGAACTCTGGAAACAGTAGGATGGGATGCTCTCAGGGTAACTGGGATCTTCAATGGCGGAAGGCCATGTCAGCCTGCTTCCTCCGGATGGATGCGGAGGTTGGAGGTGTCCCTTGGAAAGTTGGACAAGCTGATAGTGAAGCTGGAAGTTCCAAGTGCTCAACAGATGCAATCGCTCCAGAGACAGTGGGCTCGACTGCTGTTGTGGCTGTAGTTGGTTCTTCTCAGATTATCGTCGCGAATTGCGGAGATTCACGGGCTGTTCTCTCACGTGGTGGGAGAGCAATTGCACTTTCAAAAGATCACAAGGTATGAAAGTGCAAGTACAATGCTTCAGCAGGGGGTCATATCCATTCAGGGTTGCTGTATTACTGCCTGTCCTTGAACCTGTAGATGCAATTTCGGAAGCATTTTGTAGATGCACTGTATGTGGAGGATTTCTTGTAAGGTCAGAATCATGTCGGTAGACACACCTTCTTTGCAGATACATGAATAATTAAGTATTTTGATAATCTGCAGGTCAGTGAGAGCTCAGTCATTGTTCTGCACTTTATTGAGTGCTTGCACTCGAGAGTCTGAAAAGCCAAATATATATTATCTAGATCTAATAAGTTATATTTTAGACGTGATGTCTGCCTCAATCTTTGTTAAAAATATGAAGATGGAGACAAGTATGTAAAAAATTCTCTCTCTACGTTGATTTGCGCATTGATAGATTTGAAGCTTGCACATCCTGTCGTGAGTACCTGAATGGTTTGTATCACTCTTCTTGTCTCCTCGTTACTTCGATGTCCGCTGCTTATCTGCTTCTTCGACGATCTTCGCTCTGGCCACTGTCTTCCCTCATCCAACTTGCATCGGCCTGGATCGAAACGTGTCATGTTATTTTTAGTTCCCTTTTATTTGTGTCGGACTGGACAGCTTTGAATGGACTTCTTCGAAGCTTCCTTAAAGTATCTTACAGCCCGTTCGCGTCACTACAATATTTCTAAATATTTTTGTAATCTGCAGGTCGGTCACATAAGGGCTTCAGTGTACTGGCACATCTTATTATTCAGCATCAATAGTCTCTTCGCTTGCTCTTCCCTTCCTGGGTACCATTATTGTACCTGTTAAACATTTCTTCTCCAGTCTGTTTTGAGCTTAGTTCCGTTGCATGTGTTTTGTGCGTCATCATACCCACGATTGCCGCTCTCTCTTCTCTCTCAACTTGCGTCTGACTCTACTGCAGAAATTGTCTTGCCTCAAGCTTCGTAGCACCGGGTTGCAGCATTTTGTTACACTTGCATCGCTTGTAATCACGTTTGAAATGAAGGTCACGTTAGGGCCTCCGCTTATCAGCATATCTTTTTTGTTCATTGTTATTGGTGCTCATTTAAGTGTACCTGATCTTGCTTTTAAATCAAGGTTATGAACGCACTTATTTAATATCTAAGGAGAGTGGGTTGATGCACGTTGATGTAACTACATTGGCCACACCCCTTGAATATCCATTGAGCATGCATCAGATCCATAGATTGAAAGAAATCTAACCTTTTACTTTCTTCTTTTTTGTTAGTTCTTGTTTTTTATCCAGGGAAATTCCTGTTAGATTTTCTTAGGAATGATATACCGACGAAGACTTTTGATATCGTTTGTCTTATGATATCTCCATTATTTAATTTGCCTGTCGCAGCCTGAACGCGAAGACGAGATGGCTAGAGTGGAGGCTGCGGGCGGTCGGGTTATCTTTTGGAACGGTTACCGTGTTTTGGGTGTACTCGCTATGTCGAGGGCCATCGGTATGTATGGATTTGTTTGTACGCTGAGTTGGCTTGTAAACTATGCTCTGCACCTGGTGCGTACAGCGTAACGTTTTAGAATCACTCATGCTGTTAGTACCATCGCTTCATCCTGATATTAACCTACTCTTTTGTCAGGGACCCTACTTGAGGAGTATAGAAAATGAATTTAGTAGACGTACCGTATCGGCCCTGAAAGGCTCCGTTATGATTATGATTATTTCGAAGTCTTCCTTTTCCGTTTCAACTTATTTCCTAGTTGTGATAGTTCGCTGGAGGATACTTTGTGTACCGAATCAACACTTGACTGTGTTTCTTACAGCTAGTACATGAAGTTAGAAGTTGTAATTTGGCATTTTTACATGTTTCTAGGATGAGCTGATCCTCGCTGGTTACAACTACTGATGCTGGAATAGTTGTCTTTCACTGGTTTCTGGCATTGCAAGTAGTTTTGTCGCGAAGCTGGATGGATGTTTACCGGTTATCTCTGGTGATATCTGGCTGTCACTTTGCATCAAATAACGCAAAGTTGAGCCTTTGGATTATTTCTAGTCTTTGCATCTTCGTGTATTTTGTGACCATCGTTGTGTTGAGAGGGCAAGCATCTTGGTCCGAACTTATGATTATGTACTGATTGTTTCGAACTCATGTGATTCGACACTTCCTAGATTCGGGTAATATTATACGCGAAAGACCCTTTGGGGTATTGTATCCCTTTGCAATCTGTTGTTATCAATTTTGTTCTCATAATACTCCTGTTTGAAATCGCAATCTTCTGGTTGCCATATACGTGGTGGTCCGACGTCATCCGCCTTCGCTGCTTGTTCCCTTCATTCAACTATAGATAGATCTGGGTGTTAAACAATGAGGTTTACATACTAGTAGACAACTAACAACTGTACGAATTCAACTCCACGCTATTATTTTCCGATAGTTTCTCCACAAATGTGAATTTTTTTCCGCATTTCGTTCGCACTCATCAAGGTTCCGCTTAATATTCTAGGAGGTATAAATACTGTACGATTTGCATTTTTTGCAAATCCGAAATTGGTTCAGACGTTGACAGTGTTGAGGAAATTATCGCCTTTACAGTATGGCCTCTCGTGGGCGGTTTTAGAGTTGATAGTTCGTGTTGTGAAAGTCGTGCTGGGTTATCCTGCCATGGGAATTTCTGAACGTGTTAGGCAGATGAGTCGTGCAATTAGCTTGTATCTCATTTGTATGTCGGGTTGTTTTGTGCTCGGTAAAGCTACCTTGTCTCCTATTTTGCATTAGGGTGGTCTCGTAGTTTCCCTTTTGCACTTGAGATCCATATGAAGTCCCCATGCATTTCCTGGGAAATTCGCTGTCTTGCGACTGCTTTCGTTGGAATTTGAGGCGGGAAGGTGAGTAGGGAGGGGGTTTTTTTACGCGCAACACTTTACAATCTGTAACCTGGTAATATCTATCTTGGTGGGTAAGGTAGAGGGTAAGATGTGTTGATATCATATAATAACTTCTTGAGTCCAACAGCTTCAGGATTTCATCTTTCTCTTTTATTACCTCTCCAGAACGGGGCTGCCAGGGCGAGTGGTTTATGGTATACCGGCTATGACAGGCATGTTGTAGTGAGTACAGTGTACTTCCTTTCTCCTTCTAACACTACCGAACCATGGCTGTTCTACCAGGGAGGGATCATTTTCTTACACTGTTAGACAGGCAATTACTTCTAAGTAATTTTTTTCACTTTTCAAAATAAATTGTCTTTCTGTGTATTGTTCTCTTGAAGAAGTTATCTGTCGTGAGTGTCCCTTTCGGTCAATCCCCTTACAGGACGGTGTTTTTAGATGTTCCGACCCAGTTGTGTTTATTTCGATGGAGTAGAGCGAAACATCGTCTGTTGTCCGACCCAGTCTGTAGTGTCGTGTTTTTTATTAAGCTGTTTGTTTTCTTCCCCTGGACAACGCCTCCAGTGATTTGGGCTGTCGGTATGTCTCTCGCTGTTTATCCTCCGGGTTTTCTGTTTTCCCTAACAACAATATGGTTTTTCTATATTTTCCTGACATATCTGCTTGAACACTAATGGAGGACTTTAGGGGCTATCGGGGTCGTCTTCTTACCGTTGTAGTAAATTGCCTGCATGTATCTGTTGGGAGTGATCGTTCTCTCTGGGATTATTCTCAAAGTCCATTCCACGGCTCCCAGATTTACTAAATTGGATAGGAGAGTTTAAGGACGTCCCTAACTTTCATATCTAGTATTAAATCTGTACTTTTACTTCAGATTAAATCCAACTACCCCTATCTCATTGTTGATTTTTTTTTATCTAGGAGTGTGTTTTGGTTGAACTTTCGCTCAACTCTTCGTGATTTTCACGTTCTTATTTTTCTCAATCTGTAGATTAAGAGAGAAAATCATTAGAGAAAAGAAGTAGTGACCAAGCTAGAAGTAAGAGCACCTTTCCCTCCTCGCTTTCGAAGTTTGTCCCAAGGTTAGTAATATTTGTGACAAAATTCTTAGACATCACTTTCTCGTCGCCGATTATTAGCTCTTGGGATTGAATTTTTACCGCCGAATTCTTAGAATGATACGAAATCCTAATTCTACATTCAGATCTGGGGGCGCCGAATGCTTCAAATTTGTCAGTTGTGTTGTGTCCATTTTCTACAGCAGTTACTCAATTGTTCCGTCAAGTTTTTGCTCAATTTTGAGGTATGGCTATTGCACAGTTTGTGTTCGACTAATTTCTAGCCAAGGAAGAATGATTTCTCTTTCTTCTTCCATATTTTGTTCCGAAGACGAGGAAAGAAACCATTGATCGTCGTTGACTGACTTGAAATCTAGCGCCATAAAACTGACATCAGACTTCAGACGCACTGAACGTATCAGATGTTGGGACAGCCGGGGCGAGTGTAAACACACTCTCATGATCTACGCTGTTTTCAGACTGTGGACTCGCGCGGGAAGAGCCCACGCTAGGACATCCTAAGACCAGGAGATACGCAGATTATTCTCCCCATTTCTGGGCTTCTAGTAGAGATTCGAATGAATTGGTATCAGTAAGCGTGGGAATGTCATTGTAATGCCCTTGTACAAGGTTGTTATATTTTCATCATGGTGGACAATCCGCATTGATGAGGATCTACTTTGAACTTTGTTCTCAGCTTGCCTCTTACCTTCAACCCGGTCACCGTTGAAGGTTTCTAAATCATAAATCAAACTTCTGTGTTGAGCTTTCGTTAGAGGAAGAATATAAATGAGTGCACCTTCCTTCATTACCATCTTGATAATGCTTGATGCCGCCTGATATCTCTTTGTCAAAAGGTTCATCAATGGTTTATACTGAACAATTTTCTGTTCTACATGTGCAGGTGATAGATATCTCAAGCCCTTCGTGATCGCGGAGCCAGAGGTCACTTGCACCGTGCGATCGGAAGATGATGAATGTTTGATCTTGGCTAGTGATGGTTTGTGGGATGTTTTATCGAACGAACTGGTTTGCGAAATAGCGCGCAAGTGCTTGATTGGTCGTCGAAATAGTGATCTTGCATTGAGTGTGCGTTCTGGGTTGGACGAAGAAACAGGGGAGTCCCCTGCCTCTGTGGCGGCTGCACTTCTTACCAAGCTCGCCCTAGCACGAGGCAGTAGTGACAACATTAGTGTAGTAGTTGTTGACTTAACGACGGGATCTTCGGCGTAGTTTGTCTAGTTTGCCCTCTCGGAATAAACTTTGATAACTGACTTGATTATTGTGAGAAAGGTATATCTCGCATATGGTTTTGTCGGAAAAAACTCATATATCCGGGATTATCTGCGACATTCTAGAAGTTGCGGCAGCTCGGAACGGGTTTCTAAAATATGTAATAGCTTATATTTGTTTTCTGCTTATCAAGGCGAAACTTAAATGAGAATAAAACCTTTCTGCTAAAGTGTGAACTGTTTTATTGGTGAAGGGCTGACATTTCGTTCAGCCTGCAATGTAGATTTCGCTGCTAATTCTAGAAAGGTAGAAAGGACTTCTGGATTTATTACTGAGAGCAAATGTACATTGTTCACGATGCGTTGGTCGAG

mRNA

>MapolyY_A0044.1
TTCTTAGCTTAGGTCATGAAAAGGAGTAATCGATAAATCTCTGCCAAGACTCAGACACATGCACTACCTATTCTCGACAGGAAACGTCTTCGAACGCAAGGAAAGATTGAGTTTGTGTCCATGTGCGCTCCTCGGCGTCATAATGTAGTAGTATGCAGTCCCGATCATGCGGCCTGTATCCGACTTGACGCTTAGTGCGAACACCCTTCCAAAACAGGACGCGCTGCCTGAGAGTTTACATCAAGATTGGAACGGCGGGTCGCTTGTCCTCTTAAGAACCGCCGGAAAATAGCCCCAGGAGCATGAGGTTTTTAGTTGGAGGGCTTCGGCTGGTGGAGGATTGATAAAGAATGTCGAGGATGAAGCTGGTTTGCTCTTCCGAACTGCCGGAAGTGGATTGAGGGACTATGGAGACGCTGGTCACTTCCGATGCTTGCCGCAGCTCTTGCAACTTCTTAGAGGACTCTTTACAATGTGAAACCGCAACTGTTGCTGCTAGAAGACGCCGTAAAGAAATTCGCCGTTTCAAGTTGATCACCAACGCTGGTATCTCGGAGCCATCAAGTAAGCGCTTTCGGGCGCTAGAGTGTAACGCGTTTCCTTTGGCGGAAGGTGATGGAGTGGTTTTGTCTCGTAGGCCCAATTGCAACCTGGCTTTGATACCCTCGAAGCAGTGTGCTGACACCGAGGAGCGGACATCTGAAAGCCGTCAGACATTAGGTTGTCCACATGGACGACAAGGTGTCCGATCATCACTGTCAACGTGGGAGAGGACGTCCTTGGGAATTAGTGTTCAAAGTAGCAGTAGCGGAGAGGAGGATAGTGGAAGTAGTAATAGTGGTAGCACTAGTAGTGGAAGCAGCGTAAGCAGTGACAGCTCCGGGACCAGTCTCGAGAGCACAGACGCCGAAGCTGGATCTACAGTTACCTGGACGTTAGATAACACCGGAACCGTGAGTCTTACGGAATCTCAATTGGAAGTTCAAGCAGCTACAACCATGTTGCAATCTCAGGAGACATCAGTTGACAGGTTAAAGGTATCGGCTGCGAGGAACTTTCTCGATGTGGAGGATACCACTATGATTCCCAGCAGCAGCGGTAGTGTGAACGTTATTGACGATGGTCACTGTCCTCCTCATGGGCTTGTATCTGTTTGTGGCCGACGTCGAGAGATGGAGGATGCAGTTGCCGCTGTTCCTGCGTTTTTATCAGTGCCATGCGATGTCACTGGTTGTAATTGCCGAGAGAATTATGGAGTTCATGCCCCTTTACACTTCTTTGGAGTATATGATGGACATGGAGGCTCTCAGGCAGCTGTGTTTTGTGCAGATCGTCTCCATCATGCCCTTGCAGAGGAAATGAAGACTGTTTTGAACTCTGGAAACAGTAGGATGGGATGCTCTCAGGGTAACTGGGATCTTCAATGGCGGAAGGCCATGTCAGCCTGCTTCCTCCGGATGGATGCGGAGGTTGGAGGTGTCCCTTGGAAAGTTGGACAAGCTGATAGTGAAGCTGGAAGTTCCAAGTGCTCAACAGATGCAATCGCTCCAGAGACAGTGGGCTCGACTGCTGTTGTGGCTGTAGTTGGTTCTTCTCAGATTATCGTCGCGAATTGCGGAGATTCACGGGCTGTTCTCTCACGTGGTGGGAGAGCAATTGCACTTTCAAAAGATCACAAGCCTGAACGCGAAGACGAGATGGCTAGAGTGGAGGCTGCGGGCGGTCGGGTTATCTTTTGGAACGGTTACCGTGTTTTGGGTGTACTCGCTATGTCGAGGGCCATCGGTGATAGATATCTCAAGCCCTTCGTGATCGCGGAGCCAGAGGTCACTTGCACCGTGCGATCGGAAGATGATGAATGTTTGATCTTGGCTAGTGATGGTTTGTGGGATGTTTTATCGAACGAACTGGTTTGCGAAATAGCGCGCAAGTGCTTGATTGGTCGTCGAAATAGTGATCTTGCATTGAGTGTGCGTTCTGGGTTGGACGAAGAAACAGGGGAGTCCCCTGCCTCTGTGGCGGCTGCACTTCTTACCAAGCTCGCCCTAGCACGAGGCAGTAGTGACAACATTAGTGTAGTAGTTGTTGACTTAACGACGGGATCTTCGGCGTAGTTTGTCTAGTTTGCCCTCTCGGAATAAACTTTGATAACTGACTTGATTATTGTGAGAAAGGTATATCTCGCATATGGTTTTGTCGGAAAAAACTCATATATCCGGGATTATCTGCGACATTCTAGAAGTTGCGGCAGCTCGGAACGGGTTTCTAAAATATGTAATAGCTTATATTTGTTTTCTGCTTATCAAGGCGAAACTTAAATGAGAATAAAACCTTTCTGCTAAAGTGTGAACTGTTTTATTGGTGAAGGGCTGACATTTCGTTCAGCCTGCAATGTAGATTTCGCTGCTAATTCTAGAAAGGTAGAAAGGACTTCTGGATTTATTACTGAGAGCAAATGTACATTGTTCACGATGCGTTGGTCGAG

CDS

>MapolyY_A0044.1
ATGGAGACGCTGGTCACTTCCGATGCTTGCCGCAGCTCTTGCAACTTCTTAGAGGACTCTTTACAATGTGAAACCGCAACTGTTGCTGCTAGAAGACGCCGTAAAGAAATTCGCCGTTTCAAGTTGATCACCAACGCTGGTATCTCGGAGCCATCAAGTAAGCGCTTTCGGGCGCTAGAGTGTAACGCGTTTCCTTTGGCGGAAGGTGATGGAGTGGTTTTGTCTCGTAGGCCCAATTGCAACCTGGCTTTGATACCCTCGAAGCAGTGTGCTGACACCGAGGAGCGGACATCTGAAAGCCGTCAGACATTAGGTTGTCCACATGGACGACAAGGTGTCCGATCATCACTGTCAACGTGGGAGAGGACGTCCTTGGGAATTAGTGTTCAAAGTAGCAGTAGCGGAGAGGAGGATAGTGGAAGTAGTAATAGTGGTAGCACTAGTAGTGGAAGCAGCGTAAGCAGTGACAGCTCCGGGACCAGTCTCGAGAGCACAGACGCCGAAGCTGGATCTACAGTTACCTGGACGTTAGATAACACCGGAACCGTGAGTCTTACGGAATCTCAATTGGAAGTTCAAGCAGCTACAACCATGTTGCAATCTCAGGAGACATCAGTTGACAGGTTAAAGGTATCGGCTGCGAGGAACTTTCTCGATGTGGAGGATACCACTATGATTCCCAGCAGCAGCGGTAGTGTGAACGTTATTGACGATGGTCACTGTCCTCCTCATGGGCTTGTATCTGTTTGTGGCCGACGTCGAGAGATGGAGGATGCAGTTGCCGCTGTTCCTGCGTTTTTATCAGTGCCATGCGATGTCACTGGTTGTAATTGCCGAGAGAATTATGGAGTTCATGCCCCTTTACACTTCTTTGGAGTATATGATGGACATGGAGGCTCTCAGGCAGCTGTGTTTTGTGCAGATCGTCTCCATCATGCCCTTGCAGAGGAAATGAAGACTGTTTTGAACTCTGGAAACAGTAGGATGGGATGCTCTCAGGGTAACTGGGATCTTCAATGGCGGAAGGCCATGTCAGCCTGCTTCCTCCGGATGGATGCGGAGGTTGGAGGTGTCCCTTGGAAAGTTGGACAAGCTGATAGTGAAGCTGGAAGTTCCAAGTGCTCAACAGATGCAATCGCTCCAGAGACAGTGGGCTCGACTGCTGTTGTGGCTGTAGTTGGTTCTTCTCAGATTATCGTCGCGAATTGCGGAGATTCACGGGCTGTTCTCTCACGTGGTGGGAGAGCAATTGCACTTTCAAAAGATCACAAGCCTGAACGCGAAGACGAGATGGCTAGAGTGGAGGCTGCGGGCGGTCGGGTTATCTTTTGGAACGGTTACCGTGTTTTGGGTGTACTCGCTATGTCGAGGGCCATCGGTGATAGATATCTCAAGCCCTTCGTGATCGCGGAGCCAGAGGTCACTTGCACCGTGCGATCGGAAGATGATGAATGTTTGATCTTGGCTAGTGATGGTTTGTGGGATGTTTTATCGAACGAACTGGTTTGCGAAATAGCGCGCAAGTGCTTGATTGGTCGTCGAAATAGTGATCTTGCATTGAGTGTGCGTTCTGGGTTGGACGAAGAAACAGGGGAGTCCCCTGCCTCTGTGGCGGCTGCACTTCTTACCAAGCTCGCCCTAGCACGAGGCAGTAGTGACAACATTAGTGTAGTAGTTGTTGACTTAACGACGGGATCTTCGGCGTAG

Protein

>MapolyY_A0044.1
METLVTSDACRSSCNFLEDSLQCETATVAARRRRKEIRRFKLITNAGISEPSSKRFRALECNAFPLAEGDGVVLSRRPNCNLALIPSKQCADTEERTSESRQTLGCPHGRQGVRSSLSTWERTSLGISVQSSSSGEEDSGSSNSGSTSSGSSVSSDSSGTSLESTDAEAGSTVTWTLDNTGTVSLTESQLEVQAATTMLQSQETSVDRLKVSAARNFLDVEDTTMIPSSSGSVNVIDDGHCPPHGLVSVCGRRREMEDAVAAVPAFLSVPCDVTGCNCRENYGVHAPLHFFGVYDGHGGSQAAVFCADRLHHALAEEMKTVLNSGNSRMGCSQGNWDLQWRKAMSACFLRMDAEVGGVPWKVGQADSEAGSSKCSTDAIAPETVGSTAVVAVVGSSQIIVANCGDSRAVLSRGGRAIALSKDHKPEREDEMARVEAAGGRVIFWNGYRVLGVLAMSRAIGDRYLKPFVIAEPEVTCTVRSEDDECLILASDGLWDVLSNELVCEIARKCLIGRRNSDLALSVRSGLDEETGESPASVAAALLTKLALARGSSDNISVVVVDLTTGSSA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>