Mp1g06440



Description

Annotation

Database ID Description
MapolyID Mapoly0043s0036 -

Nomenclature

Gene symbol Product Transcript ID Status
MpFRH1 miRNA Published
Negatively regulates the RSL class I gene MpRSL1

Associated Literature (AI-based literature mining, Beta-version)

Identified by forward-genetic screen of few rhizoids T-DNA mutants and confirmed as a 21-nt miRNA (UGUGUGAGAAGAGGCCAAUGU); overexpression caused very few or no rhizoids in 88/103 plants. Acts as a negative regulator of rhizoid/gemma/mucilage-papilla development by cleaving MpRSL1 mRNA, with a target site 100% conserved across twelve liverworts.

3 core 7 peripheral

Mercadal J, Ferreira-Guerra M, Caño-Delgado AI, Ibañes M. (2026) · Cell reports  research experimental subject
The microRNA FRH1 (MpFRH1) mediates lateral inhibition by repressing RSL1; modeling shows FRH1 diffusion/mobility generates a diffusion-driven switch with a sharp transition between uniform and patterned states, associated with a subcritical Turing bifurcation at criticality.
Thamm, A., et al. (2019) · BioRxiv  research experimental subject
FEW RHIZOIDS1 miRNA; a repressor that inhibits MpRSL1 activity, mediating lateral inhibition to control rhizoid cell patterning. Mpfrh1 loss elevates MpRSL1 and rhizoid numbers.
Honkanen, S., et al. (2018) · eLIFE  research experimental subject
Identified by forward-genetic screen of few rhizoids T-DNA mutants and confirmed as a 21-nt miRNA (UGUGUGAGAAGAGGCCAAUGU); overexpression caused very few or no rhizoids in 88/103 plants. Acts as a negative regulator of rhizoid/gemma/mucilage-papilla development by cleaving MpRSL1 mRNA, with a target site 100% conserved across twelve liverworts.
Aggarwal, B., et al. (2024) · RNA Biology  research citation background
Cited from prior work as FEW RHIZOIDS1, characterized for rhizoid and gemma production control.
Pietrykowska, H., et al. (2023) · Plant Molecular Biology  review citation background
miRNA/tasiRNA target module (Pietrykowska 2023)

Transcript models

Transcript ID Location Sequences Extract region
Mp1g06440.1 chr1:6974604..6978527 (+) Gene /  mRNA /  CDS /  Protein
FASTA / GenBank (with flanking bases)

Expression Level powered by MBEX

Link to the original image in MBEX

Single-cell expression scRNA-seq atlas from Wang et al., 2023

Expression of Mp1g06440 across the single-cell RNA-seq atlas. Cluster identities (right) annotate the same UMAP used for the feature plot (left).

Feature plot of Mp1g06440 on UMAP
Feature plot (Seurat scale expression level).
UMAP cluster annotation
Cell-type annotation of the UMAP clusters.
Violin plot by developmental stage
Violin plot by stage. Expression across developmental time points (D0–D31).
Violin plot by cell cluster
Violin plot by cluster. Expression across cell clusters (1–21).

Gene structure:

Sequences:

Gene UTR + CDS + intron

FASTA

mRNA UTR + CDS

FASTA

CDS

FASTA

Protein

FASTA


MarpolBase / Genome Informatics Lab. NIG.